ID: 984771567

View in Genome Browser
Species Human (GRCh38)
Location 4:183441131-183441153
Sequence AGGTAGTAACAGTCTGATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984771567_984771571 18 Left 984771567 4:183441131-183441153 CCGTAATCAGACTGTTACTACCT No data
Right 984771571 4:183441172-183441194 TTCTCAAAGCTTCTAACAGAGGG No data
984771567_984771570 17 Left 984771567 4:183441131-183441153 CCGTAATCAGACTGTTACTACCT No data
Right 984771570 4:183441171-183441193 TTTCTCAAAGCTTCTAACAGAGG No data
984771567_984771572 19 Left 984771567 4:183441131-183441153 CCGTAATCAGACTGTTACTACCT No data
Right 984771572 4:183441173-183441195 TCTCAAAGCTTCTAACAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984771567 Original CRISPR AGGTAGTAACAGTCTGATTA CGG (reversed) Intergenic
No off target data available for this crispr