ID: 984774289

View in Genome Browser
Species Human (GRCh38)
Location 4:183467215-183467237
Sequence CCCTAGCGAGGTTCTCCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984774289_984774296 29 Left 984774289 4:183467215-183467237 CCTCATGGAGAACCTCGCTAGGG No data
Right 984774296 4:183467267-183467289 CCTCCACACAGACTCCCTCCTGG No data
984774289_984774293 -10 Left 984774289 4:183467215-183467237 CCTCATGGAGAACCTCGCTAGGG No data
Right 984774293 4:183467228-183467250 CTCGCTAGGGCAATGCAGAAGGG No data
984774289_984774294 0 Left 984774289 4:183467215-183467237 CCTCATGGAGAACCTCGCTAGGG No data
Right 984774294 4:183467238-183467260 CAATGCAGAAGGGAAATGTGAGG No data
984774289_984774297 30 Left 984774289 4:183467215-183467237 CCTCATGGAGAACCTCGCTAGGG No data
Right 984774297 4:183467268-183467290 CTCCACACAGACTCCCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984774289 Original CRISPR CCCTAGCGAGGTTCTCCATG AGG (reversed) Intergenic