ID: 984751978

View in Genome Browser
Species Human (GRCh38)
Location 4:183286851-183286873
Sequence CTTCTGACTCTCAATCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 216}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984751978_984751986 2 Left 984751978 4:183286851-183286873 CCCATCTGATTGAGAGTCAGAAG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 984751986 4:183286876-183286898 CTCAGTTGACAGCAGTTGGGGGG 0: 1
1: 0
2: 0
3: 11
4: 140
984751978_984751982 -2 Left 984751978 4:183286851-183286873 CCCATCTGATTGAGAGTCAGAAG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 984751982 4:183286872-183286894 AGGGCTCAGTTGACAGCAGTTGG No data
984751978_984751983 -1 Left 984751978 4:183286851-183286873 CCCATCTGATTGAGAGTCAGAAG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 984751983 4:183286873-183286895 GGGCTCAGTTGACAGCAGTTGGG 0: 1
1: 0
2: 0
3: 14
4: 106
984751978_984751985 1 Left 984751978 4:183286851-183286873 CCCATCTGATTGAGAGTCAGAAG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 984751985 4:183286875-183286897 GCTCAGTTGACAGCAGTTGGGGG 0: 1
1: 0
2: 0
3: 14
4: 132
984751978_984751984 0 Left 984751978 4:183286851-183286873 CCCATCTGATTGAGAGTCAGAAG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 984751984 4:183286874-183286896 GGCTCAGTTGACAGCAGTTGGGG 0: 1
1: 0
2: 1
3: 11
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984751978 Original CRISPR CTTCTGACTCTCAATCAGAT GGG (reversed) Intronic
900080881 1:856505-856527 CTTCTGCCTCACACTCGGATTGG + Intergenic
900768884 1:4524917-4524939 CATCTGGCTCTCAGTCACATGGG + Intergenic
902774119 1:18663705-18663727 TTTCTGACTCTCAATCCTCTAGG + Intronic
902856837 1:19213120-19213142 TCTCTGGCTCTCAATCTGATAGG - Intergenic
903766808 1:25740348-25740370 CTTTCAACTCTCAGTCAGATGGG + Intronic
904681663 1:32233622-32233644 CGTCTGAGTCTCAATCTCATCGG - Intergenic
905987102 1:42295642-42295664 CCTCTGCCTCTCAATTAGCTGGG + Intronic
907103290 1:51856761-51856783 CTTATAACTCCCAATCAGAAAGG + Intronic
911602847 1:99866015-99866037 CTTCAGCCTCTCAAGCAGCTGGG - Intronic
915462758 1:156080086-156080108 CTTCTGCCTCCGCATCAGATGGG - Intronic
915506399 1:156359495-156359517 CTTCAGCCTCTCAAGTAGATGGG + Intronic
916882079 1:169028733-169028755 CTTCTGCCTCCCAAGCAGCTGGG - Intergenic
917811751 1:178665331-178665353 CCTCAGCCTCTCAATCAGCTAGG - Intergenic
917913915 1:179681191-179681213 CTTCAGTCTCTCAAGCAGCTAGG + Intronic
917938411 1:179892355-179892377 CCTCAGACTCTCAAGCAGCTGGG - Intronic
918323526 1:183387862-183387884 CTCCTGACTCCCAATCAAACAGG - Intronic
918794870 1:188881027-188881049 CTTCTGAATTTTAATCAAATGGG + Intergenic
919793160 1:201305399-201305421 CCTCAGCCTCTCAAGCAGATGGG - Intronic
920870512 1:209790532-209790554 CTTTTGTCTCTCAATCAGGTTGG + Exonic
922301568 1:224306139-224306161 CTTCTGCCTCTCAAGTAGCTGGG - Intronic
923549290 1:234949560-234949582 CTTCAGCCTCTCAAGCAGCTGGG - Intergenic
923640471 1:235754346-235754368 CCTCAGCCTCTCAAGCAGATGGG + Intronic
1063163350 10:3437033-3437055 CTTCCGTCTCTCAAGGAGATTGG + Intergenic
1064500948 10:15972797-15972819 CTTCAGCCTCTCAAGCAGCTGGG + Intergenic
1065236973 10:23661914-23661936 CTACTAACTCTCATTCATATTGG - Intergenic
1070552668 10:77502999-77503021 CTTCAGCCTCTCAAGCAGCTAGG - Intronic
1073042615 10:100617851-100617873 CTACTGACCCTCCATCACATGGG - Intergenic
1074044168 10:109821144-109821166 TTTCTGACTCGCAATAAGATGGG + Intergenic
1074207380 10:111295655-111295677 ACACAGACTCTCAATCAGATAGG - Intergenic
1074586535 10:114772715-114772737 CTGCTGACTCTCACTCAGCATGG - Intergenic
1074683555 10:115935472-115935494 CTTCTGGTTCACAATCATATGGG + Intronic
1074789870 10:116876246-116876268 TTACTCACTGTCAATCAGATTGG - Exonic
1076151718 10:128167909-128167931 CTTCTCACTTTCAACCAGAGGGG + Intergenic
1076849879 10:133087520-133087542 CTGCTGACTCACACTCAGACGGG + Intronic
1078246810 11:9580933-9580955 CTTCAGACTCCCAAGCAGCTGGG - Intronic
1079109115 11:17594190-17594212 CTTATGCCCCTCACTCAGATGGG + Intronic
1079433316 11:20418951-20418973 CTGCTCTTTCTCAATCAGATGGG + Intronic
1080902926 11:36512523-36512545 CTTCTGACTCTCATTGAAATTGG + Intronic
1083295490 11:61713143-61713165 CTTCAGACTCACAATCATGTGGG - Intronic
1083498750 11:63083317-63083339 CTTTTGACACTGAATCATATGGG - Exonic
1083520134 11:63302447-63302469 CTTTTGACACTAAATCATATGGG + Exonic
1085242005 11:75064688-75064710 CTTCAGCCTCCCAAGCAGATGGG + Intergenic
1087441739 11:98193198-98193220 TTTCTGCCTCTTAAGCAGATTGG + Intergenic
1087627523 11:100613680-100613702 TTTCTGTCTCTTATTCAGATTGG - Intergenic
1089063997 11:115648462-115648484 CTTCAGCCTCTCTATCAGCTGGG + Intergenic
1089554212 11:119306428-119306450 CTTCTGCCCCTAAATCAGACAGG + Exonic
1089926297 11:122261840-122261862 CTTCAGCCTCTCAAACAGCTGGG - Intergenic
1090492458 11:127176848-127176870 CTTCAGTCTCTCAAGCAGACTGG + Intergenic
1092470208 12:8771306-8771328 CTTATGACCCACAATCAGAAAGG + Intronic
1093725390 12:22501959-22501981 CTTCTGACACTGAATCAAAATGG + Intronic
1095972093 12:47909254-47909276 CTTCAGCCTCTCAAGCAGCTTGG - Intronic
1096145417 12:49275525-49275547 CTTCAGCCTCTCAAGCAGCTGGG - Intergenic
1099016290 12:77347753-77347775 CTTATGACCCACAATCAGAAAGG + Intergenic
1099684489 12:85867145-85867167 CTTCCGACTCTTAATCACATAGG - Intergenic
1102375426 12:112418093-112418115 CTTCAGACTCCCAAGCAGCTGGG + Intronic
1105056930 12:133109963-133109985 CTTCAGCCTCTCAAGCAGCTGGG - Exonic
1106002283 13:25735373-25735395 CTTCAGCCTCTCAATTAGCTGGG + Intronic
1106513592 13:30433166-30433188 CTTCAGCCTCTCAAGCAGCTGGG - Intergenic
1107748518 13:43538937-43538959 CATCAGACTCTCAAGCAGCTGGG + Intronic
1107759643 13:43663966-43663988 CTTCTGCCTCTCCCTCTGATGGG - Intronic
1108196640 13:48001763-48001785 CTTCTGATGCTCAAAGAGATCGG + Intergenic
1108435953 13:50401727-50401749 CTTTTCACTCTCAATCAAAATGG - Intronic
1110488382 13:76072978-76073000 CTTATGACCCACAATCAGAAAGG - Intergenic
1111892281 13:94098555-94098577 CTTCTGATTCTCCATTAAATAGG + Intronic
1112082214 13:95984442-95984464 CCTCAGCCTCTCAATTAGATAGG + Intronic
1112884781 13:104156451-104156473 CTAGTGACTCTTAATGAGATAGG - Intergenic
1114838192 14:26229381-26229403 CTTCAGCCTCTCAAGTAGATGGG - Intergenic
1115274327 14:31590473-31590495 CTTCAGACTCAAAATCAGAGCGG - Intronic
1115375085 14:32665645-32665667 CTTAAGACTCACAATCAGAAAGG + Intronic
1115571284 14:34668943-34668965 CTTCTGCCTCTCAAGTAGCTGGG + Intergenic
1117358189 14:54946597-54946619 CCTCAGACTCTCAAGCAGTTGGG + Intronic
1119515766 14:75247051-75247073 CTTCAGCCTCTCAAGCAGCTGGG + Intronic
1121642592 14:95495789-95495811 CGTCTGTCTCTCAGTCAGTTGGG - Intergenic
1122011751 14:98755422-98755444 TTTCTCCCTCTAAATCAGATAGG - Intergenic
1202884670 14_KI270722v1_random:93890-93912 CTTCAGACTCTCAATTACCTGGG + Intergenic
1124615950 15:31242254-31242276 CTTCTGACCCTCCTTCTGATGGG + Intergenic
1127719134 15:61682840-61682862 TTTCTGTCTCTGAATGAGATTGG - Intergenic
1128967012 15:72069789-72069811 CTTCTGACTTTCAATTAGAATGG + Intronic
1129342181 15:74893246-74893268 CTTCTCACTCTTCATCAGGTGGG - Exonic
1132786412 16:1659151-1659173 CCTCTGACTCACAAGCAGAGAGG + Intronic
1132988467 16:2780324-2780346 CTTAAGACTCCCAATCAGAAAGG - Intergenic
1133687530 16:8180199-8180221 CTTCTGACTCTGAAACACAGTGG - Intergenic
1137352208 16:47723308-47723330 CTTCAGACTCCCAAGCAGCTAGG - Intergenic
1138966624 16:62092281-62092303 CTTCATACTCTCAATCAAAATGG - Intergenic
1140433576 16:74925867-74925889 CTTCAGCCTCCCAATCAGCTAGG - Intronic
1142324814 16:89407818-89407840 GATCTGACTCTCACTCAGGTGGG - Intronic
1143081397 17:4384066-4384088 CCTCTGCCTCCCAAGCAGATGGG + Intergenic
1144731064 17:17526587-17526609 CTTCTGGGTCCCACTCAGATGGG + Intronic
1148448047 17:47752780-47752802 CTTCTGATTCTCAATGATAGTGG + Intergenic
1150452115 17:65277997-65278019 CATCTGACTCTCAATCCAGTCGG - Intergenic
1152861993 17:82701811-82701833 CTTCTGACTCCCAAATAGCTGGG - Intergenic
1154166239 18:12016533-12016555 CTTCTGCCTCCCAAGCAGCTGGG + Intronic
1156756021 18:40527070-40527092 CCTCAGCCTCTCAAGCAGATGGG + Intergenic
1158252100 18:55500234-55500256 CTTCTGACTTTCATCCAGGTCGG - Intronic
1161878498 19:6930372-6930394 CTTCTGACTCTCACTCATGGTGG + Intronic
1162492431 19:11001351-11001373 CCTCTGGCTCCCAATCAGCTGGG - Intronic
1164454516 19:28396138-28396160 CTTCAGCCTCTCAAGCAGCTGGG - Intergenic
1165030813 19:32997009-32997031 CTTCTGACTCTTGAGCAGCTGGG + Intronic
1165208471 19:34212207-34212229 CTTCAGCCTCTCAAGCTGATAGG - Intronic
1167009578 19:46798183-46798205 CTTCAGACTCCCAATTAGGTGGG - Intergenic
925545960 2:5016719-5016741 CTTCTTACTCTCATTCTCATAGG + Intergenic
928198956 2:29234826-29234848 CTTCTGCCTCCCAAGCAGCTGGG + Intronic
928519712 2:32076810-32076832 CTTCAGACTCTCAAGCAGCTGGG + Intronic
929079317 2:38106742-38106764 CTTCTGACTCTCCATAAGAAAGG - Intronic
929489465 2:42383502-42383524 CCTTTTCCTCTCAATCAGATTGG - Intronic
930350370 2:50245865-50245887 CTTCTCAATGTCAAACAGATGGG + Intronic
930401095 2:50889246-50889268 TTTCTGACTTTCCATCAGACGGG + Intronic
933010320 2:77053938-77053960 TTTCTGACTCAAAATCACATAGG - Intronic
936798103 2:116231501-116231523 CTTCAGACTCCCAAGTAGATGGG - Intergenic
939109580 2:137991456-137991478 CTTATGACCCTCAATCACAAAGG + Intronic
939523834 2:143266637-143266659 TCTCTGTCTCTAAATCAGATTGG - Intronic
941880974 2:170480245-170480267 CTTATGACCCACAATCAGAAAGG - Intronic
941941705 2:171045903-171045925 CTTCTGTGTCTGAATCAGTTAGG - Intronic
942266694 2:174234577-174234599 CTTCAGCCTCTCAAGCAGCTGGG + Intronic
945366151 2:208956800-208956822 CTTCTTTCTCTCAGTCAGTTGGG + Intergenic
946476488 2:220011291-220011313 CTCTTGACTCACAATCAGAAAGG - Intergenic
946540005 2:220673791-220673813 ATTCTGCCTCTCAATATGATTGG - Intergenic
947756281 2:232567837-232567859 CTTCTGACACTCAATCACTGAGG - Intronic
1169890670 20:10448604-10448626 ATTCTTAATCTTAATCAGATGGG - Intronic
1170301047 20:14884911-14884933 TTTCTGACTGGCAATTAGATGGG - Intronic
1170406955 20:16048217-16048239 CTACTGACTCTCACTCAAAATGG - Intronic
1170469046 20:16649899-16649921 CCTCTGACTCTCAAGTAGCTGGG - Intergenic
1171403956 20:24897322-24897344 CTTCAGCCTCTCAGTCACATTGG + Intergenic
1173937020 20:46875452-46875474 CTTGTGACACACAATCAGAGGGG + Intergenic
1174236754 20:49100149-49100171 CTTCTGAGGCATAATCAGATTGG + Intergenic
1175387553 20:58606857-58606879 AATGTGACTCTCCATCAGATTGG - Intergenic
1179991541 21:44950742-44950764 CTCCTGACTCCCACTAAGATGGG - Intronic
1181137263 22:20777152-20777174 CTTCAGCCTCTCAAGTAGATGGG + Intronic
950784469 3:15422507-15422529 CCTCTGCCTCTCAAGCAGCTGGG - Intronic
953882379 3:46697315-46697337 CTTAAGACTCGCAATCAGAAAGG - Intergenic
956866942 3:73378498-73378520 CTTTTGAGTTTCATTCAGATGGG - Intergenic
957136464 3:76294962-76294984 CTTCTGACCCTCAGCCAGAGAGG - Intronic
957671043 3:83303187-83303209 CTTATGACCCACAATCAGAAAGG + Intergenic
958507259 3:94996070-94996092 CTTCTCATTCTCAATGAGAATGG - Intergenic
958572271 3:95901966-95901988 TTTGTTACTCTAAATCAGATAGG + Intergenic
958933455 3:100232131-100232153 CCTCAGCCTCTCAATCAGCTGGG - Intergenic
960046502 3:113203918-113203940 TTTCTGATTCTCAATGAGAGAGG + Intergenic
960894208 3:122484528-122484550 CTTCAGCCTCTCAAGCAGCTGGG - Intronic
963312150 3:143721100-143721122 CTTCTGCCTCCCAAGCAGCTGGG - Intronic
968230980 3:197004225-197004247 CTTATGACTTCCAATCAGAGTGG - Intronic
971514450 4:27469007-27469029 CTTATGACCCACAATCAGAAAGG - Intergenic
973333760 4:48935409-48935431 CTTCAGCCTCCCAAACAGATGGG + Intergenic
973880219 4:55263879-55263901 CTTCTGACTCTAAATCAGAAAGG - Intergenic
976702192 4:87982724-87982746 TTCCTGACTATCAATCACATCGG - Exonic
976819673 4:89191469-89191491 CTTCTTTCTCTCAAGAAGATTGG - Intergenic
977428638 4:96902813-96902835 CTGCTGGCTCTTCATCAGATTGG + Intergenic
979369596 4:119868410-119868432 CTTCAGACTATCATACAGATGGG + Intergenic
979707834 4:123742066-123742088 TTTCAGATTCTCAACCAGATTGG - Intergenic
980121857 4:128735598-128735620 CTTAAGACTCACAATCAGAAAGG + Intergenic
982056844 4:151559196-151559218 CTTCTGAGTCTCAATATGAAAGG - Intronic
982772930 4:159414733-159414755 CTTCAGACCCACAATCAGAAAGG - Intergenic
983188321 4:164726363-164726385 CCTCAGACTCCCAATCAGCTGGG - Intergenic
984751978 4:183286851-183286873 CTTCTGACTCTCAATCAGATGGG - Intronic
985122852 4:186661286-186661308 CTTATGACACACAGTCAGATTGG - Intronic
985815929 5:2127930-2127952 TTTCTGACCCTCTATCTGATGGG + Intergenic
986844072 5:11732851-11732873 CTTATGACCCACAATCAGAAAGG - Intronic
990199763 5:53358118-53358140 CTTTTTAATCTCAATCACATGGG - Intergenic
990361944 5:55029657-55029679 CTTCAGCCTCTCAAACAGCTGGG + Intronic
992759888 5:79942265-79942287 ATTCATACTCTGAATCAGATGGG + Intergenic
995708650 5:115012238-115012260 CTCCTGAGTCTGAGTCAGATGGG - Intergenic
997390271 5:133509403-133509425 CTTCTGATTCTTTATCAGAGAGG + Intronic
998104373 5:139459068-139459090 CTCCTGACTCTGCATCAGGTTGG - Intronic
999434409 5:151552234-151552256 CTTCAGCCTCTCAAGCAGCTGGG + Intronic
999990667 5:157047166-157047188 CTTATGACCCACAATCAGAAAGG - Intronic
1000568323 5:162880189-162880211 CTTCCTACTCTCAGTCAGTTGGG + Intergenic
1004638722 6:17493559-17493581 CTTCTGGCCCTCAATCAGCCAGG - Intronic
1005871157 6:29975213-29975235 CTCCTGACTCTCAAGCTGAGGGG - Intergenic
1013296476 6:108762152-108762174 CCTCAGCCTCTCAAGCAGATGGG - Intergenic
1014161156 6:118170213-118170235 ATTTTAACTCTCAATCAAATTGG - Intronic
1014398390 6:120955228-120955250 CTTTTGACTCTTAATCATACAGG - Intergenic
1015232838 6:130936363-130936385 CTTCTGACCCTCCAACAGAAGGG + Intronic
1016167449 6:140964431-140964453 TTTCTGACTCTAAAGCAAATAGG - Intergenic
1020875214 7:13684983-13685005 TTTCTGACTCTGAATCACATGGG - Intergenic
1021725012 7:23540326-23540348 CTTATGACCCACAATCAGAAAGG - Intergenic
1021853565 7:24832089-24832111 CTTCTGCCTCCCAAGCAGCTGGG - Intronic
1022117420 7:27274410-27274432 CTTCTTGCTCTCAATGATATGGG - Intergenic
1022130757 7:27402383-27402405 CTTCTGCCTCCCAATTAGCTGGG + Intergenic
1023468143 7:40481475-40481497 CTTCTGGCTCTCAAGGACATAGG - Intronic
1024761190 7:52598029-52598051 CTTCCCACTCTCAGTCAGTTGGG + Intergenic
1027410532 7:77912846-77912868 CTTCAGACTCTCAAGTAGCTGGG + Intronic
1028465145 7:91142840-91142862 CATCTCATTCTCAATCAGTTGGG - Intronic
1031069409 7:117145089-117145111 CTTCAGCCTCTCAAGCAGCTGGG - Intronic
1035107583 7:156455091-156455113 GTTCTGAGTCACAATCAGAAAGG - Intergenic
1036416847 8:8558281-8558303 ATTTTTACCCTCAATCAGATAGG + Intergenic
1036531964 8:9598967-9598989 CTTCTGTCTCATAAACAGATTGG + Intronic
1036996125 8:13658818-13658840 CCTCTGCCTCTCAAGCAGCTGGG + Intergenic
1037436499 8:18869303-18869325 CCTCAGACTCTCAAGCAGCTGGG + Intronic
1040888830 8:52294280-52294302 CTTCTGACCCTGAACCAGAAAGG + Intronic
1041669501 8:60478514-60478536 CTTATGACCCACAATCAGAAAGG + Intergenic
1042915679 8:73873538-73873560 CTTCAGACTCCCAAGCAGCTGGG - Intronic
1043023582 8:75037638-75037660 CTTCTGATTTTCATTCAGGTGGG + Intergenic
1044757909 8:95485370-95485392 CCTCTGAGTCTCAAGCAGACCGG + Intergenic
1045221147 8:100201716-100201738 CTTCTGACCCACAATCAGAAAGG - Intronic
1046650521 8:116832508-116832530 CTTCTGATTCTCAAACCTATGGG + Intronic
1047461535 8:125070293-125070315 TGTGTGACTCACAATCAGATAGG + Intronic
1047773330 8:128048599-128048621 GGTCTGACTCACCATCAGATGGG - Intergenic
1048943351 8:139422254-139422276 CTTCTGACTATCAAGGGGATTGG + Intergenic
1049151518 8:141038070-141038092 GTTCTGACTCATAACCAGATGGG - Intergenic
1049445242 8:142627352-142627374 CTTCTGACTCTCAATCTTCTCGG + Intergenic
1049861993 8:144905052-144905074 CTTATGACCCACAATCAGAGAGG + Intergenic
1051433197 9:17001877-17001899 CTCATGATTCTCAATCAGTTGGG - Intergenic
1051454439 9:17238478-17238500 CTTATGACCCTCATTCAGAGAGG + Intronic
1055459019 9:76499241-76499263 CCTCTGCCTCTCAATTAGCTGGG + Intronic
1057660452 9:96996852-96996874 CTTCTGCCTCCCAAGCAGCTGGG + Intronic
1057917797 9:99071046-99071068 CCTCTGTCTCTCAAGGAGATTGG + Intergenic
1058011105 9:99978240-99978262 CTTCTAACTCTGAATTAGACTGG + Intergenic
1059038789 9:110789661-110789683 CTTCAGCCTCTCAAGCAGCTGGG - Intronic
1059224857 9:112662674-112662696 CTTCAGACTCTCAAGTAGCTGGG - Exonic
1059639228 9:116200280-116200302 CTTCTGACCCTCCTTCAGCTGGG + Intronic
1060494611 9:124109182-124109204 CTTCTGAATCTCAAACAGTTTGG - Intergenic
1060858545 9:126934885-126934907 CTTCAGACCCTTAATCAGAAAGG + Intronic
1061660460 9:132126742-132126764 CTTCTGACGCTCCATCAGTGAGG - Intergenic
1062543835 9:137053198-137053220 CTTCTGACTCCCCATCAGGCTGG + Intronic
1185870720 X:3662754-3662776 CCTCTGTCTCTCAAGTAGATAGG - Intronic
1187366330 X:18668533-18668555 CTCCTGTTTCTCAAGCAGATTGG - Intronic
1187498194 X:19814393-19814415 CTTGTGACTCTGAGTGAGATGGG - Intronic
1188282396 X:28286329-28286351 CCTCTGCCTCTCAAGCAGCTGGG - Intergenic
1188359023 X:29229633-29229655 GATCTGTTTCTCAATCAGATTGG + Intronic
1190903027 X:54697368-54697390 TTTCTTACTCTCCACCAGATTGG + Intergenic
1191023791 X:55891486-55891508 ATTCTGTCTCCCAATAAGATAGG - Intergenic
1192778454 X:74269263-74269285 CTTCAGCCTCTCAAGCAGCTGGG - Intergenic
1194594127 X:95836700-95836722 CCTCTGCCTCCCAATCAGCTTGG + Intergenic
1194896960 X:99454824-99454846 CCTCAGACTCTCAAGCAGCTGGG + Intergenic
1196139903 X:112249622-112249644 CTTCAGACTCGGACTCAGATTGG + Intergenic
1196532988 X:116811580-116811602 CTTCTGATTCTCAGTCGTATTGG + Intergenic
1197959100 X:131984790-131984812 TTTCTGACTCTCAAGCTTATAGG + Intergenic
1198409800 X:136355023-136355045 CTTAAGACTCACAATCAGAAAGG + Intronic
1200761699 Y:7044759-7044781 CTTCAGCCTCTCAATTAGCTGGG + Intronic
1201633229 Y:16093170-16093192 CTTCAGCCTCTCAATTAGCTGGG - Intergenic