ID: 984759199

View in Genome Browser
Species Human (GRCh38)
Location 4:183349163-183349185
Sequence TTGCCCTATATGGTCTAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984759190_984759199 24 Left 984759190 4:183349116-183349138 CCACCAGCGTCAGGACAGTTTAG No data
Right 984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG No data
984759194_984759199 -4 Left 984759194 4:183349144-183349166 CCGTGGCAACGTGAGGAAGTTGC No data
Right 984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG No data
984759191_984759199 21 Left 984759191 4:183349119-183349141 CCAGCGTCAGGACAGTTTAGAGA No data
Right 984759199 4:183349163-183349185 TTGCCCTATATGGTCTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984759199 Original CRISPR TTGCCCTATATGGTCTAAGG GGG Intergenic
No off target data available for this crispr