ID: 984751710

View in Genome Browser
Species Human (GRCh38)
Location 4:183283958-183283980
Sequence CTTGTTGGACAGATATCACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 104}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984751705_984751710 8 Left 984751705 4:183283927-183283949 CCCTTTGGAGGCAGCACCTCTAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG 0: 1
1: 0
2: 0
3: 14
4: 104
984751702_984751710 27 Left 984751702 4:183283908-183283930 CCTTCATTTTTATGTTCAACCCT 0: 1
1: 0
2: 2
3: 32
4: 346
Right 984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG 0: 1
1: 0
2: 0
3: 14
4: 104
984751708_984751710 -8 Left 984751708 4:183283943-183283965 CCTCTATTTATGGTGCTTGTTGG 0: 1
1: 0
2: 0
3: 4
4: 99
Right 984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG 0: 1
1: 0
2: 0
3: 14
4: 104
984751706_984751710 7 Left 984751706 4:183283928-183283950 CCTTTGGAGGCAGCACCTCTATT 0: 1
1: 0
2: 0
3: 8
4: 120
Right 984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG 0: 1
1: 0
2: 0
3: 14
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984751710 Original CRISPR CTTGTTGGACAGATATCACA CGG Intronic
900074576 1:802707-802729 CTTGTTTGCCAGTGATCACAAGG - Intergenic
904240875 1:29144350-29144372 CTTGTAGGACTGGTGTCACAGGG - Intergenic
904583661 1:31566588-31566610 CTTGTTGGACGGATCTGACTGGG + Intergenic
919459027 1:197854806-197854828 CATGTTGGACAGAAATGACAAGG + Intergenic
919641042 1:200043669-200043691 ATTGCTGGGCAAATATCACATGG - Intronic
921076667 1:211705495-211705517 CTTGGTGGGCAGAGAGCACAGGG - Intergenic
922270422 1:224027613-224027635 CTTGTTTGCCAGTGATCACAAGG - Intergenic
923863085 1:237912029-237912051 GATGTTGGGTAGATATCACATGG + Intergenic
1064560716 10:16593092-16593114 TTTCTTGAATAGATATCACAAGG - Exonic
1066103895 10:32140295-32140317 CTTGTTGGGCACATGTCACCAGG - Intergenic
1070908151 10:80092957-80092979 ATTGTTGTGCAGATATCATAGGG + Intergenic
1080410530 11:32020029-32020051 CTTGTGGCACATATATAACATGG - Intronic
1082744673 11:56948871-56948893 ATTTTTGGACAGAAATAACATGG + Intergenic
1083691274 11:64410307-64410329 CTTTATGGACAGATATTTCATGG - Intergenic
1085161039 11:74345625-74345647 GTTGTTGGAAAGTTTTCACAGGG - Exonic
1087021254 11:93605676-93605698 CTTGTTAGAAAGAAATCACATGG - Intergenic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1094308956 12:29055904-29055926 CTAGTTGGAAAGATATCAGAGGG + Intergenic
1095814747 12:46408786-46408808 CTTGATGGACAGGAATCACAAGG + Intergenic
1097328159 12:58302744-58302766 CTTGTTGGATTAATGTCACATGG - Intergenic
1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG + Intergenic
1106130405 13:26934729-26934751 CTGCATGTACAGATATCACATGG - Intergenic
1108027891 13:46197532-46197554 CAGGTTGCACAGATGTCACAGGG + Intronic
1111400060 13:87722359-87722381 CTTGTTGGCCTGTTAGCACAAGG - Intergenic
1111468828 13:88649553-88649575 CTTGATGGTCAGATTTCACCAGG - Intergenic
1111969259 13:94893850-94893872 CTTGTTGGCTAAATATCCCAAGG + Intergenic
1112261155 13:97879699-97879721 CTTGTAGGAATGACATCACAGGG + Intergenic
1118039138 14:61898718-61898740 TGTGTTGGAAAGATATGACAGGG + Intergenic
1118909244 14:70047443-70047465 CTTGGAGAACAGAGATCACAGGG + Intronic
1123772904 15:23546944-23546966 CTTGTTGGTCAGATTACACATGG + Intergenic
1126705383 15:51400911-51400933 CCTGTTGGACAGAGAGCCCAGGG + Intronic
1128203068 15:65826524-65826546 CTTTTTGTCCAGATATCAAATGG + Intronic
1131087989 15:89593769-89593791 TTAGTTGAACAGATATCACAGGG - Intronic
1135185152 16:20309362-20309384 TTTCTTGGACAGACATCCCAAGG - Intergenic
1137577014 16:49606710-49606732 CTTGGTGAACAGTGATCACAGGG + Intronic
1140564014 16:76019707-76019729 CTTGAAGGACATACATCACAGGG + Intergenic
1143384310 17:6518302-6518324 CATGTTGGACACATTCCACAGGG - Intronic
1144693132 17:17281987-17282009 TTTGGTTTACAGATATCACATGG - Intergenic
1146384585 17:32358620-32358642 CTTCTTGAACAGAAAACACAAGG + Exonic
1146697079 17:34917617-34917639 CTTGTTGGACAAATATCCTGTGG - Intergenic
1148997973 17:51728590-51728612 ATTTTTGGATACATATCACAGGG + Intronic
1156964270 18:43071584-43071606 CAGGTTGTACAGATATCTCAAGG + Intronic
1157080758 18:44522546-44522568 CCTGATGGAGAGTTATCACAAGG + Intergenic
1157842843 18:50975526-50975548 CTAGTTGAACAGATATAACTAGG - Intronic
1163678251 19:18666220-18666242 CTTGTTGGGCAGATGTCAGTGGG + Intronic
1167814022 19:51863236-51863258 CTTTTTGGAAAGAAATCATATGG - Intronic
1168458609 19:56535387-56535409 CATCTTAGCCAGATATCACAAGG + Intergenic
925995232 2:9287450-9287472 CTTGTAGGACGGATATCTGAAGG + Intronic
927386287 2:22537653-22537675 CTTTTTTGACAAATATTACATGG - Intergenic
929979356 2:46664301-46664323 CTGGGTGGGCAGATACCACAGGG - Intergenic
931215622 2:60241034-60241056 CTTGGTAAACAGATATCCCATGG + Intergenic
939830232 2:147062878-147062900 CTTGTTGAACTGATATAAGAAGG + Intergenic
940345298 2:152622414-152622436 CTTCTTGGACACATTTCACAAGG - Intronic
943814134 2:192229969-192229991 CTTGGGGGACAGATATCACTGGG + Intergenic
944939772 2:204610797-204610819 ATTGTTGGACAGCTGTAACATGG - Intronic
945518483 2:210793425-210793447 CTTGTTGGAAGGATATGCCAAGG + Intergenic
947042040 2:225933723-225933745 CTAATTGGATAGATTTCACACGG - Intergenic
1176880442 21:14185981-14186003 TTTGTTGGAAAGATATTTCATGG - Exonic
1178631605 21:34265816-34265838 CCTGTTGTGCAGAGATCACATGG - Intergenic
954346986 3:50008243-50008265 ATTGTAGGACACATATCAGAAGG - Intronic
955518885 3:59755211-59755233 CTTGTAGGCCAGACATCCCATGG - Intronic
955907145 3:63818920-63818942 CCTGTGGGACACATATGACAAGG - Intergenic
958191199 3:90187097-90187119 CTTGTTTGAAATTTATCACATGG - Intergenic
958413394 3:93846217-93846239 CTTGTTTGAAATTTATCACATGG - Intergenic
958632100 3:96698102-96698124 CTTGTTGGACAGATGTGGTATGG + Intergenic
960856532 3:122107756-122107778 CTTGTTGTTCAGATATAACTTGG + Intronic
962625181 3:137219096-137219118 CTTGTTGAACACAGATCACTGGG - Intergenic
963728418 3:148947309-148947331 CTTTTATGACAGATATCACCAGG + Intergenic
964086321 3:152822982-152823004 CTTGGTACACAAATATCACAAGG - Intergenic
964396944 3:156255657-156255679 ATTGTTAGACAGATAAAACAAGG - Intronic
967128772 3:186451505-186451527 CCTGTTGGCCAGAGACCACAGGG + Intergenic
973583474 4:52368195-52368217 AATGTTGGAGAGATATGACAAGG - Intergenic
974241655 4:59256851-59256873 CTTGTTTGATAGACATCAAAAGG + Intergenic
980369876 4:131854488-131854510 CTTAATGGACAGATTGCACATGG + Intergenic
982179230 4:152734397-152734419 CTTGTGGGACAGACATCAGTGGG + Intronic
984751710 4:183283958-183283980 CTTGTTGGACAGATATCACACGG + Intronic
989016732 5:36944083-36944105 ATTGTTGGAGAGAGATCATAGGG + Intronic
990086568 5:51985978-51986000 CTTGTTCTCCAGGTATCACATGG - Intergenic
990406803 5:55499721-55499743 CTTCTTGGACATATATGAGAAGG - Intronic
993212049 5:84963664-84963686 ATTGTTGGAGAAATATCAAATGG - Intergenic
994949199 5:106435245-106435267 CTTGTTGGACATAGATCAATTGG - Intergenic
999554014 5:152721242-152721264 ATAGTTGGCCAGATATTACAAGG + Intergenic
1000305194 5:159988064-159988086 CTGGTGGGCCTGATATCACAAGG + Intergenic
1000846842 5:166292303-166292325 CTTGTTGTGCAGAGATCACATGG + Intergenic
1003696431 6:8410338-8410360 AATGTTGGGCAGATATGACATGG + Intergenic
1003790589 6:9542873-9542895 CTTGTAAGTTAGATATCACATGG - Intergenic
1006205355 6:32336561-32336583 CTTGTAGGTCAGATATCAAAGGG + Intronic
1007635881 6:43299472-43299494 CCTGTCGGACAGATATCCAAAGG - Exonic
1009389244 6:63125913-63125935 CTTGTATGTCAGTTATCACATGG - Intergenic
1009589060 6:65642704-65642726 CTTATTAGACTGAAATCACAGGG - Intronic
1009941431 6:70293544-70293566 CTTGTTGACCAGACATCATATGG + Intronic
1015416016 6:132949447-132949469 CTTGTTGAACAAATATCCCAGGG + Intergenic
1015559534 6:134499588-134499610 CTTGTGGAATAGATATCACATGG + Intergenic
1016388100 6:143548591-143548613 TTTGTTGGACAGAGACCACTGGG + Intronic
1017037686 6:150281136-150281158 CTGGCTGTACAGAGATCACATGG - Intergenic
1018860993 6:167710416-167710438 CTCGTTGTACAGGCATCACATGG + Intergenic
1020614045 7:10436764-10436786 CTTATTGGAGAGAAATAACAGGG - Intergenic
1022970285 7:35510794-35510816 CTTGATGGACAGATGTGGCAAGG + Intergenic
1023259337 7:38342443-38342465 CTTGCTGGACAGAAGTCTCACGG + Intergenic
1023259793 7:38346764-38346786 CTTGCTGGACAGAAGTCTCATGG + Intergenic
1023260269 7:38351094-38351116 CTTGCTGGACAGAAGTCTCATGG + Intergenic
1023260781 7:38355926-38355948 CTTGCTGGACAGAAGTCTCACGG + Intergenic
1023261763 7:38365056-38365078 CTTGCTGGACAGAAGTCTCACGG + Intergenic
1024088851 7:45919607-45919629 CACGTTGGACAGATGTCACTGGG - Intronic
1026652064 7:72224372-72224394 TTTTTTGGATGGATATCACAGGG + Intronic
1028210983 7:88073924-88073946 TTTATTGGACAGATAACAAATGG + Intronic
1028593073 7:92519036-92519058 CTTGTTGACAAGATACCACATGG + Exonic
1029212057 7:98917260-98917282 ATTATTGGACAGATGTAACAGGG + Intronic
1039087001 8:33789855-33789877 CATGATGGACATTTATCACAGGG - Intergenic
1043539259 8:81240887-81240909 CTTGTGCCACAGATGTCACAGGG - Intergenic
1046326868 8:112660423-112660445 CATCTTACACAGATATCACATGG - Intronic
1048071993 8:131030868-131030890 CTTATTGGGCAGAGATCCCAGGG + Intronic
1055523863 9:77110291-77110313 GATGTTGGGCTGATATCACATGG + Intergenic
1060264179 9:122100853-122100875 CTCGGTGCACAGATATCATATGG - Intergenic
1186902822 X:14076110-14076132 CTTGTAGGACAGAGATCATAGGG + Intergenic
1187806486 X:23126918-23126940 CTTGTTGGACACAGAACACTGGG - Intergenic
1188815067 X:34703155-34703177 CTTGTTGGCAAGATATCAATGGG + Intergenic
1193326311 X:80181898-80181920 CTAGTTACACAGATATAACAAGG + Intergenic
1198676158 X:139133431-139133453 GTTGTTGTACAGATTTCAAAGGG + Intronic