ID: 984764387

View in Genome Browser
Species Human (GRCh38)
Location 4:183388427-183388449
Sequence TTCAGGTAACATGACAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984764379_984764387 17 Left 984764379 4:183388387-183388409 CCCACCCACACAACTGCTGGGTG No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data
984764382_984764387 12 Left 984764382 4:183388392-183388414 CCACACAACTGCTGGGTGACCTG No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data
984764380_984764387 16 Left 984764380 4:183388388-183388410 CCACCCACACAACTGCTGGGTGA No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data
984764381_984764387 13 Left 984764381 4:183388391-183388413 CCCACACAACTGCTGGGTGACCT No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data
984764384_984764387 -7 Left 984764384 4:183388411-183388433 CCTGAATGCACCCAAGTTCAGGT No data
Right 984764387 4:183388427-183388449 TTCAGGTAACATGACAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984764387 Original CRISPR TTCAGGTAACATGACAGAGA TGG Intergenic
No off target data available for this crispr