ID: 984764382

View in Genome Browser
Species Human (GRCh38)
Location 4:183388392-183388414
Sequence CAGGTCACCCAGCAGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984764382_984764383 -5 Left 984764382 4:183388392-183388414 CCACACAACTGCTGGGTGACCTG No data
Right 984764383 4:183388410-183388432 ACCTGAATGCACCCAAGTTCAGG No data
984764382_984764387 12 Left 984764382 4:183388392-183388414 CCACACAACTGCTGGGTGACCTG No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984764382 Original CRISPR CAGGTCACCCAGCAGTTGTG TGG (reversed) Intergenic
No off target data available for this crispr