ID: 984764383

View in Genome Browser
Species Human (GRCh38)
Location 4:183388410-183388432
Sequence ACCTGAATGCACCCAAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984764382_984764383 -5 Left 984764382 4:183388392-183388414 CCACACAACTGCTGGGTGACCTG No data
Right 984764383 4:183388410-183388432 ACCTGAATGCACCCAAGTTCAGG No data
984764380_984764383 -1 Left 984764380 4:183388388-183388410 CCACCCACACAACTGCTGGGTGA No data
Right 984764383 4:183388410-183388432 ACCTGAATGCACCCAAGTTCAGG No data
984764381_984764383 -4 Left 984764381 4:183388391-183388413 CCCACACAACTGCTGGGTGACCT No data
Right 984764383 4:183388410-183388432 ACCTGAATGCACCCAAGTTCAGG No data
984764379_984764383 0 Left 984764379 4:183388387-183388409 CCCACCCACACAACTGCTGGGTG No data
Right 984764383 4:183388410-183388432 ACCTGAATGCACCCAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984764383 Original CRISPR ACCTGAATGCACCCAAGTTC AGG Intergenic
No off target data available for this crispr