ID: 984764382 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:183388392-183388414 |
| Sequence | CAGGTCACCCAGCAGTTGTG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984764382_984764383 | -5 | Left | 984764382 | 4:183388392-183388414 | CCACACAACTGCTGGGTGACCTG | No data | ||
| Right | 984764383 | 4:183388410-183388432 | ACCTGAATGCACCCAAGTTCAGG | No data | ||||
| 984764382_984764387 | 12 | Left | 984764382 | 4:183388392-183388414 | CCACACAACTGCTGGGTGACCTG | No data | ||
| Right | 984764387 | 4:183388427-183388449 | TTCAGGTAACATGACAGAGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984764382 | Original CRISPR | CAGGTCACCCAGCAGTTGTG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||