ID: 984751930

View in Genome Browser
Species Human (GRCh38)
Location 4:183286387-183286409
Sequence TCCCACAATCGCTCAAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984751930_984751934 -6 Left 984751930 4:183286387-183286409 CCAGGTCTTGAGCGATTGTGGGA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 984751934 4:183286404-183286426 GTGGGAAGGGGTGTAAGACCTGG 0: 1
1: 0
2: 0
3: 24
4: 317
984751930_984751938 22 Left 984751930 4:183286387-183286409 CCAGGTCTTGAGCGATTGTGGGA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 984751938 4:183286432-183286454 TTTCTGAAGGACACACATTCTGG 0: 1
1: 1
2: 4
3: 24
4: 267
984751930_984751935 9 Left 984751930 4:183286387-183286409 CCAGGTCTTGAGCGATTGTGGGA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 984751935 4:183286419-183286441 AGACCTGGTACCTTTTCTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 151
984751930_984751939 28 Left 984751930 4:183286387-183286409 CCAGGTCTTGAGCGATTGTGGGA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 984751939 4:183286438-183286460 AAGGACACACATTCTGGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984751930 Original CRISPR TCCCACAATCGCTCAAGACC TGG (reversed) Intronic
903027079 1:20437066-20437088 TGCCACAATCCCTAAAGACCTGG + Intergenic
905754833 1:40500254-40500276 TCCCAAAGTCCTTCAAGACCTGG - Intergenic
923036374 1:230287732-230287754 TCCCACATTCCCTGAAGACTTGG - Intergenic
1063329169 10:5138747-5138769 TCCCACAATAGCACAAGACAGGG + Intergenic
1070626586 10:78055189-78055211 CCCCACAATCCCCCACGACCTGG + Exonic
1071812842 10:89201984-89202006 TCCCTCAATAGCCCAAGTCCAGG + Intergenic
1073044019 10:100625662-100625684 TCCCACAATCACAGAAGTCCTGG - Intergenic
1077498809 11:2899667-2899689 TCCCACATTCCCTCAGAACCAGG + Exonic
1078035961 11:7805817-7805839 TCCCACAAGCCCTGAAGTCCTGG + Intergenic
1080516520 11:33026817-33026839 TCCCATTATGGTTCAAGACCAGG + Intronic
1087266302 11:96065577-96065599 TCCCAGAATCAGACAAGACCTGG - Intronic
1095416432 12:41982262-41982284 TCCCTCAATCCCTCAATCCCTGG + Intergenic
1096091392 12:48904210-48904232 TCCCACAACCGCCCACAACCAGG + Exonic
1128759154 15:70203628-70203650 TCCCACCCCAGCTCAAGACCAGG - Intergenic
1129746216 15:78023363-78023385 TCCCACAAAGTCTCAAGAACCGG + Intronic
1139769443 16:69261979-69262001 TGGGAGAATCGCTCAAGACCAGG + Intronic
1144154838 17:12489408-12489430 TACAAAAATCACTCAAGACCTGG + Intergenic
1162427262 19:10603826-10603848 GCCCACAAGCGGGCAAGACCTGG - Intronic
1163038103 19:14583293-14583315 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163038792 19:14587550-14587572 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1163039538 19:14592217-14592239 TCCCTCCATCCCTCAAGCCCTGG - Intronic
1164583440 19:29449626-29449648 TCCCAGATCCGCTCAAGATCTGG - Intergenic
1164687139 19:30174300-30174322 TCCCAGGGTCGCTCAAGGCCTGG - Intergenic
1165245221 19:34494712-34494734 TCCCACTGTCGCCCAAGACCTGG - Intronic
926249555 2:11146597-11146619 TCACACAGTCGCTCAGGGCCAGG - Intronic
931847537 2:66220103-66220125 TCCCATCATCCCTCAACACCTGG + Intergenic
934776733 2:96943691-96943713 CCCCACTATCCTTCAAGACCTGG + Intronic
936077103 2:109408510-109408532 TCCCACACGCGCTCACGCCCAGG + Intronic
939933849 2:148264237-148264259 TGCTACAATCGCTTAAGTCCAGG + Intronic
942578232 2:177388966-177388988 TCGAACAATCGCTTAAGATCTGG + Intronic
944852924 2:203738449-203738471 ACACACACTCTCTCAAGACCTGG + Exonic
946811287 2:223528767-223528789 TCCCACATATGCACAAGACCAGG + Intergenic
1169440314 20:5628424-5628446 TTCAACAATTGCTCAAGGCCGGG + Intergenic
1171351429 20:24506068-24506090 TCCCACCAACTCTCAAGTCCTGG + Intronic
950635788 3:14313545-14313567 TCTCACCATCTCTTAAGACCAGG + Intergenic
950765197 3:15268282-15268304 TGCCACAGTGGCTCAAGTCCTGG - Intronic
962548369 3:136461254-136461276 TCCCATAAGAACTCAAGACCAGG + Intronic
964626444 3:158764387-158764409 TCTGAGAATCCCTCAAGACCAGG - Intronic
965379937 3:167975629-167975651 TCCCTAAATCTATCAAGACCTGG - Intergenic
965659509 3:171026697-171026719 TGCCACACTCACACAAGACCTGG - Exonic
968880595 4:3296849-3296871 TCCCACAACCTCTCATGACTGGG - Intronic
975801337 4:78061507-78061529 TCCCACAAACGCTGAATCCCGGG + Intronic
984751930 4:183286387-183286409 TCCCACAATCGCTCAAGACCTGG - Intronic
989732720 5:44667132-44667154 TCACACAATCTCTCTAGATCTGG + Intergenic
998164194 5:139833175-139833197 TCCCAAAGTCACTCAACACCAGG - Intronic
998437126 5:142120371-142120393 TCCCCCAAAAGCTCAAGAACTGG - Intronic
998491437 5:142550543-142550565 TCCCTCAAACCCTCCAGACCAGG - Intergenic
1019916100 7:4133674-4133696 GCTCACAGTAGCTCAAGACCCGG - Intronic
1038970188 8:32625005-32625027 TCTCACAATTGAACAAGACCTGG - Intronic
1043669345 8:82862672-82862694 TACCCCAATGGCTCAAGCCCGGG + Intergenic
1048638594 8:136327407-136327429 TCCAACAATCACTCCATACCAGG - Intergenic
1049082979 8:140457382-140457404 TCCCACACCCGCTGAAGACTCGG - Intronic
1049221555 8:141431007-141431029 ACCCACACACGCACAAGACCCGG + Exonic
1056170484 9:83980277-83980299 TCGCACCATCGCTGAAGCCCTGG - Intronic
1187017281 X:15342235-15342257 TCCAACAATCGATCAAGGCCAGG + Intergenic
1188807984 X:34614873-34614895 TCCCACCCTCCCTCAACACCTGG + Intergenic