ID: 984748522

View in Genome Browser
Species Human (GRCh38)
Location 4:183248514-183248536
Sequence CGCTTCCAAAGTCACATGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984748522 Original CRISPR CGCTTCCAAAGTCACATGTA TGG Intronic
903175006 1:21575509-21575531 CGGTGCCAAAGGCACATGCATGG - Intronic
905318430 1:37098303-37098325 CTCCTCCAAAGACACATGCAGGG + Intergenic
911713295 1:101099385-101099407 AGTTTCCAATTTCACATGTAAGG - Intergenic
923838392 1:237640484-237640506 GGCATACAAGGTCACATGTAAGG - Intronic
1065772794 10:29093261-29093283 CGCTTCCAAGTTCACCTTTATGG + Intergenic
1068612791 10:59078730-59078752 CCATTCCAAAATCACATGGACGG - Intergenic
1070508643 10:77139842-77139864 CGCTCCCATGGTCAAATGTAAGG + Intronic
1071176600 10:82933417-82933439 CACTTCCCAAGTCTCAGGTATGG + Intronic
1072825541 10:98602362-98602384 CCCTTCCAAAGCCCCATGTCAGG - Intronic
1088990072 11:114945978-114946000 AGGTTGCAAAGTCACCTGTAAGG + Intergenic
1089906810 11:122048431-122048453 CGTTTACAAAATCCCATGTATGG - Intergenic
1099048965 12:77760396-77760418 TCCTTCGAAATTCACATGTATGG - Intergenic
1099181893 12:79478841-79478863 TGCTTCTAATATCACATGTATGG + Intergenic
1103433579 12:120907378-120907400 CGTTTCAAAAGTGACATGTCTGG - Intergenic
1108433911 13:50382839-50382861 TGCTTCCAAATTCACAAGTGTGG - Intronic
1109655494 13:65385596-65385618 CTCTTCCAAACTCACTTGCATGG + Intergenic
1110169858 13:72487693-72487715 TAATTTCAAAGTCACATGTAAGG + Intergenic
1114508595 14:23237681-23237703 TGTTTCCACAGTAACATGTATGG + Intronic
1115421970 14:33205510-33205532 AGATTCCAAAAGCACATGTATGG - Intronic
1118141849 14:63092563-63092585 TGCTTCCCAAGTCATATGAAAGG + Intronic
1119102350 14:71891558-71891580 AGCTTCAGAAGTCACATGGATGG + Intergenic
1120230652 14:81837150-81837172 CAACTCCAAAGTCTCATGTAAGG - Intergenic
1121773258 14:96571707-96571729 CTTATCCAAAGTCAGATGTAGGG + Intergenic
1131634814 15:94220735-94220757 CTCTTTCCAAGTCACATATAAGG + Intergenic
1135639426 16:24108216-24108238 TGTTTCCACAGTAACATGTATGG + Intronic
1143246321 17:5488573-5488595 CTGTGCCAAAGTCACAGGTAAGG + Exonic
1144178972 17:12734325-12734347 GGCTGACAAAGTCACATGCAGGG + Intronic
1145876194 17:28319681-28319703 GGTGTCCAAAGTCACATGTTAGG + Intronic
1152808049 17:82366725-82366747 AGCTTCAAAAGTCACATTTGTGG + Intergenic
1160053336 18:75456503-75456525 CGTTTCCAGAGTCACATTTTCGG - Intergenic
1160112486 18:76046828-76046850 CGTTACCAAAGTAACATATATGG + Intergenic
1163903665 19:20131486-20131508 AGCTTCCCAAATCACATTTAAGG + Intergenic
1164757548 19:30701763-30701785 ATCATCCAAAGTCACACGTATGG - Intronic
1166596989 19:44058911-44058933 CGCTTCCAGGGTGACATCTAGGG + Intronic
925793971 2:7523057-7523079 CGCTGCCAAAGCAACATGCATGG - Intergenic
926548560 2:14272435-14272457 CCCTTCCACACTCATATGTATGG + Intergenic
931918446 2:66985445-66985467 AGCTTCCAAATTCAGAAGTAGGG - Intergenic
932471304 2:71961255-71961277 AGCTTCCAAATCCACATGTAAGG - Intergenic
933839976 2:86278735-86278757 CTCTGCCAAAGTCACATCTTGGG - Intronic
941676160 2:168345414-168345436 CAATTCCAAAGTCAGCTGTAGGG - Intergenic
946220795 2:218224683-218224705 CTTTTCCTAAGTCACATATAGGG + Intronic
1171166376 20:22975462-22975484 CTCTTCCAAAGTTCCATGCAAGG - Intergenic
1173406062 20:42766219-42766241 TGCTTGCAAAGTTACATGTCTGG + Intronic
1179186679 21:39090332-39090354 CCCATCCAAACTCACATATACGG + Intergenic
1184907110 22:47495784-47495806 CGCTTCCACACTGGCATGTATGG + Intergenic
950943367 3:16917538-16917560 GGCTTCCATACTCACATGTTGGG + Intronic
951496204 3:23329762-23329784 TGTTTCCAAAGACCCATGTACGG - Intronic
952918194 3:38265694-38265716 CCCTTCCCAAGTCACACCTAGGG + Intergenic
953187579 3:40652926-40652948 CTCTCCCCAAGTCACATGGATGG + Intergenic
953815717 3:46154565-46154587 AGCTTGCAGAGTCACATGCAAGG - Intergenic
958664353 3:97115498-97115520 TTCTGCCAAAGTCACATGGAAGG - Intronic
958723516 3:97875741-97875763 CTCTTGCAATGTCAGATGTAGGG + Exonic
963082497 3:141407318-141407340 CTCTTCTAAAGTCACAAGTCTGG - Intronic
968546755 4:1202844-1202866 CGCTCCCAAAGGCACATGCGGGG - Intronic
974700000 4:65430143-65430165 TGCTGCTCAAGTCACATGTAAGG + Intronic
975537062 4:75461912-75461934 GGCTTCCAAGGTCAGCTGTAAGG + Intergenic
981664462 4:147207409-147207431 TGCTTCCAAAGTCACATATCTGG - Intergenic
984748522 4:183248514-183248536 CGCTTCCAAAGTCACATGTATGG + Intronic
984998354 4:185459813-185459835 AGCTTCAAAAGTCACATGATGGG - Exonic
990687639 5:58324506-58324528 TGGTTCCAAAGTCACATTTTGGG + Intergenic
993213077 5:84979698-84979720 CTCTTCCAAACTCACATGACTGG - Intergenic
999074698 5:148783378-148783400 GGCTTCCAAACTCAAATGTCAGG + Intergenic
1003634490 6:7820218-7820240 TACTTACAAAATCACATGTATGG - Intronic
1004693043 6:18009263-18009285 AGTTTTTAAAGTCACATGTATGG - Intergenic
1005092575 6:22073206-22073228 AGCCTCCAAAGTCACTTGTGGGG + Intergenic
1011171749 6:84512471-84512493 CCCTTCCATCATCACATGTAGGG + Intergenic
1026868623 7:73837418-73837440 TGTTTCCACAGTAACATGTATGG - Intronic
1028201827 7:87971396-87971418 CACTTCCAAAGTCACATATTTGG - Intronic
1037339973 8:17834051-17834073 AGCTTCCATAGTCACATATCTGG - Intergenic
1037698524 8:21250078-21250100 TGCTTGCAAAGTCACATTTCTGG - Intergenic
1042063548 8:64848235-64848257 CTCTCCCAAAGTCAAATGTGCGG + Intergenic
1045357858 8:101405250-101405272 TGTTTCCAAAGGCACATGAAAGG - Intergenic
1052691100 9:31817895-31817917 CTCTACCAGAGTCACATGTAGGG + Intergenic
1053730048 9:41044742-41044764 CGCTTCCCACGTCATGTGTAGGG - Intergenic
1187279168 X:17844378-17844400 AGCTTGCAAAGACACATGTCTGG - Intronic
1190702753 X:53000427-53000449 TGCTTCCCAAGTCACAGGCAGGG - Intergenic
1197443561 X:126520347-126520369 GGATTCCAAAGCCAGATGTACGG + Intergenic