ID: 984754442

View in Genome Browser
Species Human (GRCh38)
Location 4:183312829-183312851
Sequence CCTTGTCAGGCTCTGAGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984754435_984754442 3 Left 984754435 4:183312803-183312825 CCTTGGGCAGCCCCAGAAACCTT 0: 1
1: 0
2: 2
3: 31
4: 264
Right 984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG 0: 1
1: 0
2: 1
3: 22
4: 272
984754436_984754442 -7 Left 984754436 4:183312813-183312835 CCCCAGAAACCTTACACCTTGTC 0: 1
1: 0
2: 0
3: 10
4: 144
Right 984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG 0: 1
1: 0
2: 1
3: 22
4: 272
984754437_984754442 -8 Left 984754437 4:183312814-183312836 CCCAGAAACCTTACACCTTGTCA 0: 1
1: 0
2: 0
3: 4
4: 131
Right 984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG 0: 1
1: 0
2: 1
3: 22
4: 272
984754438_984754442 -9 Left 984754438 4:183312815-183312837 CCAGAAACCTTACACCTTGTCAG 0: 1
1: 0
2: 1
3: 9
4: 115
Right 984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG 0: 1
1: 0
2: 1
3: 22
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984754442 Original CRISPR CCTTGTCAGGCTCTGAGATG TGG Intronic
900225606 1:1532264-1532286 CTTTGTCTGGCTTTGATATGAGG + Intronic
900230868 1:1556680-1556702 CCTTGTGTGGCTCTGTGTTGAGG - Intronic
900309243 1:2025380-2025402 CCATGTTGGCCTCTGAGATGTGG - Exonic
900569434 1:3351128-3351150 GCTTGTGGGTCTCTGAGATGTGG + Intronic
900762947 1:4485220-4485242 ACATGTTAGGCTCTGAGGTGAGG + Intergenic
900783399 1:4632267-4632289 CCATGTGAGGCTCTGGGATGAGG + Intergenic
900795957 1:4708562-4708584 CCTTGGGCGGCTCTGAGATGAGG - Intronic
901012602 1:6210021-6210043 CCTGCCCAGGCTCTGAGCTGAGG - Intronic
901490441 1:9593815-9593837 CCTTGTCCGGCTCAGGGGTGGGG + Intronic
902413713 1:16226872-16226894 ACTTGTCCGGCTCCGAGCTGCGG + Intergenic
902471651 1:16650910-16650932 CCTTGTCAGTCTCAGGGATGTGG - Intergenic
902487158 1:16756535-16756557 CATTGTCAGTCTCAGGGATGTGG + Intronic
903669382 1:25026440-25026462 CCTTGCCAGCCTCAGGGATGGGG + Intergenic
903743514 1:25572052-25572074 CCAGGTCAGGCTCTTAGAAGAGG + Intergenic
904038695 1:27572062-27572084 CCCTGTCAGGCCTTGAGTTGGGG - Intronic
904523294 1:31112768-31112790 CCTTGTCAGGCAGTGGGGTGGGG + Intergenic
905283145 1:36861819-36861841 CCAGGTCAGGATCTGGGATGGGG + Intronic
905707270 1:40070311-40070333 CCTTCTCGGGCTCTGGGACGGGG - Intronic
906145319 1:43557142-43557164 TCTTTTCAGGCTCTCAGATTGGG + Intronic
906751522 1:48267131-48267153 CCATCGCAGGCCCTGAGATGGGG - Intergenic
907404180 1:54243665-54243687 CATTGAGAGGCTCTGAGGTGAGG + Intronic
907707341 1:56844298-56844320 CCTAGTCAGACTCTGAGGTCAGG + Intergenic
907950063 1:59174264-59174286 ACTAGCCAGGCTCTGACATGTGG + Intergenic
908849896 1:68365073-68365095 CCTTCTCTGGATGTGAGATGGGG + Intergenic
909057989 1:70845288-70845310 CCTAGTGAGGCTGTGAGAAGAGG + Intergenic
909489261 1:76208136-76208158 TCTTGGTAGGCCCTGAGATGAGG - Intronic
911086078 1:93978492-93978514 GCTTGGCAGGCTCTGCCATGAGG + Intergenic
916006092 1:160662235-160662257 CCTTGCCAGACTTTGATATGAGG + Intergenic
916045870 1:160999580-160999602 CCATGCCAGGCCCTGGGATGGGG + Intronic
916053399 1:161051482-161051504 CATTGTAGGGGTCTGAGATGTGG + Exonic
916575213 1:166060604-166060626 CCTTCTCAGTCTCTGCCATGTGG + Intronic
917035675 1:170744789-170744811 CCTGTTCAGGCCCTGAGAGGGGG - Intergenic
919997072 1:202762041-202762063 CCGTTTCAGGCTCTCAGAAGGGG + Intronic
920102080 1:203523110-203523132 CATTCTCAGACTCTGGGATGGGG - Intergenic
920529400 1:206690809-206690831 CCTTGCCATGCTCTGAGCTGGGG + Intronic
921941150 1:220841343-220841365 CCTTGTGAGACTCTGAGCAGAGG - Intergenic
922706224 1:227791791-227791813 CCTGGTCAGGGTGTGAGTTGGGG - Intergenic
923319264 1:232814304-232814326 GGTTGTCAGGGGCTGAGATGAGG - Intergenic
923413343 1:233731376-233731398 CCTTCTCAATCTGTGAGATGGGG - Intergenic
924056856 1:240132650-240132672 GTTTGTCAGGGTCTGTGATGAGG + Intronic
1067104970 10:43360581-43360603 CCTCAGCAGGCTCTGAGATTTGG - Intergenic
1069059457 10:63879705-63879727 CCTTGTCTGGCTTTGGTATGAGG + Intergenic
1069590116 10:69636193-69636215 CCCTGAAAGGCTCTGAGAGGCGG - Intergenic
1069710191 10:70483087-70483109 CCATGTCTGGTTCTGTGATGGGG + Intronic
1069914195 10:71777296-71777318 CCTCGTAAAGCTCTGAGCTGGGG + Intronic
1073434427 10:103507686-103507708 GCTGGGCAGGCTCTGAGCTGTGG + Intronic
1075975800 10:126693065-126693087 CCTTGTCTGGCTTTGACATCAGG + Intergenic
1076138927 10:128064375-128064397 CCTTGTCATGCTTTGTCATGGGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077362747 11:2147925-2147947 CCTTGTCAGGATCTGGGCAGCGG + Intronic
1077474501 11:2779973-2779995 CCCTGTCAGGCTCTGAGCCGGGG + Intronic
1078224497 11:9379715-9379737 CCATCTCAGACTCTGAGAGGGGG + Intergenic
1080232865 11:30037394-30037416 CCTTGTGAGGCTCTGTCAGGAGG - Intergenic
1080653829 11:34243034-34243056 CCTTATCAGGCTCCCAGATTCGG - Intronic
1080872479 11:36249125-36249147 CATTGTCAGGCTCTCTGGTGAGG + Intergenic
1081170446 11:39863238-39863260 CTTTGTCTGGTTCTGATATGAGG + Intergenic
1082782090 11:57295700-57295722 CCTTGTCTTTCTCTGAGATTTGG - Intergenic
1083333583 11:61910448-61910470 CCATGTCAGCCTCTGACCTGGGG + Intronic
1084800560 11:71540886-71540908 CCATGTCAGCCTCTGAAGTGGGG - Intronic
1085449629 11:76624022-76624044 CCTTGTGAGGTTCTGGGGTGGGG + Intergenic
1085491580 11:76924058-76924080 CCTTGGCAGGCTCCCTGATGAGG - Intronic
1088766561 11:112986386-112986408 CCTTGTCTGGCTTTGATATCAGG + Intronic
1088789587 11:113212530-113212552 TCTTGTCAGACTCTGAGATCTGG - Intronic
1088961789 11:114674817-114674839 CCTTGTCTGGCTTTGATATCGGG - Intergenic
1089835397 11:121365972-121365994 CCTGGTCAGGGACTGAGAAGAGG - Intergenic
1089846125 11:121460056-121460078 CCTTGTCAGCCACTCAGATTTGG - Intronic
1092618152 12:10234366-10234388 CCTAGTCGAGCTCTGAGAAGAGG - Intergenic
1095213946 12:39526786-39526808 CCTAGTAAAGCTCTGAGAAGAGG - Intergenic
1096150882 12:49311710-49311732 CCTTGTCTGGCTTTGATATCAGG - Intergenic
1096464072 12:51838556-51838578 CAGAGTCAGCCTCTGAGATGTGG + Intergenic
1098049884 12:66442358-66442380 CCTTGTAAGGCTCTCGGAAGAGG - Intronic
1098293420 12:68980527-68980549 CACTGTCAGGGACTGAGATGGGG - Intergenic
1098399026 12:70053513-70053535 CAATGACAGGCTCTGAGAAGAGG - Intergenic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1099904922 12:88760769-88760791 CCTTGTTAGACTCTGAGGTCTGG - Intergenic
1100068407 12:90680149-90680171 TATTGTCAGGCTCTGACATGAGG - Intergenic
1103254392 12:119528326-119528348 GCTTTTCAGTCTCTAAGATGGGG - Intronic
1104271981 12:127290457-127290479 CCTGGTGAGGGTCAGAGATGGGG - Intergenic
1104584094 12:130033933-130033955 CCTTCTGAGGCTCTCAAATGGGG + Intergenic
1106054364 13:26224375-26224397 CCTTGGCAGGTTCTGAGACCTGG - Intergenic
1106157953 13:27174557-27174579 CATTGTGAGGCTCTGTGATTAGG - Intergenic
1110382782 13:74873728-74873750 CCTTCTAAGGTTCTGAGAGGCGG - Intergenic
1110924372 13:81131835-81131857 CCTAGTGAAGCTCTGAGAAGAGG + Intergenic
1113104770 13:106760098-106760120 ACATGCCAGGCTCTGAGCTGAGG - Intergenic
1113597424 13:111543528-111543550 CCCTGTTAAGCTCTGTGATGGGG - Intergenic
1118369561 14:65125822-65125844 CATTGTCAGGGTCTGAGTGGAGG + Intergenic
1118376693 14:65183769-65183791 CCTTGTCTGGCTTTGATATCAGG + Intergenic
1118610929 14:67539205-67539227 CCTTGTAAGGCTCTCAGAGAAGG - Intronic
1118855011 14:69614024-69614046 CCTGGTCAGTCTCTGAGGTGTGG + Intronic
1119125523 14:72122205-72122227 CATATTCAAGCTCTGAGATGAGG + Intronic
1119161670 14:72458046-72458068 CCATGTCAGACTCTCAGAGGTGG + Intronic
1120089208 14:80311548-80311570 CCTTATCAGGCAATGAGGTGAGG - Intronic
1121163127 14:91764036-91764058 CCTTGTCTGGCTTTGATATCAGG - Intronic
1122054040 14:99080333-99080355 CATGGTAAGGCTCTGGGATGGGG - Intergenic
1122150479 14:99723188-99723210 CTTTCTCTGTCTCTGAGATGTGG + Intronic
1125213930 15:37247267-37247289 CCTTGCCAGGCCCTGATATTTGG - Intergenic
1126369411 15:47929640-47929662 CCCTGTTAAACTCTGAGATGTGG + Intergenic
1127804423 15:62505810-62505832 CCTTGTCTGCCTCTATGATGGGG + Intronic
1129671523 15:77610463-77610485 CCTGGACAGCCTCTGAGACGGGG - Intergenic
1130216545 15:81976518-81976540 CCTTATCTGGCTTTGATATGAGG - Intergenic
1130446704 15:84008846-84008868 CCTTGTCATTCACTGAGATGAGG - Intronic
1130649862 15:85756425-85756447 CCTTGTTGGGCTTTGGGATGTGG - Intergenic
1131190044 15:90307554-90307576 CCATCTCAGGCTCATAGATGAGG + Intronic
1131405626 15:92162040-92162062 CCTTCTCAGGCTCTCAGCAGAGG + Intronic
1134808690 16:17148058-17148080 CATTCACAGGCTATGAGATGTGG + Intronic
1135208610 16:20504133-20504155 CCTTTTCAGGATCTGCTATGGGG - Intergenic
1135230959 16:20707183-20707205 CCTTTTCAGGATCTGCTATGGGG - Intronic
1136291264 16:29272938-29272960 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1136651850 16:31679684-31679706 TCTTTGCAGGCTCTGAGCTGGGG + Intergenic
1137541440 16:49364942-49364964 CCTTGTCAGGGGCTGGGGTGCGG - Intergenic
1137806549 16:51311676-51311698 CCCTGTCAAGCTTTCAGATGAGG + Intergenic
1139372037 16:66475013-66475035 CCTTGACAGGCTCTGGGAGAGGG - Intronic
1141752659 16:85969506-85969528 CCTTGTGAGGTTCTGTGATTTGG + Intergenic
1141977199 16:87524725-87524747 TCGTGTTAGGGTCTGAGATGGGG + Intergenic
1142066574 16:88066213-88066235 GCTTTTAAGACTCTGAGATGAGG + Intronic
1142097136 16:88246404-88246426 ACTTGGCTTGCTCTGAGATGGGG - Intergenic
1142310230 16:89307885-89307907 CCTCATCAGGTTCTGAGATTAGG - Intronic
1142310264 16:89308108-89308130 CCTCATCAGGTTCTGAGATGAGG - Intronic
1143524248 17:7463112-7463134 GCAGGTCAGTCTCTGAGATGCGG + Exonic
1144248578 17:13393421-13393443 CCTGGGCAGGCTCTGGGATGAGG + Intergenic
1144445478 17:15323372-15323394 CCTGGTCTGGCTCTGGGATGGGG - Intronic
1145217337 17:21061818-21061840 CATTGGCTGCCTCTGAGATGGGG + Intergenic
1147198105 17:38781177-38781199 AGGTGTCAGGCTCAGAGATGAGG - Intronic
1147614587 17:41820606-41820628 CCTCGACATGCTCCGAGATGGGG - Intronic
1147847982 17:43418773-43418795 CCTTGTCAGGCCTTTAGAAGAGG - Intergenic
1150209375 17:63433831-63433853 CCCTGGGAAGCTCTGAGATGAGG - Exonic
1150293272 17:63993692-63993714 GTGTGTCAGGTTCTGAGATGTGG - Intergenic
1150445063 17:65222366-65222388 CCCAGTCAGGCTATGTGATGAGG - Intronic
1150576075 17:66432206-66432228 GCTGGTCAGGCTTTGAGAGGTGG + Intronic
1152117691 17:78398801-78398823 CCTTCTCAGGCTCTGTGTGGTGG + Intronic
1152800828 17:82329959-82329981 CCATGTCAGGTTCTGGGATGAGG + Intronic
1154327967 18:13405812-13405834 CCCTGTCCTGCTCTGAGCTGAGG + Intronic
1156963352 18:43059944-43059966 CCTTCTTAGCCTCTGAGGTGGGG - Intronic
1157364682 18:47053750-47053772 CCTTTTCTAGCTCTGAGATCTGG - Intronic
1157901520 18:51522715-51522737 CCTAAGCAGGGTCTGAGATGAGG - Intergenic
1158171192 18:54602746-54602768 CCTTGTCAGCCTCTGGGGTAAGG + Intergenic
1160460877 18:79037260-79037282 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460895 18:79037336-79037358 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1160460912 18:79037412-79037434 CCTTGGAAGGCTCTGAGATATGG - Intergenic
1160460930 18:79037488-79037510 CCCTGGAAGGCTCTGAGATATGG - Intergenic
1164473727 19:28556452-28556474 CCTTCTCAGGTTCTGGGAAGTGG - Intergenic
1165282312 19:34807775-34807797 CATTCTCAGGCTCTGGGATGGGG + Intergenic
1166505215 19:43367145-43367167 CCTTTTCTGGCTTTGAGGTGTGG - Intergenic
1166509342 19:43393950-43393972 CCTTTTCTGGCTTTGAGGTGTGG + Intergenic
1166523707 19:43497937-43497959 CCCAGGCAGGCTCTGAGATATGG - Intronic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1167674602 19:50876637-50876659 TCTTGGCAGGCTCTGACAGGCGG - Exonic
1167782175 19:51605904-51605926 CCTCAGCAGGCTCTGACATGGGG - Intergenic
1202704049 1_KI270713v1_random:7705-7727 CCTTGTCAGTCTCAGGGATGTGG - Intergenic
925634926 2:5933800-5933822 TGATGTCAGGCTCTGGGATGAGG + Intergenic
926287447 2:11501021-11501043 CCTTCTCAGGGTCTTACATGAGG + Intergenic
927248926 2:20981020-20981042 CTCTGCCAGGCTCTGAGATCTGG - Intergenic
927865060 2:26582950-26582972 CCATGTCAGGCAGTGAGGTGGGG + Intronic
927906466 2:26862129-26862151 CCTTGTGAGGCTCTAAGCAGAGG + Intronic
927955287 2:27203637-27203659 CCTTGTCATGCACACAGATGGGG + Intronic
929792287 2:45032180-45032202 TCTTGTCCTGCCCTGAGATGAGG - Intergenic
930816266 2:55601268-55601290 CCTTGTCAGGTTTTAAGAGGAGG - Intronic
932137407 2:69243277-69243299 CCCTGTGAGGCTGTGAGTTGTGG + Intronic
934559310 2:95304388-95304410 CCTGTTGAGGCTCTGAGCTGAGG + Intronic
934655303 2:96114251-96114273 CCCTGGCAGGCGCTGGGATGGGG - Exonic
935611478 2:105030376-105030398 CCATGTCAGCCTCTAAAATGTGG - Intergenic
935627541 2:105183770-105183792 TGTTTTCAGGATCTGAGATGTGG - Intergenic
935787412 2:106561366-106561388 CCGTCCCTGGCTCTGAGATGTGG - Intergenic
937007394 2:118529730-118529752 CCTAGTCAGGCTGTGATGTGTGG + Intergenic
937295727 2:120808736-120808758 CCTTGTCTGTCTGTGAAATGGGG + Intronic
937688717 2:124728258-124728280 CCTTGTCTGGCTTTGATATTAGG + Intronic
937998976 2:127716948-127716970 CATTGTCAGCCTCTGGGGTGAGG + Intronic
938749221 2:134312816-134312838 CCTTTTCAGACTGTCAGATGAGG + Intronic
940003094 2:148986708-148986730 CCTGGTAGGGCTCTGGGATGGGG + Intronic
940830683 2:158461854-158461876 CCTTGCCAAGCTCACAGATGTGG - Intronic
944135015 2:196389623-196389645 CCTTGTCAGGGTCTCAGAGGTGG + Intronic
945654531 2:212607009-212607031 ACTTGTCATCCACTGAGATGGGG - Intergenic
945767211 2:213995896-213995918 GCTTGTCAGGCTCTGTGAGAAGG - Intronic
948447826 2:238046691-238046713 GCTTAACATGCTCTGAGATGAGG + Intronic
948706655 2:239797932-239797954 ACTTCTCAGGCTCTCAGCTGGGG + Intronic
1168800235 20:640073-640095 CCTTGTGAGGCTTTGAGCAGAGG - Intergenic
1169953034 20:11068386-11068408 TCTTGTCTGGGGCTGAGATGGGG + Intergenic
1170110252 20:12797234-12797256 CCATGTCAATCTCTGAAATGAGG - Intergenic
1171561910 20:26134453-26134475 CCTACTCAGGCTCTGCGAGGAGG - Intergenic
1172032096 20:31989420-31989442 CCTTGGAAGGCTTTGAGAAGGGG + Intronic
1172628277 20:36361078-36361100 CCTTTGCTGGCTCTGAGATGTGG - Intronic
1172853930 20:37986669-37986691 CCTTCTGAGGCTCTGAGGAGAGG + Intronic
1173049188 20:39542490-39542512 CCTTGTGAGCCTCTGAGCAGAGG + Intergenic
1173424345 20:42929960-42929982 CCAGATCAGGCACTGAGATGGGG - Intronic
1173523623 20:43716379-43716401 CCTAAGCAGGGTCTGAGATGAGG - Exonic
1175228326 20:57458352-57458374 CCTTGTCAGGCCCTGGGCAGTGG - Intergenic
1175678924 20:60970432-60970454 CATTGTCAGCCCCTGAAATGTGG - Intergenic
1176172684 20:63703305-63703327 GCTTGTCTGGCACTGGGATGGGG - Intronic
1177269530 21:18829440-18829462 ACTCTTCAGGCGCTGAGATGTGG - Intergenic
1177404081 21:20643406-20643428 CGTTGTCAGGATGTAAGATGTGG + Intergenic
1179043076 21:37822196-37822218 CCTTGTCATGCTAGGAGCTGGGG + Intronic
1179377337 21:40862406-40862428 CCTTCTGAGGCTCTGAGAGAGGG + Intergenic
1181728774 22:24829936-24829958 CCATTCCAGGCTCTCAGATGTGG - Intronic
1181863226 22:25835337-25835359 CCTTTTCTGGGTCTTAGATGAGG + Exonic
1182144774 22:27990700-27990722 CCTGGGCAGGCTCTGAGCTCGGG - Intronic
1184270754 22:43381519-43381541 GGGAGTCAGGCTCTGAGATGGGG + Intergenic
949642292 3:6050410-6050432 CCTTGTCTGGCTTTGATATCAGG - Intergenic
951084715 3:18498084-18498106 CAATGTCAGGAGCTGAGATGTGG + Intergenic
951119687 3:18910808-18910830 CATTGTCAGTCTCAGGGATGTGG + Intergenic
952952808 3:38538476-38538498 CTTTGGGAGGCTCTGTGATGGGG + Intronic
953273655 3:41472787-41472809 CCTTGTCTGGCTTTGGTATGAGG - Intronic
955005166 3:54961872-54961894 ACTTCTCAGCCTCTGAGAAGAGG - Intronic
955458503 3:59152291-59152313 TATAGGCAGGCTCTGAGATGGGG - Intergenic
961787753 3:129357848-129357870 CCTCGGAAGGCTCTGAGATACGG + Intergenic
962852746 3:139319947-139319969 CCTTGTTAGGCTCTGCCAAGAGG + Intronic
963983506 3:151566441-151566463 CCTTGTTAGCCACTGAGATTTGG - Intergenic
964966144 3:162495960-162495982 CCTAGTGGGGCTCTGAGAAGAGG - Intergenic
969145266 4:5118030-5118052 CCTTGTCTGGCTTTGATATCAGG + Intronic
969314308 4:6372247-6372269 CCTTGTGAGGCCCTAGGATGAGG + Intronic
969361789 4:6669007-6669029 CCACATCAGGCTCTGAGAAGAGG - Intergenic
969902455 4:10362469-10362491 CCTCCTCAGCCTCAGAGATGGGG + Intergenic
972301863 4:37792304-37792326 CCTAGTGAGGCTGTGAGAAGAGG + Intergenic
973068364 4:45825440-45825462 TCTTGTCAGGATTTCAGATGAGG + Intergenic
973724387 4:53759607-53759629 CCTTGTCTGGCTTTGAAATCAGG - Intronic
975242854 4:72082001-72082023 CCTTGTCAGGGAGTGGGATGAGG + Intronic
975925766 4:79450442-79450464 GGTGGTCAGGATCTGAGATGTGG + Intergenic
978713829 4:111817641-111817663 CCTTGTGAGACTCTGAGTAGAGG + Intergenic
979076042 4:116272205-116272227 CCTTGTCTGGCTTTGGCATGAGG + Intergenic
980829995 4:138119571-138119593 CCTTGTCTGGCTCTGGTATCAGG + Intergenic
981224872 4:142282489-142282511 CCTTGTTAGGCCCTGAGCAGAGG - Intronic
983544298 4:168946363-168946385 CTTGCTCAGGCTCTGAGAGGAGG - Intronic
984389515 4:179110859-179110881 CCATGTGAGACTCTGAGAAGAGG - Intergenic
984754442 4:183312829-183312851 CCTTGTCAGGCTCTGAGATGTGG + Intronic
985950192 5:3217169-3217191 CCTCCTCAGGATCTGTGATGAGG - Intergenic
986741562 5:10710022-10710044 GATTGCCAGGCTCTGTGATGAGG + Intronic
987662481 5:20894731-20894753 CCTTGTGAAGCTGTGAGAAGAGG + Intergenic
987967315 5:24893355-24893377 CTTTGTGAAGCTGTGAGATGAGG - Intergenic
989274469 5:39571026-39571048 CCTTATAAGGCTCTGGGATAGGG + Intergenic
991615697 5:68494940-68494962 CCTTGTGAGACCCTGAGCTGGGG + Intergenic
994583090 5:101673097-101673119 CCTTGTTAGACTCTGAACTGAGG - Intergenic
994709825 5:103253961-103253983 CCTTGGCAGGCTTTGATGTGAGG + Intergenic
994979937 5:106861009-106861031 CCTAGTTAGGCTCTGAGATGTGG - Intergenic
995359634 5:111280673-111280695 CCGTGTAAATCTCTGAGATGTGG + Intronic
997445548 5:133937161-133937183 CCTTGCCAGTCCCTGAGCTGAGG - Intergenic
997716870 5:136049058-136049080 CTTTGTCTGGCGGTGAGATGGGG + Intronic
997758778 5:136424660-136424682 CCTTTTCAGACTCTGGTATGAGG + Intergenic
1000026589 5:157363976-157363998 CCCTGAGAGGCTCTGAAATGGGG + Intronic
1003403772 6:5811544-5811566 CCCTATCAGGCTCTCACATGAGG + Intergenic
1003984927 6:11426028-11426050 CCTTGTTAGGGTCTGTGGTGGGG - Intergenic
1004734603 6:18392713-18392735 CCTATTCAGGCTCTGTGAGGTGG - Intronic
1006458816 6:34146269-34146291 CCTGGACAGGCTGTGAGATCTGG - Intronic
1007748801 6:44059317-44059339 CCTTCTCAGGGTCTGACAAGAGG - Intergenic
1009726589 6:67543174-67543196 CCTAGTGATGCTCTGAGAAGAGG + Intergenic
1012641537 6:101623326-101623348 ACCTGACAGGCTCTGAAATGTGG - Intronic
1013690627 6:112637917-112637939 TCTTGTGACACTCTGAGATGAGG + Intergenic
1016429060 6:143964089-143964111 CCTTATCAGGCCCTGGGATGGGG - Intronic
1017892129 6:158647417-158647439 TTGTGTCAGGCTCTGAGCTGGGG + Intergenic
1019574192 7:1728399-1728421 TCTTGATAGGCTCTGAGATGCGG + Intronic
1022473192 7:30694281-30694303 CCATGCCAGGCACTGAGAGGCGG - Intronic
1022476806 7:30716369-30716391 CCTTGTCAAGCTCAGATCTGTGG + Intronic
1023566275 7:41526679-41526701 CCAGGTCAAGGTCTGAGATGCGG - Intergenic
1023882201 7:44326722-44326744 CCTGGGCAGGCTCTGAGGAGGGG + Intronic
1026483842 7:70800984-70801006 GCTGGTGAGGCTCTGACATGGGG - Intergenic
1026646216 7:72171379-72171401 TCTTGACAGGCTCAGAGAGGAGG + Intronic
1027893799 7:84014307-84014329 GATTGTCACTCTCTGAGATGAGG + Exonic
1027974279 7:85129476-85129498 TCTTATCAGACTGTGAGATGAGG + Intronic
1029884558 7:103854594-103854616 CCTTGTGACTTTCTGAGATGAGG + Intronic
1030575125 7:111276422-111276444 CCTTATCTGGCTTTGGGATGAGG + Intronic
1031232363 7:119124018-119124040 CCTTTTCAGGGTGTGAGATGGGG - Intergenic
1032460121 7:132104048-132104070 CCTTGTCTGGGTCGGAGACGGGG + Intergenic
1032529864 7:132611042-132611064 ACTTGCCAGTCTCAGAGATGGGG - Intronic
1032925880 7:136604095-136604117 CCTAGTGGGGCTGTGAGATGAGG + Intergenic
1034954451 7:155325963-155325985 CGTTACCAGGATCTGAGATGGGG + Intergenic
1037601504 8:20399708-20399730 CCTTGTCTGGCTCTGGTATCAGG - Intergenic
1041024791 8:53672901-53672923 GCTTTTCAGCCTCTGACATGAGG + Intergenic
1045134330 8:99197296-99197318 CCTTGTCTGGCTTTGGTATGAGG + Intronic
1047438428 8:124855314-124855336 ACTCCTCACGCTCTGAGATGGGG + Intergenic
1047805915 8:128359817-128359839 CTTAGTCAGCCTATGAGATGGGG + Intergenic
1048106767 8:131419510-131419532 CCAGGTCAGCCTGTGAGATGAGG + Intergenic
1048786713 8:138058363-138058385 GGTTTTTAGGCTCTGAGATGTGG - Intergenic
1049255146 8:141609688-141609710 CCACGTCAGGCTCCGAGAGGGGG + Intergenic
1049297188 8:141848375-141848397 CATTCTCAGCCTCTGAGATTGGG - Intergenic
1050253216 9:3767758-3767780 CATTGTCAGGCTATGATTTGAGG + Intergenic
1051232832 9:14970632-14970654 CCTTGTCAGGCTTTGGTATCAGG - Intergenic
1051840341 9:21390046-21390068 CCTTGTCTGGCTTTGATATGAGG - Intergenic
1056844392 9:90024891-90024913 CCTTGTCAGCCTTTGAGAATTGG - Intergenic
1057890405 9:98865584-98865606 CCTTGGAAGTCTGTGAGATGGGG - Intergenic
1059036643 9:110761180-110761202 CCTTGGCAGAGTCTGAGTTGGGG + Intronic
1060376008 9:123115581-123115603 TCTTACCAGGCTCTGTGATGGGG - Intronic
1060970758 9:127736301-127736323 CTTTTTCAGGCTCTGATATTTGG - Intergenic
1061037457 9:128121533-128121555 CCATCTCAGGACCTGAGATGAGG - Intronic
1186863450 X:13695731-13695753 TCTTGTCTGGCTCAGACATGCGG + Intronic
1187052220 X:15706324-15706346 CCTTGTCAATCACAGAGATGGGG - Intronic
1188392643 X:29640287-29640309 CTTTGTCAGCATCTGAGAGGAGG + Intronic
1189085699 X:38021303-38021325 GCTTGTCAGGCCCTGTGGTGAGG + Intronic
1190739728 X:53280995-53281017 CCCTGTAAGGTTCTGAGATTTGG - Intronic
1191593831 X:62919770-62919792 CCTTGTCTGGCTTTGGTATGAGG - Intergenic
1192397566 X:70797551-70797573 CCTTGTCTGGCTTTGATATTAGG - Intronic
1194566453 X:95494585-95494607 CCTAGTCAAGCTGTGAGAAGAGG + Intergenic
1195482688 X:105365373-105365395 CCTTGTCTGGCTTTGAAATCAGG + Intronic
1197168233 X:123402923-123402945 CCTTCTAAGTCTCTGGGATGAGG - Intronic
1198304612 X:135368369-135368391 CCTAGTGAGGCTGTGAGAAGAGG - Intergenic
1198618045 X:138480057-138480079 CCCTGTCAGGCTCCAAGGTGAGG + Intergenic