ID: 984745101

View in Genome Browser
Species Human (GRCh38)
Location 4:183207591-183207613
Sequence CTGTATTAGGTGAATGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984745095_984745101 22 Left 984745095 4:183207546-183207568 CCAACTTTGATTAGTGCTGATGC 0: 1
1: 0
2: 0
3: 3
4: 91
Right 984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG 0: 1
1: 0
2: 0
3: 20
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984745101 Original CRISPR CTGTATTAGGTGAATGAAGG TGG Intronic
903825910 1:26145728-26145750 CTGTATCTGGTGATTGAAGGAGG - Intergenic
907788661 1:57639643-57639665 CAGTATTTGTTGAATGAAAGAGG - Intronic
909996808 1:82289989-82290011 CTTTAATAGGTGATTGAAGGTGG - Intergenic
913976894 1:143466722-143466744 CTATATTGGGAGAAGGAAGGAGG + Intergenic
914071296 1:144292349-144292371 CTATATTGGGAGAAGGAAGGAGG + Intergenic
914107859 1:144674006-144674028 CTATATTGGGAGAAGGAAGGAGG - Intergenic
916153375 1:161818986-161819008 CTGTATTAGGAGAGTGGAAGAGG + Intronic
916321347 1:163508181-163508203 CTGTATTAGGGAAATGAAATAGG + Intergenic
917902254 1:179554489-179554511 CTGTATTTGGGGAATCAAAGTGG - Exonic
921259713 1:213375416-213375438 CTGTTGTAAGTGAATTAAGGTGG + Intergenic
922354893 1:224766368-224766390 CTGTGTTAGGTCAATGCATGGGG + Intergenic
923759869 1:236832291-236832313 CTGCATTTGGTGTATGAAGTAGG + Intronic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1066593781 10:37025739-37025761 CTGTATGAGGAGAATTTAGGTGG + Intergenic
1069830744 10:71280849-71280871 CTCTGTCAGGTGACTGAAGGGGG - Intronic
1070424682 10:76273779-76273801 CTGGATCAGGTGAATGAAAAGGG + Intronic
1070672009 10:78384443-78384465 CTTTATGAGGTGATTCAAGGTGG - Intergenic
1073621350 10:105052255-105052277 CTGGATTAGGTGAGTGGATGTGG - Intronic
1073675899 10:105646756-105646778 CTGGAGGAGGTGACTGAAGGTGG + Intergenic
1080875888 11:36274017-36274039 CTGCATTAGATGAAGGAAGAGGG + Exonic
1085072809 11:73563176-73563198 CTGCCTTAGGTGAATGATAGAGG - Intronic
1085501729 11:77030637-77030659 CTGGATGAGAAGAATGAAGGGGG - Intergenic
1087306204 11:96491922-96491944 CTGTATAAGGTGTAAGAAAGGGG - Intronic
1087473607 11:98608101-98608123 CTGTAGTAGTTGAATGCATGAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1091452251 12:580165-580187 CTGTATAAAGTGTATAAAGGGGG + Intronic
1091950655 12:4590432-4590454 CTGTATCAGGTGAGTGCAGACGG + Exonic
1093197119 12:16142640-16142662 CTATACTAGGAGAGTGAAGGAGG + Intergenic
1096591448 12:52662579-52662601 GGGAATTAGGTGAATGAGGGTGG - Intergenic
1096596335 12:52698146-52698168 CTCTATGATGTAAATGAAGGAGG - Intronic
1097606725 12:61764122-61764144 CAGTATGAGGTAAATGTAGGAGG - Intronic
1100706041 12:97201517-97201539 TTGTATTTGATGAGTGAAGGTGG + Intergenic
1101248442 12:102908052-102908074 CTGTATTGGGTGATTGAAGAAGG - Intronic
1105052383 12:133066270-133066292 CTGTATTCAGTGACTGAAAGAGG - Intergenic
1105222334 13:18343087-18343109 CTATATTGGGAGAAGGAAGGAGG - Intergenic
1106256306 13:28025316-28025338 CTGTATTATGTGAGGGAAAGTGG - Intronic
1107370988 13:39747443-39747465 ATGTATTACATGAATGAAGGAGG - Intronic
1108830968 13:54477722-54477744 CAGTATTTGGTAAATGAACGGGG + Intergenic
1110629804 13:77695855-77695877 CCATATTGGGTAAATGAAGGAGG + Intergenic
1111453517 13:88449849-88449871 CTGGAGGAGATGAATGAAGGAGG - Intergenic
1111767032 13:92544845-92544867 CTTTTTTATGTGAATGAAGGGGG + Intronic
1114132755 14:19811673-19811695 CTATATTCACTGAATGAAGGTGG + Intronic
1114247925 14:20932362-20932384 CTGTTTTAGGTTAATGAATGGGG + Intergenic
1114250755 14:20958464-20958486 CTGTTTTAGGTTAATGCATGAGG + Intergenic
1114597346 14:23925050-23925072 CAGTATTTGGTGACTGATGGGGG - Intergenic
1119826803 14:77663539-77663561 CTGTGTTAGGTGAATGTAACAGG - Intergenic
1121112540 14:91322117-91322139 CTGGGTTGGGTAAATGAAGGGGG - Intronic
1123575843 15:21667539-21667561 CTATATTCACTGAATGAAGGTGG + Intergenic
1123612463 15:22110010-22110032 CTATATTCACTGAATGAAGGTGG + Intergenic
1123727329 15:23116774-23116796 CTGTATTTGGAGATTTAAGGGGG - Intergenic
1124683159 15:31754902-31754924 CTGGAGTAGGGGTATGAAGGAGG + Intronic
1128601932 15:69002298-69002320 TGCTATTAGGTGAATGAAGTGGG - Intronic
1202984711 15_KI270727v1_random:401784-401806 CTATATTCACTGAATGAAGGTGG + Intergenic
1134233088 16:12444542-12444564 CTGGATTAGGTGGGTGTAGGGGG + Intronic
1136072547 16:27796678-27796700 CTGTTTTAGGAGATTGAATGGGG + Intronic
1137927417 16:52553768-52553790 TTGTTGTGGGTGAATGAAGGAGG - Intergenic
1138848138 16:60592345-60592367 TTGTATTAAGTGAAAGAAGATGG + Intergenic
1140726429 16:77817283-77817305 CTGCATGACATGAATGAAGGGGG - Intronic
1141067715 16:80927411-80927433 TTGGAGGAGGTGAATGAAGGAGG + Intergenic
1146317330 17:31818363-31818385 CTGTGCCAGGTGAATGGAGGGGG + Intergenic
1150224345 17:63515292-63515314 CTGTATTCTTTGAATGATGGAGG - Intronic
1158856692 18:61549964-61549986 CTGTGTTATCTGAAAGAAGGAGG - Exonic
1159992810 18:74930084-74930106 CTGAATTCTGGGAATGAAGGAGG - Intronic
1164037979 19:21470432-21470454 CTGTACTGGGAGAATGGAGGAGG + Intronic
930803788 2:55469875-55469897 CTGTATTAGTAGAATGAAATGGG + Intergenic
931292273 2:60883140-60883162 CTGTACTAAGAGAATGAAGAGGG + Intronic
933160325 2:79016698-79016720 CTGTATTATGAGTATGAATGAGG + Intergenic
933324662 2:80820097-80820119 TTGTATAAGGTGTAAGAAGGAGG - Intergenic
933331441 2:80897274-80897296 CTGTGGTAGGTGAATGGAGTAGG - Intergenic
934135779 2:88995141-88995163 TTATATGAGGAGAATGAAGGAGG - Intergenic
934181596 2:89627706-89627728 CTATATTGGGAGAAGGAAGGAGG + Intergenic
934234536 2:90218634-90218656 TTATATGAGGAGAATGAAGGAGG + Intergenic
934291898 2:91701926-91701948 CTATATTGGGAGAAGGAAGGAGG + Intergenic
935748220 2:106208290-106208312 CTGTAATAGGTGAAAGAAAGAGG + Intergenic
936593329 2:113824574-113824596 CTTCATTTGGTAAATGAAGGAGG + Intergenic
939403893 2:141731119-141731141 CTGTATTATGAAAATAAAGGAGG - Intronic
939488501 2:142847682-142847704 CTGAAGTAGGTGGATGAATGGGG + Intergenic
939903094 2:147874920-147874942 CTGTACTAGGTGAGTCTAGGTGG + Intronic
940369759 2:152888101-152888123 ATGTATTAGGAGACTGAAAGTGG - Intergenic
942206825 2:173627405-173627427 ATTTATTAGGTGAATAAAAGGGG + Intergenic
943100579 2:183481060-183481082 CTGTATAAGGTGTAGGAAAGGGG - Intergenic
943256569 2:185601177-185601199 CTGTGGAAAGTGAATGAAGGGGG + Intergenic
943559633 2:189445220-189445242 ATGTATTAGCTGAATGATGTTGG - Intronic
944291852 2:198017010-198017032 CGGTAATAGGGGAATGAAGGTGG + Intronic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945320401 2:208415384-208415406 CGGTAGTAGGTGAATGAATGTGG - Intronic
945675531 2:212851353-212851375 CTGCATTAGGAGGATGAAGGAGG + Intergenic
947185322 2:227449901-227449923 CTGTCTTAGGCAAATGACGGAGG - Intergenic
947927724 2:233936285-233936307 CAGTATCTGTTGAATGAAGGTGG + Intronic
948126079 2:235565381-235565403 CTGTTTTATAGGAATGAAGGGGG + Intronic
1170831484 20:19845900-19845922 CTGTATAAGGTTTATGAAAGGGG + Intergenic
1172951888 20:38727569-38727591 CTGTACGAGGAGAATGAAGACGG + Exonic
1176730882 21:10495511-10495533 CTATATTGGGAGAAGGAAGGAGG - Intergenic
1177048280 21:16199582-16199604 CTGAATTAGGTGAATGGTGTAGG - Intergenic
1177819929 21:26020154-26020176 CTGTGTTAAGTGAAAGAAGTCGG + Intronic
1178753854 21:35329005-35329027 ACATATTAGTTGAATGAAGGAGG - Intronic
1180059125 21:45375611-45375633 CTGCATTTGGGGAATGGAGGAGG + Intergenic
1181455298 22:23056125-23056147 CTGGAGCAGGTGAATGAAGGGGG + Intergenic
1184940512 22:47761403-47761425 CACTCTTAGGTGAAAGAAGGGGG + Intergenic
951758883 3:26123145-26123167 TTGTATAAGGTGAATGCAAGGGG - Intergenic
952492893 3:33888710-33888732 CTATATTGGGTGCATGAGGGTGG - Intergenic
953298488 3:41747631-41747653 CTGTATTTGGAGATTTAAGGGGG + Intronic
953394022 3:42552403-42552425 CTGGAGTAGGTGAATGAACATGG - Intronic
955324452 3:57999207-57999229 CTGTGGTAAGAGAATGAAGGCGG - Intergenic
956323216 3:68022360-68022382 CAGTGTTAGGTAAATGAAGTGGG + Intronic
959093195 3:101925825-101925847 CTCTATTAAGTGAATGAGGGGGG + Intergenic
962041853 3:131715713-131715735 CTGTCTTTGGTGGATGAAGTGGG + Intronic
962393543 3:134993811-134993833 CTGTAAGATGTGAATGAAGCTGG - Intronic
964212125 3:154240006-154240028 CTCTATTTGCAGAATGAAGGAGG - Intronic
965157869 3:165087805-165087827 CTGAATAAGGTAAATAAAGGAGG - Intergenic
965270106 3:166604288-166604310 TTGTATTAGGTGAATAAAAGAGG + Intergenic
967662847 3:192134347-192134369 CTGAATTAGGTTAATAAATGTGG - Intergenic
969183854 4:5461285-5461307 CCGTATTATGTGAATGGAGGTGG + Intronic
969248391 4:5951322-5951344 CTGCATTGAGGGAATGAAGGGGG + Intronic
970913224 4:21303732-21303754 ATGTCTTAGGTGAATGTAAGAGG - Intronic
971048320 4:22831163-22831185 CTTAATTAGGGGAATGAAGTGGG - Intergenic
972886359 4:43494466-43494488 TTTTATTAGGTGAATGAATATGG - Intergenic
973955797 4:56061484-56061506 ATGTATTAGGTGAAAGAGTGGGG + Intergenic
974117915 4:57603368-57603390 CTGTTGTAGTTGAATGAATGTGG + Intergenic
974516884 4:62927109-62927131 CTTTATTAGGTGAATGGCGTTGG + Intergenic
974863137 4:67547913-67547935 CTGTACTAAGTGAAAGAAGCTGG + Intergenic
976386388 4:84464210-84464232 CTGTAATACGAAAATGAAGGAGG + Intergenic
977547637 4:98403062-98403084 CTGTATAATGTGTATGTAGGAGG - Intronic
978850949 4:113335806-113335828 CTTTGCTATGTGAATGAAGGTGG + Intronic
982594863 4:157368346-157368368 CTGAATTAGCTGAATGAATTTGG + Intergenic
983329487 4:166306393-166306415 TTGTATAAGGTGAAAGAAGGGGG - Intergenic
983851850 4:172590634-172590656 CTGTAATGGGGGAATGTAGGCGG + Intronic
983975533 4:173929202-173929224 CTGCATAAGGAGAAAGAAGGTGG - Intergenic
984745101 4:183207591-183207613 CTGTATTAGGTGAATGAAGGTGG + Intronic
985297661 4:188453050-188453072 CTGTATTAGGAGATTGAATTGGG + Intergenic
986660080 5:10051787-10051809 CTCTATTAGGGCAATGCAGGGGG - Intergenic
988729855 5:33961306-33961328 TTTTATTAGGTGGATGATGGAGG - Intronic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989371994 5:40720632-40720654 GTGTATTTGTTGGATGAAGGAGG - Intronic
994557969 5:101329269-101329291 CTGTATTACTTGAATAAAGGAGG - Intergenic
996958788 5:129218457-129218479 GTGTATTAGGTAGATGATGGTGG + Intergenic
1001317094 5:170651326-170651348 CTGTATCAGGGGAAGGCAGGTGG + Intronic
1001380644 5:171304371-171304393 CTGTGGCAGGTGAATGAATGAGG - Intergenic
1003153313 6:3571048-3571070 CTGTAGTAGATGAATGACAGAGG + Intergenic
1004381913 6:15139800-15139822 CTGAAGTAGGTGGATGAAGTAGG - Intergenic
1005493763 6:26370641-26370663 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1005498317 6:26407990-26408012 CTGTGGCAGTTGAATGAAGGGGG + Intronic
1008716211 6:54293187-54293209 CTGTATTAGGTAGATGATTGAGG - Intergenic
1009689370 6:67008494-67008516 CAGTATTTGTTAAATGAAGGTGG - Intergenic
1009894492 6:69731095-69731117 CTGTGTTAGGTGAAATAAGCTGG - Intronic
1009976225 6:70674011-70674033 CTGTTATAGGTTAATAAAGGTGG - Intronic
1013703853 6:112808744-112808766 CTGTAATGAGTGAATGCAGGAGG - Intergenic
1013910716 6:115272765-115272787 CTCTATTAGGGCAATGAAGAGGG + Intergenic
1014699508 6:124666293-124666315 CTGAAATAGGAGAATGAAGGTGG + Intronic
1015429233 6:133110834-133110856 CTGTATTGGGTGGGTGGAGGTGG + Intergenic
1015657144 6:135531781-135531803 TTTTAATAGGTGAATGAATGGGG - Intergenic
1015780136 6:136856745-136856767 CCAGATTAGGTGAATGTAGGTGG + Intronic
1016473503 6:144400693-144400715 CTGTATCAAGAGAATGAATGCGG + Intronic
1016810718 6:148258777-148258799 ATGTATAAGGGGAATGAAAGAGG - Intergenic
1016884245 6:148944123-148944145 ATTTATTAGAGGAATGAAGGGGG + Intronic
1022851569 7:34268309-34268331 CTGTACTAGGTGACTATAGGAGG - Intergenic
1028367127 7:90046586-90046608 CAGTATTTGTTGAATGAAAGTGG - Intergenic
1029379979 7:100207002-100207024 CTGTACTAAGTGAAAGAAGCTGG - Intronic
1035445244 7:158936804-158936826 CTGTATTTAGTGATTGAGGGAGG - Intronic
1037680635 8:21094632-21094654 CTGTATTATGTGAGAGAAGTAGG - Intergenic
1041403275 8:57467191-57467213 CTGTAATTGTTGAATGAAGATGG - Intergenic
1042732153 8:71947940-71947962 CTGGATGAGTTGGATGAAGGTGG + Intronic
1044994189 8:97823254-97823276 GTGTAGTAGGTGAATGCATGTGG + Intronic
1048489780 8:134881962-134881984 CTGTCTTAGGTTAACTAAGGAGG - Intergenic
1051006429 9:12350942-12350964 CTGTACATGGTGAATGAAAGTGG - Intergenic
1051339631 9:16099614-16099636 TTGTAGGAGGTGCATGAAGGGGG + Intergenic
1051533953 9:18136075-18136097 CAGTATTATGTGACTGAGGGAGG - Intergenic
1052037436 9:23698730-23698752 CTTTATCAGGTGAAAGAAGAAGG + Intronic
1052138251 9:24942875-24942897 CTCTATCAGGTGATTGAGGGAGG - Intergenic
1052326372 9:27220284-27220306 CAGTATTAGGTGAATAAAAGGGG - Intronic
1057074908 9:92133507-92133529 CTGAATGGGCTGAATGAAGGAGG + Intergenic
1058606162 9:106725886-106725908 CTTTTTTAAGAGAATGAAGGAGG + Intergenic
1187296451 X:18005944-18005966 CCATATTAGGTGACTGATGGAGG + Intergenic
1189528602 X:41854493-41854515 CTGTAATAAGCGAATGAAGGTGG - Intronic
1190223545 X:48528775-48528797 CTGGAATAAGTGAATGATGGTGG - Intergenic
1190639463 X:52468837-52468859 CTGTATTCAGAGAATGATGGTGG - Intergenic
1193080389 X:77400615-77400637 CTGTATTAAGAAAATGAATGTGG - Intergenic
1193552831 X:82919678-82919700 CTGTATAAGGTGTATGAAAGGGG + Intergenic
1194192336 X:90853072-90853094 TTGTATATGGTGAATGAAAGGGG + Intergenic
1197221992 X:123923044-123923066 CTGTGCAAGGTGAATGATGGAGG + Intergenic
1199799910 X:151240323-151240345 CTGTATTAGGAAAAGGAGGGAGG - Intergenic
1200140110 X:153896570-153896592 CTGTAACTGGTGAATGAAGCAGG + Intronic
1200538971 Y:4435523-4435545 TTGTATATGGTGAATGAAAGGGG + Intergenic
1201669294 Y:16499529-16499551 CTGAGTTGGGTGGATGAAGGGGG + Intergenic