ID: 984750639

View in Genome Browser
Species Human (GRCh38)
Location 4:183270026-183270048
Sequence TGATGAACAAAGTTTAAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984750636_984750639 7 Left 984750636 4:183269996-183270018 CCAGTGGGAAGCACAGAAACACA 0: 1
1: 0
2: 2
3: 26
4: 281
Right 984750639 4:183270026-183270048 TGATGAACAAAGTTTAAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 247
984750633_984750639 30 Left 984750633 4:183269973-183269995 CCAATTGAGCTTTTCTCTGCAGT 0: 1
1: 0
2: 2
3: 16
4: 196
Right 984750639 4:183270026-183270048 TGATGAACAAAGTTTAAGAGGGG 0: 1
1: 0
2: 2
3: 18
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984750639 Original CRISPR TGATGAACAAAGTTTAAGAG GGG Intronic
902472096 1:16656335-16656357 AGATGAACAAAATTGAACAGAGG - Intergenic
902486707 1:16751111-16751133 AGATGAACAAAATTGAACAGAGG + Intronic
903508368 1:23854187-23854209 TTATAAACAAAATTTAGGAGGGG - Intronic
905111543 1:35598303-35598325 TGATGAATAAAGTTTACACGGGG + Intergenic
905935724 1:41822537-41822559 GGATGAAGAAAGAATAAGAGTGG + Intronic
906756502 1:48322225-48322247 AGATGAACAAAGTAGAACAGAGG + Intronic
906835630 1:49080610-49080632 TAATGAAAAAAGTTAGAGAGAGG + Intronic
907764978 1:57400402-57400424 GAATGAACAAAGTTTATGAGAGG + Intronic
907941650 1:59093999-59094021 TGATGAAGAAGGATTGAGAGGGG + Intergenic
909067996 1:70959659-70959681 AGATGAAAAAAATTGAAGAGGGG - Intronic
909588151 1:77313983-77314005 TGATGGACAAAGGGGAAGAGGGG + Intronic
910866039 1:91788991-91789013 TGCTGGACAAATTTTAAAAGGGG + Intronic
911757153 1:101571820-101571842 ATATAAACAAAGTTTAGGAGAGG - Intergenic
912048300 1:105489617-105489639 TGATGAACAAAGGTAGAGTGTGG + Intergenic
912691562 1:111808707-111808729 TGATGCACAAAGTTGGTGAGGGG + Intronic
913482256 1:119300099-119300121 TGATCAACAATGTTTAACACTGG - Intergenic
918362442 1:183772635-183772657 TGATGAAGAAAATTTCAGAAAGG + Intronic
921810445 1:219506461-219506483 TGCTGAACAGAGTTTAAAAGGGG + Intergenic
924079509 1:240379456-240379478 TGAGGAACAGAGTTCCAGAGAGG - Intronic
924391643 1:243566888-243566910 AAAAGAACAAAGTTCAAGAGTGG + Intronic
924437166 1:244051864-244051886 TGAAGAATAAAGTTTCACAGAGG - Intronic
1063060773 10:2550109-2550131 AGAGGAACAAAGATAAAGAGGGG + Intergenic
1063075716 10:2714165-2714187 TGAGGAAGAAAGTATCAGAGGGG + Intergenic
1063597504 10:7450164-7450186 AGAAGAAGAAAGTTTAACAGAGG + Intergenic
1063783396 10:9352317-9352339 TGAAGAATAAAGATTAAGGGAGG + Intergenic
1066276640 10:33875415-33875437 TGAAGATCAAAGGATAAGAGAGG - Intergenic
1066508166 10:36066547-36066569 TGGTGCCCAAAGTTTCAGAGGGG - Intergenic
1068254053 10:54485123-54485145 TTCTGAACAAAATTTATGAGAGG - Intronic
1069172515 10:65251208-65251230 TAATTATCAAACTTTAAGAGAGG - Intergenic
1071313902 10:84372679-84372701 AGAACAACAAAGGTTAAGAGTGG - Intronic
1072059058 10:91790620-91790642 GGAGGAACAAAGTTAAAGTGTGG + Intergenic
1073714358 10:106085670-106085692 TGAGGAACACTTTTTAAGAGAGG - Intergenic
1073882938 10:108005091-108005113 CCATGAACTTAGTTTAAGAGGGG + Intergenic
1074059972 10:109956351-109956373 TGATGAAGAAGTTTTAGGAGTGG - Intergenic
1074608363 10:114996909-114996931 TGATGTAAAAAGTTTAGGTGGGG + Intergenic
1074939859 10:118223696-118223718 TGATGAACCATTTTGAAGAGAGG - Intergenic
1079081053 11:17414024-17414046 TGAAGAACCAAGTTTCAGAAAGG - Intronic
1079169168 11:18075827-18075849 TGATGAACAAATAGTATGAGAGG + Intronic
1079411575 11:20192489-20192511 TGGTGAAACAAGTTTGAGAGTGG - Intergenic
1079432933 11:20413774-20413796 TTAAGAACAGAGTTGAAGAGAGG - Intronic
1083410983 11:62492194-62492216 TGAGGAACAATGTGTAAGAAAGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1083774037 11:64884431-64884453 TGATGACCAAAGGGCAAGAGAGG - Intronic
1084397897 11:68926172-68926194 TGATCAGCAAACTTGAAGAGAGG - Intronic
1085549329 11:77353433-77353455 AGAAGAACAAGGTTTATGAGAGG + Intronic
1086009534 11:82083549-82083571 TCATGAACAAACTTTATAAGAGG + Intergenic
1086256487 11:84882850-84882872 AGATGATGAAAGTTTTAGAGAGG + Intronic
1090688070 11:129147837-129147859 TGAAGGATAAAGTTTAAAAGAGG - Intronic
1094108081 12:26833720-26833742 TGATGAAGAAAGTAGAAGAGAGG + Intergenic
1094183742 12:27618843-27618865 TGATAGAGAAATTTTAAGAGTGG + Intronic
1095583550 12:43826716-43826738 TGATTTACTAAGTGTAAGAGAGG + Intergenic
1095749742 12:45697138-45697160 TGGTGCCCAAAGTTTCAGAGGGG + Intergenic
1096513409 12:52144153-52144175 GGATGAACCAAGGTGAAGAGTGG - Intergenic
1097450767 12:59734259-59734281 TGATGCACAGAGTTTCAGAGGGG + Intronic
1097507614 12:60495775-60495797 TGTTGAAGAAAGATTAAGAAAGG - Intergenic
1097840960 12:64320710-64320732 TGTTAAACAAAGTTGATGAGAGG + Intronic
1098884196 12:75943513-75943535 TTATAAACAAAATTTAGGAGGGG - Intergenic
1099692306 12:85972815-85972837 GGAATAACAAAGTTTAAGTGTGG + Exonic
1100935194 12:99656568-99656590 AGATGAACAGAATTTAAAAGTGG + Intronic
1103011000 12:117458237-117458259 GGATGAACAAGGTAGAAGAGAGG - Exonic
1107515829 13:41128260-41128282 TAATGAACAAAGATTAAGGAAGG + Exonic
1108054505 13:46472365-46472387 TGATGAACAAATTGTGAGGGAGG - Intergenic
1110287059 13:73761988-73762010 TGATGAACAGAGTTTATGTCTGG + Intronic
1110359205 13:74606221-74606243 TGCTCAACAAAGTTTATGGGAGG + Intergenic
1110655775 13:77997024-77997046 TGATGACAAAAGCTTAAGATTGG - Intergenic
1111191349 13:84811203-84811225 TTATGAACATAGTTTACAAGGGG + Intergenic
1111276952 13:85962834-85962856 TGATGAATAAAATTTCAGATAGG + Intergenic
1114972325 14:28048405-28048427 TGATAAGCAAAGTATAAAAGAGG + Intergenic
1115032688 14:28815823-28815845 TGATGAGAAAAGTTTAAAAATGG + Intergenic
1116683826 14:48012147-48012169 TAGTGAAGAAAGGTTAAGAGTGG + Intergenic
1117858596 14:60063544-60063566 CCATAAAGAAAGTTTAAGAGAGG - Exonic
1118096502 14:62543341-62543363 TGATGATCAAAGTTTGAAGGAGG - Intergenic
1119409029 14:74417385-74417407 TCATGAACACTGTTAAAGAGAGG + Intronic
1120126240 14:80747347-80747369 TGATGAACAGATTTAAAAAGTGG + Intronic
1120657661 14:87213981-87214003 TAATCAACAAAATTTAAGATAGG - Intergenic
1120727727 14:87963794-87963816 TGATGAACCAAGTTTGGGGGGGG - Intronic
1127152881 15:56096246-56096268 TGAGGCAGAATGTTTAAGAGGGG + Exonic
1128296135 15:66521445-66521467 TGATGAATAAAGTTTTTGAGTGG + Intronic
1130433285 15:83871103-83871125 TGCTGAACAATTTTTAAGAATGG - Intronic
1132005193 15:98220174-98220196 TGATGAACTAAGTTGAGGATGGG - Intergenic
1133425263 16:5682987-5683009 GAATGAACAAAGGTTCAGAGAGG - Intergenic
1133427159 16:5702563-5702585 AGAGGAACAAGGTTTGAGAGAGG + Intergenic
1134844528 16:17428800-17428822 TGATTAACAATCTTTCAGAGAGG + Intronic
1137339923 16:47591577-47591599 AGAAGAGCAAGGTTTAAGAGGGG - Intronic
1137641811 16:50038803-50038825 TGATGAACACACTTTAAAATAGG - Intergenic
1139018707 16:62722058-62722080 TGTTTAACAAAATTTAGGAGGGG - Intergenic
1149157762 17:53653509-53653531 TGATCAAGGAAGTTTAACAGAGG + Intergenic
1155446781 18:25921299-25921321 TGAAGGACAAAGATGAAGAGGGG - Intergenic
1155883890 18:31184200-31184222 TGATGAAGCAAGGTGAAGAGAGG + Intergenic
1156796246 18:41049711-41049733 TAATGAACAAAGGTAAAGAAAGG - Intergenic
1157177693 18:45466301-45466323 TGATGGACAAAGACAAAGAGAGG + Intronic
1161790481 19:6356594-6356616 TTATAAACAAAATTTAGGAGGGG - Intergenic
1163074084 19:14873392-14873414 TTTGGAACAAATTTTAAGAGAGG - Intergenic
1202704493 1_KI270713v1_random:13129-13151 AGATGAACAAAATTGAACAGAGG - Intergenic
925537237 2:4930593-4930615 TGATCAAAAAAGTTGAAAAGTGG - Intergenic
926038924 2:9657146-9657168 TGAAGAACCAAGCTTCAGAGAGG - Intergenic
928762120 2:34596625-34596647 GGATGAAGAAGGTTAAAGAGAGG + Intergenic
928781632 2:34829329-34829351 TGATGAAAAAAATTGAAGAGGGG - Intergenic
929841204 2:45465563-45465585 TAATGATCAAAGTATAAGACTGG + Intronic
931204808 2:60136867-60136889 TGATGAAGAAAGGGTAAGAGAGG + Intergenic
932508205 2:72257495-72257517 TAATGACCAAAGATTAATAGTGG - Intronic
933205682 2:79504876-79504898 TTATGAACAAAATTAAAGAATGG - Intronic
933739370 2:85521244-85521266 TTATAAACAAAATTTAGGAGGGG + Intergenic
933860884 2:86466375-86466397 TCATAAACAAAGTTTACCAGAGG + Exonic
936287128 2:111189458-111189480 TGATGATCAAAGTGGAAGAGTGG - Intergenic
938202888 2:129390757-129390779 GGATAATCAAAGTTAAAGAGGGG + Intergenic
939098837 2:137870842-137870864 TGATTAACAAAGTTTCAGGATGG + Intergenic
939130867 2:138234644-138234666 TTATGATAAAAGTCTAAGAGAGG - Intergenic
939467611 2:142579062-142579084 TGATGAACAAAATGTAAAAGAGG + Intergenic
939483047 2:142772963-142772985 TGATGAAAGAAATTAAAGAGGGG - Intergenic
939584577 2:143991001-143991023 GGTTCAACAAAGCTTAAGAGAGG + Intronic
943099172 2:183467500-183467522 TGTTAAACAAAGTTTATGGGAGG + Intergenic
943191297 2:184682037-184682059 TGGTGCCCAAAGTTTCAGAGGGG - Intronic
943388312 2:187229663-187229685 TGATACACAAATATTAAGAGGGG - Intergenic
944165730 2:196717965-196717987 TGAAGTAAAAAGTTTAAAAGGGG + Intronic
944458889 2:199923375-199923397 TGAGGAACTAAATTTAATAGAGG + Intronic
945490048 2:210443948-210443970 TGATGAATAAAGTCTAAGAAGGG + Intronic
947094298 2:226548684-226548706 TCATGAAGAAAGTAGAAGAGTGG - Intergenic
948411735 2:237767993-237768015 TGTTGAAAAATATTTAAGAGAGG - Intronic
1170855559 20:20050565-20050587 TGCTGAACAACTCTTAAGAGAGG - Exonic
1171303347 20:24083426-24083448 TGGTGACCACAGTTTAATAGTGG + Intergenic
1172168198 20:32911797-32911819 TGATGAACACCCTTTCAGAGAGG - Intronic
1173308972 20:41879193-41879215 TGGTTAACAAAGTATAAAAGAGG + Intergenic
1174694049 20:52539547-52539569 TAATGAACAGAGACTAAGAGAGG - Intergenic
1176880127 21:14182209-14182231 TAATGTACAGAGTTCAAGAGAGG - Intronic
1177110798 21:17025797-17025819 GGCTGAAAAAATTTTAAGAGTGG - Intergenic
1177315218 21:19451640-19451662 TGATGAACAATTTTTGGGAGGGG - Intergenic
1177455962 21:21339571-21339593 TAATGAAAAAAGTTTAAAGGAGG - Intronic
1178135906 21:29627012-29627034 TGATGAAAATATTTTAAGACAGG + Intronic
1181856660 22:25785992-25786014 TGATGAATATAGTCTATGAGTGG + Intronic
1181877004 22:25947582-25947604 TGACCATCAATGTTTAAGAGTGG - Intronic
1183046364 22:35223696-35223718 GGATGAACAAAGGCTCAGAGTGG - Intergenic
950908996 3:16568007-16568029 TTGTAAACAAAGTTTTAGAGTGG + Intergenic
951119261 3:18905421-18905443 AGATGAACAAAATTGAACAGAGG + Intergenic
954809111 3:53236940-53236962 TCATGAACTAATTTGAAGAGAGG + Intronic
956491066 3:69772780-69772802 TGATGGATAGAGTTCAAGAGTGG - Intronic
956999708 3:74871620-74871642 TGCTGAATAAACTTTTAGAGGGG - Intergenic
958787964 3:98619606-98619628 TGAAAAACAAAATCTAAGAGAGG - Intergenic
958881893 3:99681484-99681506 TTATGAAGAAAGTTTAAAGGAGG + Intronic
959360067 3:105377471-105377493 TTATGAAGAGAGTTTAAGAAAGG - Intronic
960300180 3:115993509-115993531 TTATGAACAAATTTCAAAAGTGG - Intronic
960444942 3:117736469-117736491 TGATAAACAAATTCTAAAAGAGG - Intergenic
963190415 3:142464764-142464786 AGATGAAAAAAGTTTTGGAGAGG + Intronic
963508853 3:146222944-146222966 TGATGGACTAAGGTAAAGAGAGG + Intronic
964697588 3:159526958-159526980 TGATTAAGATAGTTTAAGACTGG - Intronic
965701904 3:171466833-171466855 TGAAGAACAAGTTTTTAGAGTGG + Intergenic
967028890 3:185587540-185587562 TGATCACTAAAGTTGAAGAGGGG - Intronic
970208326 4:13679474-13679496 TGATGTACATAGTTTTACAGGGG + Intergenic
970402946 4:15735388-15735410 GAATGAACTAAGTTTAATAGAGG + Intronic
971944969 4:33263051-33263073 TGATGATAAAAGTTTGAGACAGG - Intergenic
972323840 4:37996451-37996473 TGTTGATCAAAGTTAAAGAAAGG + Intronic
974165722 4:58198974-58198996 TGATGGATAAAGTATAAAAGGGG - Intergenic
974296527 4:60006846-60006868 TGATATACAAGGTTGAAGAGAGG + Intergenic
975442066 4:74422207-74422229 TGATGAACAACCTTTAACAGTGG + Intergenic
975588296 4:75973490-75973512 TGAAGAACAAATTCAAAGAGTGG + Intronic
975748418 4:77497020-77497042 AGAAGAAGAAAGTTTAGGAGTGG - Intergenic
976257623 4:83115795-83115817 TGTTAAACAAAGTTTATGAGAGG - Intronic
977354539 4:95928385-95928407 TCAAGAACAAAGTCTAAGATAGG + Intergenic
978374632 4:108061963-108061985 AGATGAAGAAAGTTTCACAGAGG + Intronic
978830528 4:113078768-113078790 TTCTGAACAAAGTTTAAAAAAGG + Intronic
978834166 4:113127767-113127789 TGATGAAGAAAGACTATGAGGGG + Intronic
978927809 4:114270417-114270439 TGATGTATAAAGTATAAGATAGG + Intergenic
979845089 4:125498638-125498660 TGTTGAACAAATTTAAAAAGTGG - Intergenic
980389876 4:132129555-132129577 TCATGATCAAAGTTTGAGAATGG - Intergenic
983622119 4:169772838-169772860 TCAAGAACAAAGTTCAAAAGAGG + Intergenic
983869989 4:172813917-172813939 TGCTTAGCAAAGTTTAAGAAGGG - Intronic
984750639 4:183270026-183270048 TGATGAACAAAGTTTAAGAGGGG + Intronic
984826938 4:183933875-183933897 TGATGAAAAAAATTAAATAGTGG + Intronic
985116307 4:186595099-186595121 TAATGAAGAAAGTTTAACAGTGG - Intronic
986548103 5:8921709-8921731 TGATGAACAAGGTCTAATATAGG + Intergenic
986653498 5:9988405-9988427 TCATGGTCAAAGTATAAGAGAGG + Intergenic
987226147 5:15843615-15843637 TGATGAATGCAGTTTAAAAGAGG + Intronic
987366096 5:17150506-17150528 TGATTAAAAAATTTTAAGGGTGG + Intronic
987920167 5:24269941-24269963 TGATGAACAAAATTTAATATTGG + Intergenic
988080472 5:26408959-26408981 ATATGAACTAAGTTTAAGTGTGG + Intergenic
988904066 5:35767394-35767416 TGATGACCAAACTTACAGAGGGG - Intronic
989106232 5:37865694-37865716 TGATGAACACAGTATCAAAGTGG - Intergenic
989271973 5:39544378-39544400 TGATGAAAAAATCTTAACAGCGG + Intergenic
989813259 5:45704100-45704122 TAAAGAACAAAGATAAAGAGAGG - Intergenic
990846145 5:60141992-60142014 TGATGATCAGGGTTTAGGAGAGG - Intronic
991132782 5:63144071-63144093 TGATGAAGACTGTTAAAGAGTGG - Intergenic
991956154 5:71997728-71997750 GGATGATCAAAGTTGAAGAGAGG + Intergenic
992029727 5:72709218-72709240 TGGTGCCCAAAGTTTCAGAGGGG + Intergenic
992040611 5:72827206-72827228 TGATGAACATAGTGAAAAAGGGG + Intronic
992061955 5:73060543-73060565 TGGGGGACAAAGTTTAAGACTGG - Intronic
992276707 5:75128459-75128481 TAATGATCAAAGTTTCATAGTGG - Intronic
993162543 5:84311446-84311468 TTATAAACAAAATTTAGGAGGGG + Intronic
993260381 5:85650408-85650430 TTTTAAACAAAGTTTAAGATAGG + Intergenic
993698946 5:91095418-91095440 TGAACAACAAAGTTAAAGACTGG - Intronic
994050060 5:95352436-95352458 TGTTTAACAAAGTTTAAGCATGG + Intergenic
995405201 5:111786970-111786992 TGCTGGACATAGTTTAAGAAGGG - Intronic
996190143 5:120530433-120530455 TGATGAACAAACAAAAAGAGAGG - Intronic
996458809 5:123717220-123717242 TGTTAAATAAAGTTTATGAGAGG + Intergenic
997214443 5:132098984-132099006 TGAAGAACAAAGGTTCAGAGAGG - Intergenic
998853782 5:146375550-146375572 TGATGAACTAGATTTAAGGGTGG + Intergenic
1001251237 5:170148643-170148665 TGAGGAACTAAGGTTCAGAGAGG - Intergenic
1002387152 5:178876622-178876644 AAATCAACAAAGTTTAAGATAGG - Intronic
1002650901 5:180692868-180692890 TGAGGAACAAAGTTGTAAAGAGG - Intergenic
1005451271 6:25975179-25975201 TAATAAACAGTGTTTAAGAGGGG - Intronic
1006229775 6:32574612-32574634 AGATGACCAAAGAATAAGAGTGG + Intronic
1006955287 6:37864585-37864607 TGATGAGAAATGTTTAGGAGAGG + Intronic
1007164062 6:39815922-39815944 TGAGGAGCAAAGTTGAGGAGTGG - Intronic
1008364774 6:50665057-50665079 GGAGCAACGAAGTTTAAGAGAGG + Intergenic
1008921211 6:56844953-56844975 TGATGAAGAGAGTCTCAGAGAGG - Intronic
1009346609 6:62619885-62619907 TGAGGAACCAAGTTTAAGGAAGG - Intergenic
1009612965 6:65970572-65970594 TGTAGAACAAAGATTAATAGAGG + Intergenic
1010418868 6:75648913-75648935 TAATGTACAGTGTTTAAGAGTGG - Intronic
1010938685 6:81890034-81890056 GGATGAAGGAAGTTTAAGATGGG - Intergenic
1011125665 6:84004587-84004609 TGATGAACTATGTTTGGGAGTGG - Intergenic
1011969518 6:93205106-93205128 AGATGAACAAATTTAAAAAGTGG - Intergenic
1012119313 6:95344269-95344291 TCATGAAAAAACTTTAACAGAGG - Intergenic
1012171519 6:96022711-96022733 TGACGAACAAAGGTAAAAAGGGG - Intronic
1013751439 6:113411363-113411385 TAATGAAGAAAATTTAGGAGTGG - Intergenic
1013922030 6:115417097-115417119 TTATTAAGAAAGTTTTAGAGAGG + Intergenic
1016604195 6:145900267-145900289 TGATGAATAAATTTTAAAACAGG + Intronic
1017272758 6:152528234-152528256 TGTTTGACAAAGTTTAGGAGAGG - Intronic
1017595383 6:156022779-156022801 AGATGAAAAAATTTAAAGAGGGG + Intergenic
1019781935 7:2945629-2945651 TGATGATGAAAGGTTAACAGGGG - Intronic
1020518572 7:9157063-9157085 TAATGCACAAAGTTTATAAGTGG + Intergenic
1021397496 7:20168057-20168079 TGATGAACCAAGCTGCAGAGAGG + Intronic
1021799887 7:24294737-24294759 TGATGAACTAGGTCTAAGAATGG + Intergenic
1023012413 7:35936076-35936098 GAATGAACAAAGTTGCAGAGGGG + Intergenic
1024078714 7:45837751-45837773 GAATGAACAAAGTTGCAGAGGGG - Intergenic
1026411913 7:70132028-70132050 TGGTGAAAAGGGTTTAAGAGGGG + Intronic
1027653026 7:80894756-80894778 TGATAAAAATAGGTTAAGAGTGG - Intronic
1027900206 7:84103673-84103695 TTAAAACCAAAGTTTAAGAGTGG - Intronic
1028007764 7:85598206-85598228 TGAAGAATAAAGTTAATGAGGGG - Intergenic
1029809951 7:103037390-103037412 TGATGAACAAAGTTTAACTGTGG - Intronic
1030012724 7:105187085-105187107 TCATGAACAAAATTAAAAAGGGG + Intronic
1030881064 7:114880627-114880649 AGATGAAAAAAGTTAAAAAGTGG - Intergenic
1031517980 7:122725008-122725030 TCATTAACAAAGTTTAAAAAGGG + Intronic
1031909962 7:127505643-127505665 TGATGTACAAAAATGAAGAGAGG - Intergenic
1032534557 7:132651543-132651565 TGAAAAACAAAATTAAAGAGAGG + Intronic
1036618448 8:10406291-10406313 TGAAGAACACAGGTTCAGAGAGG - Intronic
1039723856 8:40193962-40193984 AGTTGAACAAATTTTAAGAGTGG + Intergenic
1040957806 8:52997234-52997256 TGTTAAACAAAGTTTATGGGAGG - Intergenic
1041513145 8:58673065-58673087 TGATGATGAAAGTATAAAAGTGG - Intergenic
1045057196 8:98379418-98379440 TAAAGAACAAAGTTTTTGAGTGG - Intergenic
1045160035 8:99529775-99529797 TGATAAACAATGTTTAAGAGTGG - Intronic
1045481663 8:102597683-102597705 TGATGAAGAGAATTCAAGAGGGG - Intergenic
1046673007 8:117078545-117078567 TGAGGAACTGAGTGTAAGAGAGG - Intronic
1047033151 8:120905748-120905770 TGAGGAACTAAGATTTAGAGAGG - Intergenic
1047820452 8:128514094-128514116 TTAAGAACCAAGTTTCAGAGAGG + Intergenic
1048336855 8:133508792-133508814 TGATGCACAAGCTTTCAGAGAGG - Intronic
1048802598 8:138207680-138207702 TGTTGAAAAGACTTTAAGAGTGG - Intronic
1050244611 9:3675481-3675503 TGATGAAAAATATTTAAAAGTGG - Intergenic
1052062696 9:23980273-23980295 AGATGAACAAAATTTATAAGTGG + Intergenic
1052497520 9:29246346-29246368 TCTTGAACAAAGTTTCATAGTGG + Intergenic
1052649399 9:31281436-31281458 TGATAAATAAATTTTAAGAAGGG - Intergenic
1054318427 9:63625111-63625133 TGATGAAAGAAGTTTTTGAGTGG - Intergenic
1057400876 9:94722136-94722158 AGATGAACTAAGTTCAATAGAGG - Intergenic
1058176507 9:101741272-101741294 AGATGAACAGTGGTTAAGAGTGG + Intergenic
1058176513 9:101741357-101741379 AGATGAACAGTGGTTAAGAGTGG + Intergenic
1059454968 9:114394686-114394708 AGATGAAGAAAGGTTCAGAGAGG + Intergenic
1059662233 9:116413355-116413377 TAAAGAACAAAGTTTAAGCTAGG + Intergenic
1203372206 Un_KI270442v1:318414-318436 AGATTAACAAATTTTAACAGAGG + Intergenic
1185827232 X:3263836-3263858 TTATTAACAAAGTTATAGAGAGG + Intergenic
1188486882 X:30691895-30691917 ATATGAACAAAGTGGAAGAGGGG - Intronic
1188985514 X:36765271-36765293 GGCTGAACCAAGTTTAGGAGAGG - Intergenic
1189643873 X:43105203-43105225 TGATGACAAAAGATTCAGAGAGG + Intergenic
1191576506 X:62712341-62712363 TGCAGAACAAAGGGTAAGAGAGG - Intergenic
1192162830 X:68801402-68801424 GGATGAACAGATTTTAAGTGTGG - Intergenic
1194852684 X:98888814-98888836 TGACTAAGAAAGTTTAAGCGTGG - Intergenic
1196039837 X:111190346-111190368 TGATGAACTGAGGTTCAGAGAGG - Intronic
1196051014 X:111304253-111304275 TGAGGAACAGATTTTCAGAGGGG - Intronic
1196109379 X:111929861-111929883 TGATGAACAAAGTCTGAAAGTGG - Intronic
1196117065 X:112009420-112009442 TGAGGAAGAGAGTTTAAGAAAGG - Intronic
1200232286 X:154450031-154450053 TGAACATCAAAGTTGAAGAGTGG - Exonic