ID: 984778586

View in Genome Browser
Species Human (GRCh38)
Location 4:183504903-183504925
Sequence CGGGGCCGGCGCCGGGGTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1110
Summary {0: 1, 1: 2, 2: 16, 3: 213, 4: 878}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984778586_984778607 18 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778607 4:183504944-183504966 CTCCGGTCCTGGAGCGGGAGGGG 0: 1
1: 0
2: 2
3: 10
4: 157
984778586_984778605 16 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778605 4:183504942-183504964 TGCTCCGGTCCTGGAGCGGGAGG 0: 1
1: 0
2: 3
3: 11
4: 160
984778586_984778611 28 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778611 4:183504954-183504976 GGAGCGGGAGGGGAGAAAGGAGG 0: 1
1: 0
2: 19
3: 219
4: 2016
984778586_984778603 12 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778603 4:183504938-183504960 CCACTGCTCCGGTCCTGGAGCGG 0: 1
1: 0
2: 4
3: 19
4: 248
984778586_984778598 1 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778598 4:183504927-183504949 CGAGGGGATCCCCACTGCTCCGG 0: 1
1: 0
2: 1
3: 6
4: 117
984778586_984778599 7 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778599 4:183504933-183504955 GATCCCCACTGCTCCGGTCCTGG 0: 1
1: 0
2: 1
3: 12
4: 104
984778586_984778606 17 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778606 4:183504943-183504965 GCTCCGGTCCTGGAGCGGGAGGG 0: 1
1: 0
2: 1
3: 9
4: 177
984778586_984778610 25 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778610 4:183504951-183504973 CCTGGAGCGGGAGGGGAGAAAGG 0: 1
1: 1
2: 2
3: 70
4: 660
984778586_984778612 29 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778612 4:183504955-183504977 GAGCGGGAGGGGAGAAAGGAGGG 0: 1
1: 1
2: 25
3: 486
4: 4248
984778586_984778604 13 Left 984778586 4:183504903-183504925 CCGGGACCCCGGCGCCGGCCCCG 0: 1
1: 2
2: 16
3: 213
4: 878
Right 984778604 4:183504939-183504961 CACTGCTCCGGTCCTGGAGCGGG 0: 1
1: 0
2: 0
3: 9
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984778586 Original CRISPR CGGGGCCGGCGCCGGGGTCC CGG (reversed) Intergenic
900119036 1:1040891-1040913 CGGGGCCGGTGCCTGGGGCGGGG + Intronic
900186391 1:1335079-1335101 TGGTGCTGGCTCCGGGGTCCTGG - Exonic
900189979 1:1349216-1349238 CGGGGGCGGCGGCCGGGGCCTGG - Intronic
900191839 1:1355402-1355424 CGGGGTCGGGGCAGGGGTCCGGG - Intronic
900199689 1:1398900-1398922 CGGGGCAGGGGCTGGGGTCGGGG + Intronic
900269172 1:1778418-1778440 CGGCGCCGGCGCCGGGGTCCGGG - Intronic
900367880 1:2318674-2318696 TGGGGCCGGGGCGGGAGTCCAGG + Intergenic
900589913 1:3454885-3454907 CGGGGGAGGCGCCGGGAACCCGG + Intronic
901138050 1:7010262-7010284 AGGAGCCGGCCCTGGGGTCCTGG - Intronic
901217354 1:7562178-7562200 AGGGGCCGGAGCTGGGGTGCCGG - Intronic
901279896 1:8026069-8026091 CGCGCCGGGCGCCGGGATCCAGG - Intronic
901332811 1:8423873-8423895 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
901332813 1:8423879-8423901 CGGGGGCGGGGCCGGGGCCGGGG - Intronic
901443392 1:9292938-9292960 CGGCGCCGGCGCCTGGAGCCTGG - Exonic
901443399 1:9292947-9292969 AGGCGCCGGCGCCGGGGCCGGGG + Exonic
901443401 1:9292953-9292975 CGGCGCCGGGGCCGGGGCCGCGG + Exonic
901836360 1:11926328-11926350 CGGGGTGGGCGCCGCGGTCCGGG - Exonic
902448792 1:16484126-16484148 CAGGTCCGGGGCCAGGGTCCGGG - Intergenic
902451510 1:16499370-16499392 CGGGGGCGGGGCCGGGCGCCAGG + Intergenic
902520237 1:17011684-17011706 CGGGGACCGCGCCGGGCTCGGGG + Intronic
903132728 1:21290226-21290248 CGGCGGCGGCGCCAGGGTCGGGG - Intronic
903231821 1:21926987-21927009 GGGGGCCGGAGCCGGCTTCCTGG + Intronic
903628211 1:24745937-24745959 CGCGCCCGGCGCTGGGGCCCCGG - Intronic
904050167 1:27634157-27634179 CTGGGCCGCCGCGGGGCTCCGGG - Intronic
904237187 1:29123314-29123336 CAGGTCCGACGCCGGGCTCCGGG + Intronic
904500118 1:30908520-30908542 CGGCGCCGGGGCCGGGGCCGCGG - Exonic
904500120 1:30908526-30908548 CGGGGCCGGCGCCGGGGCCGGGG - Exonic
904620592 1:31772854-31772876 CGGGGCCGTCTCTGGGCTCCGGG + Intergenic
904696781 1:32335698-32335720 GGGGGGCAGCGCCGGGGACCGGG + Intronic
905038002 1:34929823-34929845 GCGGGCGGCCGCCGGGGTCCCGG + Intergenic
905067024 1:35192612-35192634 CGGGGGCCCCGCCAGGGTCCGGG - Exonic
905442783 1:38005566-38005588 GGGGGCCGGGGGCGGGGTCCGGG - Intronic
905867103 1:41382360-41382382 CGAGGCGGGCGCCGCGGGCCTGG + Exonic
905886915 1:41496559-41496581 CAGGGCCCCCGCAGGGGTCCGGG - Intergenic
906525224 1:46489774-46489796 CCGGGCCCGCGCCGGGCGCCCGG + Intergenic
906551229 1:46668106-46668128 CGGGGCCGAGGCCGAGCTCCAGG - Exonic
907040089 1:51251334-51251356 CGGGGCCGGGGCCGAGGCCGCGG - Intronic
907261329 1:53220670-53220692 CGGGGCCGGGGCCGGGCCGCGGG + Intergenic
907450432 1:54542526-54542548 GGAGGCCAGCGCCGGGGTACAGG - Intronic
907689143 1:56645245-56645267 CGGGGCGGGCGCGGGGTCCCGGG - Intronic
908501222 1:64745231-64745253 CGGGGCTGGGGCCGGGGCCGGGG + Exonic
911176158 1:94820353-94820375 CGGGGCCGGGGCCGGGGCTGGGG - Exonic
912511137 1:110190830-110190852 TGGGGCCGGGGGCGGGGGCCTGG + Intronic
912568890 1:110607470-110607492 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
912927935 1:113929792-113929814 CGGGGACGGCTCCGGGGGGCGGG + Exonic
912927943 1:113929806-113929828 GGGGGCGGGGGCCGGGGCCCGGG + Exonic
913144617 1:115976795-115976817 CGGGGCCGGGGCCGAGGCCGAGG + Intronic
913966835 1:143383640-143383662 CGGGGCCACCGCCATGGTCCAGG + Intergenic
914061212 1:144209247-144209269 CGGGGCCACCGCCATGGTCCAGG + Intergenic
914117938 1:144757122-144757144 CGGGGCCACCGCCATGGTCCAGG - Intergenic
914257785 1:145974875-145974897 CGGGGTGGGGGCCGGGGTCGTGG + Exonic
914753210 1:150549512-150549534 GGCGGCCGGGGCCGGGGTCCCGG - Intronic
914758464 1:150579772-150579794 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914758468 1:150579778-150579800 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
914869128 1:151458825-151458847 CGCGGCGGGCGCCGGGGGGCGGG + Intronic
914899468 1:151704131-151704153 GGGGCCCGGAGCAGGGGTCCGGG + Intronic
915213304 1:154325500-154325522 CGGAGCCGGCGGCGGGGGCCGGG - Intergenic
915246291 1:154558470-154558492 AGGGGGCGGCGCCGGGGGCCGGG - Exonic
915463523 1:156082822-156082844 GGGGGCCGGGGCCGGGGGCGGGG + Intronic
915463525 1:156082828-156082850 CGGGGCCGGGGGCGGGGAGCCGG + Intronic
915937793 1:160099002-160099024 CTGGGGCGGGGCCGGGGCCCGGG - Intergenic
918015985 1:180632524-180632546 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
918056055 1:181022870-181022892 GGGGGCCGGCGCCCGAGTCCGGG - Exonic
919981202 1:202643779-202643801 CGGGGCCGGCTCCGAGCCCCCGG + Intronic
920512468 1:206561090-206561112 CTGGGCCGGTGCCAGAGTCCTGG - Intronic
920575066 1:207053315-207053337 CAGGGCAGGCGCCGGGGCCAAGG + Exonic
922695304 1:227728410-227728432 CAGGGCGGGCGGCGGGGCCCAGG - Intergenic
922757143 1:228102820-228102842 TGGGGCCGGGGCCGGGGACTGGG - Intronic
923712105 1:236395792-236395814 CGGGTCTGGCGCCTGGGTCGGGG - Intronic
924763140 1:247007710-247007732 CCGGGCCGGCAGCGGGATCCCGG - Intronic
924801440 1:247331757-247331779 CGGGGCCGGCCGCGGGAGCCGGG + Intronic
924940924 1:248812097-248812119 CGGGGGCGGGGCCGGGCCCCAGG + Exonic
1062774644 10:135350-135372 CGGAGCCGGCGGCGGGGTCCGGG + Intronic
1062874008 10:931279-931301 CGGGGCCGGGGCCGGGGCAGGGG - Intronic
1062874012 10:931285-931307 CTGGGCCGGGGCCGGGGCCGGGG - Intronic
1062874287 10:932159-932181 CAGGGCCGGGGCCTTGGTCCAGG - Intergenic
1062874307 10:932204-932226 CAGGGTCGGGGCCTGGGTCCTGG - Intergenic
1062874353 10:932319-932341 CAGGGCCGGGGCCTGGGTCCCGG - Intergenic
1062874374 10:932363-932385 CAGGGCCGGGGCCTTGGTCCCGG - Intergenic
1062874397 10:932408-932430 CAGGGCCGGGGCCTTGGTCCCGG - Intergenic
1062874416 10:932452-932474 CAGGGCCGGGGCCTTGGTCCCGG - Intergenic
1062874435 10:932496-932518 CAGGGCCGGGGCCTTGGTCCCGG - Intergenic
1062874475 10:932578-932600 CAGGGCCGGGGCCTTGGTCCCGG - Intergenic
1062874493 10:932616-932638 CAGGGCCGGGGCCTGGGTCCCGG - Intergenic
1063418243 10:5890310-5890332 CGGCGGCGGCAGCGGGGTCCGGG + Intronic
1064209082 10:13348119-13348141 CGGCGGCGGCGGCGGGGGCCCGG + Exonic
1064274193 10:13891765-13891787 CGGGGGCGGCGGCGGGGACGGGG - Intronic
1065024200 10:21526064-21526086 CGGGGCTGGCGGCGGGGGCGGGG - Intergenic
1066135913 10:32446152-32446174 CGGCGCCGGCGGCGGGTGCCCGG + Exonic
1066406970 10:35127330-35127352 TTGGCCCGGCCCCGGGGTCCCGG - Intronic
1067111858 10:43407185-43407207 CGGGCCCTGCGCCGGGGTCAGGG - Intronic
1067139935 10:43648547-43648569 CGGGCCCGGTGCCCGGGGCCCGG - Intronic
1067336976 10:45374165-45374187 CGGGGCCGGGACCGGGGCCAGGG + Intronic
1067389155 10:45847505-45847527 CGGGGCCGGGGCCAGGGCCAGGG - Intronic
1067445104 10:46337044-46337066 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067445107 10:46337050-46337072 CGGGGCCGGGGCCGGGGCCAGGG + Intergenic
1067502319 10:46816336-46816358 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1067502322 10:46816342-46816364 CGGGGCCGGGGCCGGGGCCAGGG + Intergenic
1067567605 10:47349972-47349994 CGGGGCCGGCCTCAGGGCCCTGG - Exonic
1067592265 10:47523678-47523700 CGGGGCCGGGGCCGGGGCCAGGG - Intronic
1067592268 10:47523684-47523706 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1067639382 10:48031751-48031773 CGGGGCCGGGGCCGGGACCAGGG - Intergenic
1067710958 10:48650917-48650939 CGAGGCCGGCCCAGGGGTCCTGG + Intronic
1067830788 10:49610170-49610192 CGGGGCGGGGGCCGGGGGCGGGG - Intronic
1070136374 10:73697907-73697929 CGGGGCCGGGGCCGGGGCCAGGG - Exonic
1070768655 10:79070128-79070150 CGGGGCTGGAGCCGGGGTCGGGG + Intronic
1070788799 10:79177577-79177599 CGGGGCAGGAGGCAGGGTCCGGG - Intronic
1070800829 10:79243551-79243573 CGGCGGCGGCGCGGGGGCCCGGG - Intronic
1071309456 10:84328829-84328851 CAGAGCCGGGGCCGGGGTCGCGG + Intronic
1072336704 10:94403620-94403642 CGGGGCCGGGGCCGGAGCCGGGG + Intronic
1072336706 10:94403626-94403648 CGGGGCCGGAGCCGGGGTCTTGG + Intronic
1072465173 10:95656460-95656482 CGGAGCAGGTGCCGGGGCCCGGG - Intronic
1072591629 10:96832734-96832756 CGGCGGCGGCGCCGGGGCGCCGG - Intronic
1072926312 10:99620276-99620298 GGGGGCCGGCGGCAGGGCCCGGG - Exonic
1073099626 10:100999847-100999869 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1073099634 10:100999865-100999887 CGGGGCCGGAGCCGGAGCCGGGG + Exonic
1073138037 10:101230312-101230334 CGGGGCCCCGGCCGGGGCCCGGG - Intergenic
1073138043 10:101230324-101230346 CGGGGCCGGCAGCGGGGCCCCGG - Intergenic
1074165815 10:110872512-110872534 CGGGGCCGAGGCCGGGGCTCCGG - Intronic
1075401383 10:122163732-122163754 CGCGGCCCGAGCCGGGGGCCGGG - Intronic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1076372300 10:129963588-129963610 CCGGGCCGGGGCCGGGGCCAGGG + Intronic
1076674838 10:132142479-132142501 AGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076683516 10:132186873-132186895 CGGGGGCGGAGCCGGGGTGGGGG + Intergenic
1076721814 10:132396446-132396468 GGTGGCCGGCACCGGGGCCCGGG - Intergenic
1076722222 10:132397594-132397616 GGGGCGCGGGGCCGGGGTCCCGG + Intronic
1076857582 10:133124824-133124846 CGGGGCCGGGGCCGGGGGAAGGG - Intronic
1076857586 10:133124830-133124852 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076857590 10:133124836-133124858 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1076879076 10:133231144-133231166 CGGGGGTGGCGGCGGGGACCCGG - Exonic
1076963689 10:133787244-133787266 CGGGGTCGGGGTCGGGGTCGGGG + Intergenic
1076963691 10:133787250-133787272 CGGGGTCGGGGTCGGGGTCAGGG + Intergenic
1077008521 11:369988-370010 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1077043723 11:535438-535460 CGGGGCCAGGGCCGGGGCCGAGG + Exonic
1077049729 11:561222-561244 CGGTGCCCGCGGCGGGGACCGGG + Exonic
1077121500 11:910938-910960 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077121504 11:910944-910966 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1077158195 11:1100835-1100857 TGGGGTCGGCGTGGGGGTCCAGG - Intergenic
1077191642 11:1258209-1258231 CGGGGCTGGGGCCGGGCTCCTGG + Intronic
1077233760 11:1470201-1470223 TGGGGCCGGCAGCGGGGGCCCGG - Exonic
1077250069 11:1557023-1557045 CGGGGCCGCCGGCGGGGCCGTGG + Exonic
1077491386 11:2862442-2862464 CGGGGCGGGGGCCGGGGTCGGGG + Intergenic
1077495480 11:2884842-2884864 CGGGGCCGGGGCCGGGGCGGGGG + Exonic
1077495484 11:2884848-2884870 CGGGGCCGGGGCGGGGGCCGGGG + Exonic
1077495488 11:2884854-2884876 CGGGGCGGGGGCCGGGGCCGGGG + Exonic
1077495491 11:2884860-2884882 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495495 11:2884866-2884888 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1077495499 11:2884872-2884894 CGGGGCCGGGGCCGGGGCTGGGG + Exonic
1077495503 11:2884878-2884900 CGGGGCCGGGGCTGGGGCCGGGG + Exonic
1077495522 11:2884926-2884948 CGGAGCCGGAGCCGGGGCCGGGG + Exonic
1077495526 11:2884932-2884954 CGGAGCCGGGGCCGGGGCCGGGG + Exonic
1077495548 11:2884998-2885020 CGGAGCCGGAGCCGGGGCCGGGG + Exonic
1077914709 11:6603750-6603772 CGGGGCCGGCGGCGGGCTGCGGG + Intronic
1077923150 11:6655977-6655999 CGGAGCCGGGGCCTGGGGCCGGG - Intergenic
1078139672 11:8682959-8682981 CGGGCCCGGGGCGGGGCTCCCGG + Intronic
1078326444 11:10385378-10385400 CGGGGCCTGTGGTGGGGTCCGGG + Intronic
1078353556 11:10615770-10615792 CGGGGCCTGTGGTGGGGTCCGGG + Intronic
1078631925 11:13010692-13010714 CGGGGCCACCGTCGGGCTCCAGG - Intergenic
1080387325 11:31817779-31817801 CCGGGCCGGGGCCGGAGCCCGGG + Intronic
1081636772 11:44727043-44727065 CGGGGCCGGGGCTGGGGCTCGGG - Intronic
1081636778 11:44727055-44727077 CGGGGCTGGGGCCGGGGCCGGGG - Intronic
1081636782 11:44727061-44727083 CGGGGCCGGGGCTGGGGCCGGGG - Intronic
1081636786 11:44727067-44727089 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1081636790 11:44727073-44727095 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636794 11:44727079-44727101 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636798 11:44727085-44727107 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1081636802 11:44727091-44727113 CGGGACCGGGGCCGGGGCCGGGG - Intronic
1081636806 11:44727097-44727119 CGGGGCCGGGACCGGGGCCGGGG - Intronic
1081872762 11:46391014-46391036 CGGGGCCGGAGGAGGGGGCCTGG + Intergenic
1082002371 11:47400263-47400285 GGGGGGCGGGGCCGGGGGCCGGG - Intergenic
1082025109 11:47565815-47565837 CGGGGACGGGGCAGGGGCCCGGG - Intronic
1083200502 11:61118509-61118531 CGGGGCTGGCGCCCAGGCCCAGG - Intronic
1083266069 11:61547391-61547413 TGTGCCCGGCCCCGGGGTCCTGG - Intronic
1083326019 11:61873407-61873429 TGGGGCCGGCGGCGGGGTTGAGG - Intergenic
1083618117 11:64036224-64036246 CGGGGCGGGGGCCGGGGGCCCGG + Intronic
1083648371 11:64186147-64186169 AGGGGCGGGAGCCGGGGTCCCGG + Intronic
1083741439 11:64713594-64713616 CGGGGCCGCCGCCGAACTCCAGG + Exonic
1084070027 11:66728065-66728087 CGGGGTCGGGGTCGGGGTCGGGG - Intronic
1084129126 11:67119602-67119624 CGGGGCCGGGGCCCGCGTTCCGG + Intronic
1084165312 11:67372631-67372653 CGGGGGCGGGGGCGGGGTCCGGG + Intronic
1084165584 11:67373422-67373444 CGGCCCCGGCGCGGGGCTCCCGG + Intronic
1084172961 11:67409485-67409507 TGTGGCCGGGGCGGGGGTCCCGG - Exonic
1084284065 11:68120689-68120711 CGGGGCGGAGGCCGGGGACCGGG - Intronic
1084758069 11:71251746-71251768 CGGGTCGGGCGCCCAGGTCCCGG - Intronic
1084787667 11:71452995-71453017 CCGGGCCGGGGCCGGGGCCTGGG + Intergenic
1084787669 11:71453001-71453023 CGGGGCCGGGGCCTGGGACGTGG + Intergenic
1084888438 11:72224888-72224910 TGGGGCCGGGCCCGGGGCCCGGG - Exonic
1084892630 11:72244039-72244061 CCGGGTCGGGGTCGGGGTCCGGG + Exonic
1085284626 11:75351726-75351748 CGGGGGCGGCGGCGGCGGCCGGG - Intergenic
1086455323 11:86954972-86954994 TGGGGCCGGCGCGGGGCTTCGGG - Exonic
1089273289 11:117315936-117315958 CTGGGCCAGCCCCCGGGTCCGGG + Exonic
1089499824 11:118925511-118925533 CGGGGCCGGGGCGCGGGGCCGGG + Intronic
1089729564 11:120511847-120511869 CGGGGGCTGAGCCGGGGGCCGGG - Exonic
1089729630 11:120512025-120512047 GGGGGCCGGGGCAGGGGTGCGGG - Intronic
1091550042 12:1530259-1530281 CGGGGCCGGCGCGGCTGTCGGGG + Intronic
1091550281 12:1530963-1530985 CGGGGCCGTCCCCGGGGGCGAGG - Intronic
1091823256 12:3491746-3491768 CGGCGGCGGCGCGGTGGTCCGGG - Intronic
1092239607 12:6828748-6828770 CGGGACCCACGCAGGGGTCCTGG + Exonic
1092246637 12:6867709-6867731 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1092455155 12:8636477-8636499 CGGTGCCGGCGCCGGTCCCCTGG + Intergenic
1094607276 12:31959542-31959564 CGGGGCGGGGGCCGGGAGCCGGG + Intronic
1094682685 12:32679689-32679711 CGGAGCCGGCGCGGCGGGCCTGG + Intronic
1095261660 12:40105616-40105638 CGGCGGCGGCGTCGGGGACCTGG - Exonic
1095440794 12:42237784-42237806 CGGGGGCGGCCGCGGGGCCCGGG - Intronic
1095752888 12:45729989-45730011 CCGGGCCGGGCACGGGGTCCCGG + Intronic
1095958514 12:47819668-47819690 CGGAGCCGGAGCCGGGGCCAGGG + Intronic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096250067 12:50025299-50025321 CGTGGCCGCCGCGGGGGTCCGGG - Intronic
1096389479 12:51217720-51217742 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096389481 12:51217726-51217748 CGGGGCCGGGGCCGGGGCCACGG + Intergenic
1096773964 12:53953075-53953097 CGGGGCCGGCTCCTGGGGGCGGG + Intergenic
1096796736 12:54082562-54082584 CCGGTCCGGGGCCGGGGGCCGGG + Intergenic
1096796740 12:54082568-54082590 CGGGGCCGGGGGCCGGGGCCGGG + Intergenic
1096796745 12:54082575-54082597 GGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796749 12:54082581-54082603 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796753 12:54082587-54082609 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1096796761 12:54082599-54082621 CGGGGCCGGGGCCGGGCTGGGGG + Intergenic
1097029322 12:56080139-56080161 CGGAGCCGGAGCCGGAGTCCGGG - Exonic
1097190391 12:57216784-57216806 CGGAGCCGGCGCTGGGGGCGGGG - Exonic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1098255339 12:68610747-68610769 AGAGGCCGGCGCCGAGGACCCGG + Intergenic
1099014268 12:77325592-77325614 CGTGGCCTGCGCCGGGGTCACGG + Intergenic
1100632299 12:96400610-96400632 CGGGGGCGGGGCCGGCGGCCGGG + Intergenic
1100632303 12:96400616-96400638 CGGGGCCGGCGGCCGGGGGCGGG + Intergenic
1101773823 12:107775754-107775776 TGCGGCGGGCGCGGGGGTCCTGG - Exonic
1102197192 12:111034068-111034090 CGGGGCCGCCGCCGGCCGCCCGG - Exonic
1102256488 12:111418454-111418476 CGGGGCCGGGGCCTGGCTCCGGG - Exonic
1102520047 12:113472362-113472384 CGGGGCCGGCTCCAGGAGCCGGG - Intergenic
1102953481 12:117045260-117045282 CGGGGCGGAGGCCGGGCTCCGGG - Intronic
1103107855 12:118246207-118246229 CGGGGCCGGGGCCGAGGCCGCGG + Intronic
1103410810 12:120710400-120710422 CGGGGGCGGGGCCCGGGGCCCGG - Intergenic
1103563470 12:121804282-121804304 CAGGGCCGGGGCCGGGGGCTTGG - Intronic
1103568716 12:121830313-121830335 GGGGGCGGGCGCGGGGGGCCGGG - Exonic
1103623582 12:122203512-122203534 CGGGTGTGGCGCCGGCGTCCTGG + Intergenic
1103649531 12:122422324-122422346 GGTGGCCGGCGCCGGAGGCCGGG - Intronic
1104049668 12:125186877-125186899 CGGGGTCGGGGATGGGGTCCGGG - Intronic
1104376193 12:128267110-128267132 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1104773373 12:131378659-131378681 AGGGGCCGGCGCAGGGCCCCAGG + Intergenic
1105011740 12:132761338-132761360 CGGGGAAGGCGGCGGGGGCCCGG - Intronic
1105012012 12:132762097-132762119 GGGGGCCGGGGCTGGGGCCCGGG + Intergenic
1105031408 12:132887158-132887180 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
1105031412 12:132887164-132887186 TGAGGCCGGGGCCGGGGGCCGGG - Intronic
1105074644 12:133264905-133264927 GGGGTCCGGGTCCGGGGTCCGGG + Intergenic
1105293900 13:19071855-19071877 CGGGGCCGCTGCTGGGATCCAGG + Intergenic
1105413839 13:20192804-20192826 CGGGGCCGGGGCGGGGGTCTCGG + Intronic
1105413993 13:20193287-20193309 CAGCGCCGGAGCCGGGGTCTGGG - Intergenic
1105472074 13:20703743-20703765 CGGCGGCGGCGGCGGGGGCCGGG + Intronic
1105502890 13:20988348-20988370 CGGGGGCGGGGGCGGGGGCCGGG + Exonic
1106956334 13:34942688-34942710 CGGGCCCGGCGCCGCGGCGCTGG + Exonic
1107086606 13:36432534-36432556 CGGGGCCCGCTTTGGGGTCCAGG + Exonic
1108247429 13:48532415-48532437 CCGGGCCGGTGCCCGGGACCTGG + Intronic
1108541647 13:51452222-51452244 CGGGGCCGGAGCCCGGGCCCCGG + Intronic
1112343943 13:98576057-98576079 CGGGCCCGGCCCCGGGACCCTGG - Intronic
1112343948 13:98576066-98576088 CGGGGCCGGGCCCGGGACCCTGG + Intronic
1112365538 13:98752517-98752539 GGGGGCCGGCACCGAGGGCCGGG - Intronic
1113120244 13:106917584-106917606 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120248 13:106917590-106917612 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120252 13:106917596-106917618 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120256 13:106917602-106917624 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120260 13:106917608-106917630 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120264 13:106917614-106917636 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1113120268 13:106917620-106917642 CGGGGCCGGGGCCGGGGTCGGGG + Intergenic
1113120270 13:106917626-106917648 CGGGGCCGGGGTCGGGGACGCGG + Intergenic
1113655116 13:112063114-112063136 CGGGGGCGGGGCGGGGGTGCTGG - Intergenic
1113737821 13:112690533-112690555 CCGGTCCAGCCCCGGGGTCCCGG + Intronic
1113769229 13:112897977-112897999 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1113769233 13:112897983-112898005 CAGGGCCGGGGCCGGGGCCGGGG - Intronic
1113874398 13:113585151-113585173 TGGGGCCGGGGCCGGGGCCGGGG + Intronic
1113874402 13:113585157-113585179 CGGGGCCGGGGCCGGGGCTGGGG + Intronic
1113874405 13:113585163-113585185 CGGGGCCGGGGCTGGGGCCAGGG + Intronic
1113882929 13:113637931-113637953 CTGGGCCTCCCCCGGGGTCCAGG + Intronic
1113907449 13:113826447-113826469 CGAGGCCGGCGCCGGGAGGCTGG - Intronic
1113907462 13:113826486-113826508 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1113907475 13:113826525-113826547 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1113907500 13:113826603-113826625 CGAGGCCGGCGCCGGGAGGCCGG - Intronic
1114270642 14:21098246-21098268 GGGGGCCGGGGGCGGGGGCCGGG + Intronic
1114525704 14:23365939-23365961 CGGAGCCGGCGCCGGGTGCCAGG - Intergenic
1115257604 14:31419995-31420017 CCGGGCCGGGGCCCGGCTCCTGG + Intronic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1115399245 14:32939146-32939168 CGGGGCCGGGGCCGTGGCCGTGG - Intronic
1116817855 14:49599766-49599788 CGGGGCCGGGGCGGGGATCCGGG + Intronic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1117424473 14:55580413-55580435 CGGCGCCGGCCGCGGGGTCCTGG + Intronic
1117478380 14:56119002-56119024 CGGGGGCAGCGCCGGGCACCGGG + Intronic
1118024074 14:61751197-61751219 CGGGGCCGCGGGCGGGGCCCGGG - Intergenic
1118514318 14:66508902-66508924 CGGTGCAGGCGGCGGGATCCCGG + Intronic
1118607739 14:67515572-67515594 CGGGGCCGACCCCGGGCTGCGGG - Intronic
1119286390 14:73458356-73458378 CCGGGCCGGGGCCGGGGCCAGGG - Intronic
1119286394 14:73458362-73458384 CGGGGCCCGGGCCGGGGCCGGGG - Intronic
1119539291 14:75428198-75428220 CGGGGCCGGGGCCCGGCTGCAGG - Intronic
1121352636 14:93185257-93185279 CGGCGGCGGCGACGGGGGCCGGG + Exonic
1121412290 14:93756529-93756551 CCGGGGCGGGGTCGGGGTCCGGG - Intronic
1121595159 14:95156986-95157008 GCGGGGAGGCGCCGGGGTCCGGG + Intronic
1122208244 14:100159204-100159226 CGGGGCCAGGGCCGGGGCTCTGG - Intronic
1122582340 14:102778178-102778200 GGCGGGCGGCGCGGGGGTCCGGG + Intronic
1122786157 14:104164169-104164191 CGGGCCCGGCTCTGGGGTGCAGG + Intronic
1122881556 14:104692681-104692703 CTGGGAGGGCTCCGGGGTCCAGG - Intronic
1123037983 14:105479066-105479088 GGGGGCGGGGGCGGGGGTCCGGG - Intronic
1123684425 15:22786920-22786942 CGGGGCAGGGGACGGGGTCGGGG + Intronic
1123684428 15:22786932-22786954 CGGGGTCGGGGCCCGGGCCCAGG + Intronic
1123898067 15:24848237-24848259 CGGGGGCGGCGGCGGGGGCGGGG + Intronic
1124250988 15:28106563-28106585 CGGGGCCGGAGGCCGGGGCCCGG - Intergenic
1124496895 15:30192509-30192531 CGGGGCCGGCTCCGAGCCCCCGG + Intergenic
1124500443 15:30223296-30223318 CGGGGCCCGCGCCGGGGCCGGGG + Intergenic
1124500957 15:30225780-30225802 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1124696728 15:31870244-31870266 CCGGGCCGGAGCCGGTGGCCCGG + Intronic
1124696797 15:31870447-31870469 CGGGGCCGGGCCCGCGGACCAGG - Intronic
1124742613 15:32312887-32312909 CGAGGCCGCCGCCGGGGGCAGGG + Intergenic
1124746681 15:32346138-32346160 CGGGGCCGGCTCCGAGCCCCCGG - Intergenic
1124848009 15:33310695-33310717 CGGGGGCGGTGCGGGGGCCCTGG - Intergenic
1125508768 15:40281974-40281996 CGGGGCTGGCCGCGGGGGCCGGG + Exonic
1125674356 15:41494433-41494455 CGGGGCCAGCGCCGGGCGCGGGG + Intronic
1125677856 15:41512067-41512089 CGGCGCCGGCGCCGGGGGCGAGG - Intronic
1125874670 15:43133664-43133686 CGGGGCCGGCGCCGGATGCGGGG - Exonic
1125903638 15:43370970-43370992 CGGGGCCGGGGCCGGGGTCAGGG - Intronic
1125903641 15:43370976-43370998 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125903645 15:43370982-43371004 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1125937519 15:43649320-43649342 CTGGGCCGGGGCCGGGGGCGAGG + Intronic
1125954025 15:43777018-43777040 TGGGGCCGGGGGCGGGTTCCTGG - Exonic
1126109505 15:45167301-45167323 CGGGGACGGCGCCGGAGGCGCGG + Exonic
1126113264 15:45187679-45187701 CGGGGGCGGCGCGGGGGGCGCGG + Intronic
1127426638 15:58864976-58864998 CGGGGCAGGCGCTGCCGTCCAGG + Intergenic
1128153544 15:65377856-65377878 CGGGGCCGGCGCCGGGGCCGGGG + Exonic
1128153550 15:65377868-65377890 CGGGGCCGGGGCTGGGGCTCCGG + Exonic
1128161061 15:65423007-65423029 TGGGGCCGGCGCGGGGGCCAGGG + Exonic
1128318113 15:66673787-66673809 CGGGGCTGGCGCAGGGGGCGTGG - Intronic
1128322543 15:66703442-66703464 CGGGGCCGCCGCGGGGCTACCGG - Exonic
1128506767 15:68278149-68278171 CAGGGCCGGCGCCTGGGACCTGG + Exonic
1128547740 15:68579199-68579221 CGGGGGCGGCGGCGGCGGCCCGG - Exonic
1128760862 15:70215180-70215202 CGGGGCAGGCACCGGGGTAGGGG + Intergenic
1129144298 15:73633249-73633271 CGGGGCCAGAGCCGGGGCCGGGG + Exonic
1129406496 15:75322618-75322640 AGAGGCCGGCGGCGCGGTCCTGG + Intergenic
1129675934 15:77632506-77632528 CGGAGCCGGGGCCGGGGCTCGGG + Intronic
1130076634 15:80695399-80695421 CCGGGCCGGCGGCGGGCACCAGG + Exonic
1130335353 15:82952911-82952933 CGGGGCCGGCACCGAGGACTGGG - Intronic
1130656372 15:85794597-85794619 CGCGGCTGGGGCCGGGGCCCTGG - Intronic
1131108689 15:89751027-89751049 CGGAGGGGGCGCGGGGGTCCCGG + Exonic
1132105436 15:99059408-99059430 CGGAGCTGCCGACGGGGTCCGGG - Intergenic
1132365348 15:101252382-101252404 CCGGGCCGGCCCCGCGCTCCCGG + Intergenic
1132398262 15:101489624-101489646 CGGGGCGGCGGCCGGGGCCCGGG + Exonic
1132453400 15:101980786-101980808 CGGGGTCGGGGTCGGGGTCAGGG + Intergenic
1132464744 16:72367-72389 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132512843 16:352725-352747 CGGGGGCGGGGCCGGGGCGCGGG + Intergenic
1132560231 16:590142-590164 CGGGGCCGGCGCTGGGCTTCGGG + Intronic
1132578761 16:675763-675785 CTGGCCGGGGGCCGGGGTCCGGG - Exonic
1132600013 16:769165-769187 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600017 16:769171-769193 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600037 16:769207-769229 CGGGGCCGGGGCCGGGGTTGGGG - Intergenic
1132600041 16:769213-769235 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132600045 16:769219-769241 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1132607804 16:800790-800812 TGGGGGCGGCGCCAGGGCCCAGG - Intergenic
1132683441 16:1153008-1153030 CGGGGCGGGCGGGGGGGTACTGG - Intergenic
1132683577 16:1153342-1153364 GGGGGCCGGGGCCGGGGCCGGGG + Exonic
1132730004 16:1356504-1356526 AGGGGCCGTGGCCGGGGTTCTGG + Intronic
1132736592 16:1389050-1389072 CGGGGCCGGGGCCGGGGGAGGGG - Intronic
1132736597 16:1389056-1389078 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1132746578 16:1438766-1438788 TGGGGCCGGGGCCGGGGTGCAGG - Intronic
1132779355 16:1614313-1614335 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1132785906 16:1656893-1656915 GGGAGCCGGGGCGGGGGTCCTGG - Exonic
1132805483 16:1773267-1773289 CAGGGCCGGGGCCGGGGACGGGG + Exonic
1132828895 16:1918138-1918160 GGGGGCCGGCGCGGGGGCGCGGG + Exonic
1132833913 16:1943025-1943047 CGGGGGCGCCGCCGTCGTCCGGG - Intronic
1132838022 16:1964480-1964502 CGGGGCCGGGGCCGAGGCCGCGG - Exonic
1132854159 16:2037371-2037393 CGGGGCAGGCACCGGGCGCCTGG - Intronic
1132856589 16:2047771-2047793 CGGAGCCGGAGCCTGGGACCCGG - Exonic
1132891875 16:2208641-2208663 GGAGGCCAGCGCCGGGGGCCAGG - Intronic
1133020565 16:2965042-2965064 CGGGGCCTGCGCTGGGGGCGAGG + Intronic
1133053869 16:3135105-3135127 CGGGGGCGGGGGCGGGGGCCGGG + Exonic
1133156327 16:3879712-3879734 CGGGGCCTGCTCCGAGCTCCCGG + Intronic
1133156586 16:3880509-3880531 CGCCGCCGCCGCCGGGCTCCGGG + Exonic
1133156609 16:3880561-3880583 CGGGGCGGGCGCCGAGGGCCGGG + Exonic
1133227875 16:4351167-4351189 CGGGCCGGGGGCCGGGGGCCGGG - Intronic
1133272374 16:4616458-4616480 CGGGGGCGGAGCCGGGGGCGGGG + Intergenic
1133286745 16:4694251-4694273 CGGGGCGGGGGGCGGGGCCCGGG - Intronic
1133739241 16:8639397-8639419 AGGGGCCGCCGCCAGTGTCCGGG - Intronic
1133784435 16:8963606-8963628 CGGGGCCGGGGCCGGGGCTGCGG + Intronic
1134064695 16:11220459-11220481 CAGAGTCGGGGCCGGGGTCCAGG + Intergenic
1134531996 16:14990251-14990273 CGGGGTGGGCGCCGCGGTCTGGG - Intronic
1135335859 16:21600074-21600096 CGGGGCCGCGGCCGGGTGCCCGG - Intronic
1136141645 16:28292546-28292568 CCGGGCGGGCGCCGGGGCCGGGG + Exonic
1136147453 16:28323660-28323682 CAGGGCCTGGGGCGGGGTCCTGG + Exonic
1136153678 16:28368186-28368208 CGAGGCCGCCGCCGGGGGCAGGG - Intergenic
1136237828 16:28925338-28925360 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
1136365184 16:29806427-29806449 CGGGGCCGGGGGCGGGGGCCCGG - Intronic
1136365187 16:29806433-29806455 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1136419512 16:30123134-30123156 GGGGGTCGGCCCGGGGGTCCCGG - Exonic
1136453900 16:30369962-30369984 CGGGGCCGGAGCAGAGGTCTCGG + Exonic
1136498736 16:30659330-30659352 CGGGGGCGGCGCCGGCTCCCCGG + Exonic
1136522422 16:30805676-30805698 CCGGGCCGGCGTCCGGGCCCAGG + Intergenic
1136573074 16:31108455-31108477 CGGGGCCGGAGCCAGGGCCCGGG - Intronic
1137559245 16:49492470-49492492 CGAGGCCGGGGCCGGGGCCGGGG + Intronic
1137559249 16:49492476-49492498 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1137614565 16:49838915-49838937 CGGGGCCGCCCCCGCGGGCCGGG + Intronic
1137655323 16:50153839-50153861 CGGGGCCGGGGCCGGGGCCGAGG - Exonic
1137675539 16:50302076-50302098 CGGGGCCAGGGCCGGGGTACAGG - Intronic
1137708012 16:50548605-50548627 CGGCGACGGCGGCGGGGCCCGGG - Intronic
1137926514 16:52546732-52546754 TGGGCCCGGGGCCGGGGGCCGGG + Exonic
1137926601 16:52546986-52547008 CGGGCCGGGCGCCGGGGGCGCGG + Exonic
1138478284 16:57284703-57284725 CGGGGGCGGAGCCGGGATCTCGG - Intergenic
1138507700 16:57486400-57486422 CGGCGGCGGCGCCGGGCTCCAGG + Exonic
1139383681 16:66550146-66550168 AGGGCCAGGCGCCGGGATCCAGG - Exonic
1139435465 16:66934328-66934350 CGGGGTCGGCGGCGGCCTCCTGG - Exonic
1139631829 16:68235988-68236010 CGGGGTCGGCCGCGGGGTCAGGG + Exonic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1141054751 16:80804562-80804584 CCGGGCCGGCGGCGGGCGCCGGG - Intergenic
1141054774 16:80804616-80804638 CGGGGGCCGGGCCGGGCTCCCGG - Intergenic
1141132297 16:81444771-81444793 CGGGCCGCGCGCCGGGCTCCCGG - Intergenic
1141608577 16:85169243-85169265 CGGCGGCGGCGGCGGGGCCCGGG - Intergenic
1141921911 16:87141074-87141096 CGCAACCGGCGCCAGGGTCCCGG - Intronic
1141957695 16:87383591-87383613 CGAGGCTAGCGCCGGGGTCGGGG - Exonic
1141986924 16:87586072-87586094 AGTGGCCGGGGCCGGGGTCACGG + Intergenic
1142068582 16:88076677-88076699 CGGAGCCGGCGAGGGGCTCCTGG - Exonic
1142338968 16:89508442-89508464 CGTGCCCTCCGCCGGGGTCCAGG + Exonic
1142430265 16:90022670-90022692 GGGGGCGGGCGCCCTGGTCCCGG + Exonic
1142468338 17:148309-148331 CTGGGCCTCCGCCGGGGGCCAGG + Intronic
1142509829 17:386251-386273 CGGGGCGGGCGCCGGTTTCACGG - Intronic
1142551839 17:745594-745616 CGGGGCTGGCACGGGGCTCCTGG - Exonic
1142586859 17:979454-979476 CGGGGCCGGGAGCGGGGGCCGGG - Exonic
1142762428 17:2050248-2050270 GGCGGCCGGGGCCGCGGTCCTGG + Intergenic
1142855101 17:2724692-2724714 CGGCGGTGGCGCCGGGGCCCGGG + Intergenic
1143150938 17:4807381-4807403 CGGGCCGGGGGCAGGGGTCCAGG - Intronic
1143329056 17:6120666-6120688 CGGGGGCGGCGGCGTGGGCCAGG - Exonic
1143390578 17:6556938-6556960 CGGAGCCGGAGCCGGGCTCTGGG - Intergenic
1143519428 17:7437172-7437194 GGGCGCCGCCGCCCGGGTCCCGG - Exonic
1143904624 17:10198744-10198766 CGGGGCCGGGGCCGGGACCGGGG + Intergenic
1143904628 17:10198750-10198772 CGGGGCCGGGACCGGGGCCGGGG + Intergenic
1144930928 17:18858235-18858257 CGGGGCCGGGGCTGGGGTCGGGG + Exonic
1145273421 17:21416587-21416609 CCAGGCTGGCGGCGGGGTCCTGG + Exonic
1145311610 17:21704031-21704053 CCAGGCTGGCGGCGGGGTCCTGG + Exonic
1145747772 17:27332843-27332865 CGCGGCCGGCGCAGGCGTCCAGG + Intergenic
1146008358 17:29176599-29176621 CGGGGAGAGAGCCGGGGTCCCGG - Intronic
1146058703 17:29593551-29593573 CGGCGCCGGAGCCGGGGCCCGGG - Exonic
1146398590 17:32487092-32487114 CGGCCCCGCCGCCGCGGTCCCGG - Exonic
1146445290 17:32928083-32928105 CGGGCCGGGGGCCGGGGGCCGGG + Exonic
1146646376 17:34579818-34579840 CGGGCGCGGCGCCAGGGGCCAGG - Intergenic
1146846057 17:36182928-36182950 CGGGGCCGGGGCCGGTGGGCAGG - Intronic
1147139720 17:38454151-38454173 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1147312597 17:39604249-39604271 CAGGCCCGGCGCCGGCGTCCGGG - Intronic
1147629245 17:41919183-41919205 CGGGGCCGGGGCGGGGCCCCGGG + Intronic
1147661912 17:42121263-42121285 CGCAGCCGGGGCCGGGGTCGGGG + Exonic
1147661915 17:42121269-42121291 CGGGGCCGGGGTCGGGGCCTGGG + Exonic
1147722589 17:42548095-42548117 CGTGGCCAGGGCCGGGGTCGGGG + Intergenic
1147795068 17:43036509-43036531 CTGGGGCGGCGCCGGGCTCTGGG - Intergenic
1148122828 17:45222542-45222564 CGGGGCACGCACAGGGGTCCCGG + Intronic
1148157566 17:45432480-45432502 CTGGGTCGGCGCTGGGGGCCTGG + Intronic
1148183111 17:45620684-45620706 CGGGGCCGCGGCCGGGGGCGCGG + Intergenic
1148265740 17:46225007-46225029 CGGGGCCGCGGCCGGGGGCGCGG - Intronic
1148323703 17:46771701-46771723 CGGCGCCGGGGCCGGGGGCGCGG - Intronic
1148370971 17:47099940-47099962 CGGGGCCGCGGCCGGGGGCGCGG - Intergenic
1148440409 17:47709010-47709032 CGGGGGCGGCGGCGGTGGCCGGG - Exonic
1148442601 17:47719509-47719531 CTGGGCAGGGGCTGGGGTCCGGG + Intergenic
1148608025 17:48944788-48944810 GGGAGCCGGCGGCGGAGTCCGGG - Exonic
1149166375 17:53757725-53757747 CGGGGCCGGGGCCGAGGCCGCGG - Intergenic
1149314035 17:55421979-55422001 CGGGGGCGGAGCCGGGCTCCGGG - Exonic
1149994629 17:61400131-61400153 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
1150250264 17:63700732-63700754 CGAGGCTGGCGGCGGCGTCCGGG + Intronic
1150285232 17:63950430-63950452 CGGGGCCGGGGCCGGGGCCTGGG - Intronic
1150791884 17:68205742-68205764 CGGGGCCGGGGCAGGGGCCGGGG - Intergenic
1151472336 17:74326131-74326153 AGGGGCGGGCGCCGGGGGCGGGG + Intergenic
1151491060 17:74432502-74432524 CGGGGCCGGCGGCGAGTCCCAGG + Intronic
1151728239 17:75896670-75896692 CGGGGCCGGGGCCGGGATCGGGG + Exonic
1151728244 17:75896682-75896704 CGGGATCGGGGCCGGGATCCCGG + Exonic
1151772953 17:76177118-76177140 CAGGGCCGGGGCCAGTGTCCAGG - Intronic
1151812572 17:76453076-76453098 CGGGGCTGGAGCCGGGGCCTGGG + Exonic
1151854398 17:76710773-76710795 GCGGGACGGCGCCGGGGCCCCGG + Exonic
1151938855 17:77280911-77280933 GGGGGTCGGAGCCGGGGTGCCGG - Intronic
1151969869 17:77452033-77452055 CGGCGCCGGCACTGGGATCCAGG + Intronic
1152069072 17:78126237-78126259 CGGGGCCGGGGCCGAGGCCGAGG + Intronic
1152108008 17:78342001-78342023 CGGGGCCGGGACCGGGATCCCGG + Intergenic
1152123478 17:78432911-78432933 CGGTGCTGGCACCGGGGTCGGGG - Intronic
1152239214 17:79152835-79152857 GGAGGCCGGCGCCGTGTTCCTGG - Intronic
1152354078 17:79798214-79798236 CGGGCCGGGCGCCGGGGTTCGGG - Intronic
1152462595 17:80449382-80449404 CGGGGACGGCAGCGGGGCCCTGG + Intergenic
1152697518 17:81804360-81804382 CCGGGCGGTCTCCGGGGTCCGGG + Intronic
1152714380 17:81891471-81891493 CGGGGCGGGGGCCGGGGCCGCGG - Exonic
1152724233 17:81937290-81937312 CGGGGGCGGGGCCTGGGTGCGGG - Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152852885 17:82648144-82648166 CTCGGGCGGGGCCGGGGTCCCGG + Intronic
1152924030 17:83079514-83079536 CGGGGTCGGGGGCGGGGTCGGGG + Intergenic
1152924374 17:83080497-83080519 CGGGGCAGGGGCGGGGGGCCCGG - Intronic
1153854957 18:9136683-9136705 AGGGGCGGGCGCCGGGGGGCGGG + Intronic
1153934966 18:9913609-9913631 CGGGGCCTTCGCCGAGGGCCTGG - Intergenic
1153935310 18:9914880-9914902 CCGGGCCGGGGCAGGGGTCGGGG - Intronic
1155168524 18:23249916-23249938 AGGGGCCAGCGCTGGGATCCTGG - Intronic
1155284207 18:24271875-24271897 CGGGCGCGGCGCGGGAGTCCTGG - Intronic
1155519886 18:26657048-26657070 AGGGGCCGCGGCCGGGGGCCGGG - Intronic
1156171703 18:34493858-34493880 CGCGGCCGGCGCCGGCGCACAGG - Intronic
1156275563 18:35580958-35580980 CGGGGCAGGCACCCGGGTCTCGG - Intergenic
1157473693 18:48008328-48008350 CTGGGCCGGGGGCGGGGGCCAGG + Intergenic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1157833656 18:50879325-50879347 TGGGGCCCGGGCGGGGGTCCGGG + Intronic
1157867218 18:51197276-51197298 CGGGGCCGCCGCCAGGGCCAGGG + Exonic
1158137612 18:54224276-54224298 CGGGGCCGGGGCCGGGGCCGCGG - Exonic
1158137613 18:54224282-54224304 CGGGGACGGGGCCGGGGCCGGGG - Exonic
1158137624 18:54224300-54224322 CGGGGCCGTGGCCGGGGACGGGG - Exonic
1158137628 18:54224306-54224328 CGGGGCCGGGGCCGTGGCCGGGG - Exonic
1158137632 18:54224312-54224334 CGTGGCCGGGGCCGGGGCCGTGG - Exonic
1158436009 18:57435860-57435882 CGGGGGCGGCGGCGGGGGCCCGG + Exonic
1158453341 18:57586340-57586362 CGGGGAGGGCGCCCGGATCCAGG - Intronic
1158718367 18:59900274-59900296 CGGGGTCGGGGCCGGGGTCGAGG + Intronic
1158718368 18:59900280-59900302 CGGGGCCGGGGTCGAGGTCTCGG + Intronic
1158938351 18:62384947-62384969 CGGGGCCGCCGCACGGGTCCGGG - Exonic
1158953815 18:62522398-62522420 CGGCCCCGGCGCCGCGATCCCGG - Intergenic
1159798082 18:72867708-72867730 CGGGGCCGGGGCCGGGGAGAGGG + Exonic
1160157174 18:76442703-76442725 TGGGGCTGGCGCAGGCGTCCAGG + Exonic
1160163208 18:76491268-76491290 CGGGGCCGGGGCCGGGGAGGGGG - Intronic
1160163213 18:76491274-76491296 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160163330 18:76491555-76491577 GGGGGCGGGCGCCGGGGGGCGGG + Intronic
1160242392 18:77132892-77132914 CGGCGCCGGCGGCCGCGTCCAGG - Intronic
1160499540 18:79395382-79395404 GGGGGCGGGGGCCGGGGGCCGGG - Intergenic
1160499891 18:79396375-79396397 CGTGGGGGGCGCAGGGGTCCGGG - Intronic
1160500779 18:79400351-79400373 CGGGGCGGGAGCCGGGGTCGCGG - Intronic
1160567758 18:79797904-79797926 GCGGGGCGGCGCCGGAGTCCGGG + Intergenic
1160592533 18:79952145-79952167 CGGGGCCGTCGCCGGGGGGCCGG + Intergenic
1160631208 18:80247423-80247445 CGGGGCCGGGGCCGGGGCCTGGG - Exonic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160701132 19:507924-507946 CAGCGCCGGCGCAGGGGCCCGGG + Intronic
1160718733 19:588553-588575 CGGGGCCGGCGTGGGGGCGCAGG + Intergenic
1160719296 19:590340-590362 CGGGGCCCGCGCCGGGGCCGGGG + Exonic
1160724846 19:613554-613576 GGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160724850 19:613560-613582 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1160724854 19:613566-613588 CGGGGCCGGGGCCGGGGATGGGG + Intronic
1160725624 19:616690-616712 CGAGGCCGCCGCCGGGGGCAGGG - Exonic
1160749482 19:727228-727250 CGGGGTCGGGGTCGGGGTCAGGG - Intronic
1160781139 19:878428-878450 CGGGGCCGGGGCCGGGGCTGGGG - Intronic
1160781143 19:878434-878456 TGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781298 19:878918-878940 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160781302 19:878924-878946 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1160826363 19:1082273-1082295 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1160831982 19:1108456-1108478 CGACGCCGGGGCCGGCGTCCAGG + Exonic
1160832064 19:1108726-1108748 CAGGGCCGGCGCTGGGGGCTCGG + Intronic
1160832962 19:1111945-1111967 CGGGGCAGGGGCAGGGGTCTAGG - Intronic
1160845346 19:1163811-1163833 GAGGGCAGGAGCCGGGGTCCAGG + Intronic
1160856326 19:1219440-1219462 TGGGGCGGGGGCCGGGGGCCAGG + Intronic
1160930759 19:1568452-1568474 CGGGGCCGGCGCCGGGCACGTGG + Intergenic
1160947401 19:1650149-1650171 CGGGGGCTGGGCGGGGGTCCTGG + Intronic
1160957589 19:1700551-1700573 GCGGGCCGGCGGCGGGGGCCAGG - Intergenic
1160991819 19:1863275-1863297 CCGCGGCGGCGCCGGGGCCCGGG + Exonic
1160991839 19:1863318-1863340 CGGGGGTGGCCCCGGGGTCCCGG + Exonic
1161065645 19:2236093-2236115 GGAGGCCGGGGCCGGGGTCTGGG - Intronic
1161069261 19:2252305-2252327 CCGGCCCCGCGCCGGAGTCCAGG - Exonic
1161175860 19:2841820-2841842 CGGGGACGGAGTCGGGCTCCGGG - Intronic
1161237691 19:3206067-3206089 TGGGGCCGGGGCCGGGGGCAGGG - Intronic
1161319628 19:3634911-3634933 CAAGGCCTGCGCTGGGGTCCTGG - Intronic
1161494694 19:4580817-4580839 CGGGGCTGGTGTGGGGGTCCTGG - Intergenic
1161505082 19:4639512-4639534 CGGAGCCGGGGCCGGGGCCGGGG - Intronic
1161583929 19:5094977-5094999 CGGGGGCGGCGCCGGGGGCGGGG + Intronic
1161608749 19:5229450-5229472 CGGGGCCGGGGACGGGCTCCGGG - Intronic
1161702941 19:5805007-5805029 CGGGGGCGGGGCCGGGGGCGGGG - Intergenic
1161702946 19:5805013-5805035 CGGGGCCGGGGGCGGGGCCGGGG - Intergenic
1161800727 19:6415639-6415661 CGGGGCCGGGGACGGGGCCCGGG + Exonic
1161840575 19:6677914-6677936 CGGTGAAGGCGCCGAGGTCCTGG + Exonic
1162007352 19:7788944-7788966 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
1162019761 19:7863076-7863098 CGGGGCCGGGGTCGGGGGGCGGG + Intronic
1162033250 19:7926178-7926200 CGGGGCCGCCGCGGGGGGCGGGG + Intergenic
1162426879 19:10602428-10602450 CGGGGCCGGGGCCCGGGGCGGGG + Intergenic
1162506855 19:11090652-11090674 CGGAGGCGGCTCCGGGGACCCGG - Intronic
1162535835 19:11262466-11262488 CGGCGGCGGGGCCGGGGCCCGGG - Intronic
1162659199 19:12156312-12156334 CGGGGCCGGGGCCAGGGCCGGGG + Intronic
1162760464 19:12885698-12885720 AGGAGCCGGCGCCGGGCCCCGGG + Exonic
1163018165 19:14469523-14469545 AGGGGCCCGGGCTGGGGTCCAGG - Intronic
1163154455 19:15432456-15432478 CCGAGCCGGAGCCGGGGCCCGGG - Intronic
1163243305 19:16077037-16077059 CGGGGCTGGCGCCGGGGTCCCGG + Intronic
1163262277 19:16198337-16198359 CGGCGCCGGGGCCGGGGGCTCGG + Intronic
1163304896 19:16471872-16471894 TGGGGGCGGCGCCGGGGTGCGGG - Intronic
1163424784 19:17235412-17235434 GGGGGCCGGAGTCTGGGTCCAGG + Intronic
1163462648 19:17448291-17448313 CGGGGCCGGCGCCCAGCTCCTGG + Exonic
1163521691 19:17795451-17795473 TGGGAGGGGCGCCGGGGTCCCGG - Intronic
1163547231 19:17947801-17947823 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1163551201 19:17967222-17967244 GGGAGCCGGAGCCGGGGTCGCGG - Intronic
1163596994 19:18226158-18226180 TGGGGCCGGGGCCGGAGTCCGGG - Intronic
1163606936 19:18280863-18280885 CGCGGGCGGCGCCGGGGGCGCGG - Exonic
1163607284 19:18282012-18282034 CGGGGGCGGTGCCGGCCTCCGGG + Intergenic
1163695073 19:18759943-18759965 CGGGGCTGGCGGCGGGGACAGGG - Intronic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1164229293 19:23273893-23273915 CGGGCGGGACGCCGGGGTCCCGG + Intergenic
1164835957 19:31355188-31355210 CGGGGCCGGGGCCGGGGCCAGGG + Intergenic
1165227463 19:34365107-34365129 CGGGGGCGGGGCCGGGGCTCAGG + Intronic
1165242923 19:34481873-34481895 CGGGGCGGGCTCCGGGCTTCGGG + Exonic
1165274284 19:34734398-34734420 CGGGGGCGGCGGCGGGGCTCAGG + Intronic
1165349737 19:35269189-35269211 CGGGGCCGGGGCCGGGGCGCGGG - Intronic
1165349740 19:35269195-35269217 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1165420141 19:35718289-35718311 CGGGGCCGGGGACGGGGTCGGGG + Exonic
1165425913 19:35745295-35745317 GGGGGTCGGGGCCGGGGTACTGG - Exonic
1165490821 19:36121731-36121753 CGGGCCCGGTCCCGGGCTCCAGG + Intronic
1165939164 19:39406769-39406791 CGGGGCCGGGGCCGGGGGCGGGG - Intergenic
1165939169 19:39406775-39406797 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1166106371 19:40600096-40600118 CGGCGGCGGCCCCGGGGGCCAGG + Exonic
1166126330 19:40717261-40717283 TGGGCCCGGCGCAGGGGCCCCGG + Exonic
1166714049 19:44955358-44955380 CGGGGCTGGCGGCGGGGGCGGGG + Exonic
1166853631 19:45771734-45771756 CGGGGCCGGGGCCGGGATGCGGG - Intronic
1167267530 19:48491111-48491133 CGGGCCGGGCGTCGGGGGCCCGG + Exonic
1167456297 19:49597936-49597958 CGGGGCCGGGGCCGAGGCCGGGG + Exonic
1167461182 19:49625472-49625494 CGAGGGCGGCGCCGAGGACCTGG + Exonic
1167578333 19:50328320-50328342 CGGCGCCGCCGCCCGCGTCCTGG + Exonic
1167622759 19:50568344-50568366 CGGGGCCGGGGCCGGGGCCTGGG - Intergenic
1167622762 19:50568350-50568372 GGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1167648900 19:50719302-50719324 TTGGCCCGGCGCCGGGCTCCTGG - Intronic
1167781432 19:51601505-51601527 GGGGGCAGGCGCCGGGGCGCGGG - Intergenic
1168076194 19:53982014-53982036 CGGGGCCGGGGGCGGGGGCGGGG + Intronic
1168306162 19:55437540-55437562 CGGGGCCAGAGCCTGGGTTCAGG - Intronic
1168307312 19:55442641-55442663 CGGGGCGGGCGCGGCGGCCCGGG - Exonic
1168401515 19:56088283-56088305 CGGGCACGGGGCCGGGCTCCTGG - Exonic
1202700619 1_KI270712v1_random:161135-161157 CGGGGCCACCGCCATGGTCCAGG + Intergenic
924962266 2:45927-45949 CGGGACCGTCTCCGGGTTCCCGG + Exonic
925927195 2:8678960-8678982 CGGGGCCGGAGCCGGAGCCCCGG - Exonic
926035106 2:9630461-9630483 CGGGGCCGGGGCCGGGGCGGAGG + Exonic
927690506 2:25204669-25204691 CGGGGCCCGGGCGGGCGTCCGGG - Intergenic
927809474 2:26173437-26173459 CGGGGCCCACGCCGGGGAGCTGG - Intronic
927990348 2:27442782-27442804 CCGGGCGGGGGCCGGGCTCCCGG + Intronic
928126701 2:28621299-28621321 CAGGGACAGCGCCCGGGTCCAGG - Intronic
928511997 2:32010736-32010758 CGGGGCCGGCGGCGGGCGGCCGG - Intronic
928518325 2:32064136-32064158 CGGCACCGGCGCCGGGGCCGAGG - Exonic
929468682 2:42169585-42169607 CGGGGAAAGCGCCGGGCTCCGGG - Exonic
929966840 2:46542822-46542844 CGGGGCCGGGGCGGGGATCCGGG + Exonic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
930011425 2:46941040-46941062 CGGGGGCGGCGGCGGGGGGCGGG + Intronic
930700836 2:54456695-54456717 CGGGGGCGGCGCGGGGAGCCCGG + Intronic
933886221 2:86720850-86720872 CGGGGCCGGGACCGGGGCTCGGG - Intronic
933923959 2:87075856-87075878 CGGGGCCGGGACCGGGGCTCGGG + Intergenic
934171547 2:89544607-89544629 CGGGGCCACCGCCATGGTCCAGG + Intergenic
934281855 2:91618925-91618947 CGGGGCCACCGCCATGGTCCAGG + Intergenic
934933189 2:98445054-98445076 GGCGGCTGGCGCCGGGGGCCGGG + Exonic
934943585 2:98520165-98520187 CAGGGCCTGCACCGGGCTCCAGG + Intronic
934966804 2:98730947-98730969 TGGGGGCGGCGCCGGCGGCCGGG - Intronic
935046714 2:99489783-99489805 CCGGGCCGGCGGCGGGGTGGGGG - Intronic
935556055 2:104510615-104510637 CGGGGCCTGCCCGGGGGTCAGGG + Intergenic
935592567 2:104855630-104855652 CGGGGGCGGCGCAGGGGGCGGGG + Exonic
936122669 2:109760369-109760391 CGGGGGCGGGGCCGGGGGCCAGG + Intergenic
936222024 2:110611104-110611126 CGGGGGCGGGGCCGGGGGCCAGG - Intergenic
936433262 2:112482223-112482245 CGGCGCGGGCGGCGGGGGCCGGG + Exonic
937997084 2:127702134-127702156 CGAGGCCGGCGCCGCGGCCCAGG - Exonic
938301121 2:130213696-130213718 CGGGGCCGGGGCGGGGATCCTGG - Intergenic
938455595 2:131460771-131460793 CGGGGCCGGGGCGGGGATCCTGG + Intergenic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
940316706 2:152335104-152335126 CCGGGCCGGGGGCGGGGGCCGGG + Intergenic
941104906 2:161341153-161341175 GCGGGACGGCGCCGGGGCCCCGG + Intronic
941111605 2:161423516-161423538 CGGGGCCCGCGCCCGCGCCCGGG - Exonic
941666361 2:168247289-168247311 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
941666363 2:168247295-168247317 CGGGGCCGGGGCCGGGGCCGCGG + Exonic
941666373 2:168247325-168247347 CGGGGCCGGCGCTGCTGTCGCGG + Exonic
943185295 2:184598868-184598890 CGGGGCCGGCGACGGTGGGCTGG - Exonic
944221857 2:197310937-197310959 CGGGGGCAGCGCCGGGGGCCGGG - Intronic
944495867 2:200306872-200306894 CCGGGCCGGAGCCGGGGCCCGGG - Intronic
945080952 2:206085723-206085745 TGGGGCCGGCGCCCGGGTGGTGG - Intronic
945225885 2:207530509-207530531 CCGGGGCGGCTCCGGGTTCCCGG - Intronic
946422083 2:219570861-219570883 CGCTGCCATCGCCGGGGTCCGGG - Exonic
947623328 2:231604592-231604614 CGGGGCCGGAGCTGGGGCCGAGG + Intergenic
947720178 2:232365372-232365394 CGGGGACTGTGCTGGGGTCCAGG + Intergenic
947800881 2:232928034-232928056 CGGGGGCCACGCCGGGGCCCTGG + Intronic
947856279 2:233326708-233326730 CAGGGCCAGCGCTGGGGTCCAGG - Intronic
948216538 2:236237337-236237359 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216551 2:236237356-236237378 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948216553 2:236237362-236237384 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216566 2:236237381-236237403 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948216568 2:236237387-236237409 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216581 2:236237406-236237428 CGGGGCGGGGGCCGGGGCCGGGG + Intronic
948216583 2:236237412-236237434 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948479143 2:238239607-238239629 CGGGGCGGGCGGGCGGGTCCGGG - Intronic
948492255 2:238320914-238320936 CTGGGCCGGAGTCGGGGCCCGGG + Intronic
948690014 2:239696062-239696084 CAGGGCAGCCGCAGGGGTCCTGG - Intergenic
948697309 2:239738203-239738225 CGGGGCCGGGGCCGGGGATGGGG - Intergenic
948697313 2:239738209-239738231 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697317 2:239738215-239738237 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948697321 2:239738221-239738243 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
948824637 2:240568378-240568400 CGGGGCCGGGGCGCGGGGCCGGG - Intronic
948824856 2:240569122-240569144 CGGGGCGGGCGCCGGGGCTGCGG + Intronic
949089086 2:242183383-242183405 CGGGGTCGGGGTCGGGGTCAGGG + Intergenic
1168769747 20:407943-407965 CGGGGCCGGGGGCGGGGCCGGGG - Intronic
1168769751 20:407949-407971 CGGGGCCGGGGCCGGGGGCGGGG - Intronic
1168769756 20:407955-407977 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1168769793 20:408012-408034 CGGGGCCGGGGGCGGGGCCGGGG - Intronic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169044443 20:2524729-2524751 CAGCGCCGGGGCTGGGGTCCGGG - Intergenic
1169113245 20:3046409-3046431 CGAGGCCCGAGCCGGGGTTCTGG + Exonic
1169116773 20:3071460-3071482 CAGGGCCTGGGCCGGGGTCAAGG - Intergenic
1169120603 20:3093343-3093365 GCGGGCCGGCGGAGGGGTCCTGG + Intergenic
1169214723 20:3786501-3786523 CGGCGGCGGCGCCGGGCCCCGGG - Exonic
1169557805 20:6768407-6768429 CGGGGCCGGCTCCGGGACTCGGG - Exonic
1169867705 20:10218732-10218754 CGGGGGCGGGGGCGGGGCCCGGG - Intergenic
1170562322 20:17569052-17569074 CGGGGCTGGCGCCACCGTCCCGG + Intronic
1170889956 20:20368389-20368411 CGGGCTCGGCGCCGGGGGCTCGG - Exonic
1171978527 20:31610733-31610755 CGAGGCTGGGGCCAGGGTCCAGG + Intergenic
1172367910 20:34363731-34363753 CGGGGCCGGCGCGGGCGACGTGG + Intronic
1172533509 20:35652817-35652839 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1172618709 20:36306402-36306424 CGGGGCGGGGGCCGGGGCCTAGG + Exonic
1172656457 20:36541415-36541437 CGGGGCCGCGGGCGGGGTGCGGG - Intergenic
1172765039 20:37346483-37346505 CGGGGGGGGCGCAGGGTTCCTGG + Intronic
1173205596 20:40990863-40990885 CTGGGCTGGGGCTGGGGTCCAGG + Intergenic
1173210657 20:41029168-41029190 CCGGGCCGGGGCTGGGGTCGGGG - Intronic
1174054071 20:47785880-47785902 CGGGGCCGGGGCCGTGCGCCGGG - Exonic
1174384097 20:50176475-50176497 CGGGACCAGCGCCGGCTTCCTGG + Intergenic
1175107797 20:56627124-56627146 AGAGGGCAGCGCCGGGGTCCAGG + Intergenic
1175108229 20:56629224-56629246 GGGGGCCGGCGCGGAGGCCCAGG - Intergenic
1175847185 20:62065258-62065280 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1175847192 20:62065270-62065292 CGGGGCCGGGGCCGGGCCCGGGG + Exonic
1175847196 20:62065276-62065298 CGGGGCCGGGCCCGGGGCCGGGG + Exonic
1175873672 20:62219854-62219876 CGCGGCCAGCACCGCGGTCCAGG + Exonic
1175877831 20:62238737-62238759 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1175877901 20:62238908-62238930 GGGGGCCGGGCCGGGGGTCCCGG - Intronic
1175911479 20:62407228-62407250 CGGGGCCGGGGGCCGGGCCCGGG + Exonic
1175936912 20:62518195-62518217 CTGAGCAGGCGCTGGGGTCCGGG - Intergenic
1176005576 20:62860951-62860973 CGGGGCCGGGGCCGGGGCGGAGG - Intronic
1176005579 20:62860957-62860979 CGAGGCCGGGGCCGGGGCCGGGG - Intronic
1176097312 20:63350053-63350075 TGGGGCGGGCGGCAGGGTCCAGG + Exonic
1176128965 20:63488219-63488241 CGGGGGCGGGGCGGGGGCCCGGG + Exonic
1176128967 20:63488225-63488247 CGGGGCGGGGGCCCGGGCCCGGG + Exonic
1176143258 20:63554223-63554245 CTGGGGCGGCGGCGGGGGCCGGG + Exonic
1176178880 20:63740474-63740496 CGGGGGCGGCGGCGGGGCCCCGG + Exonic
1176194483 20:63831018-63831040 CGGGCCCGGAGCCGGGAGCCGGG - Intronic
1176220998 20:63969441-63969463 CCAGGCCTGGGCCGGGGTCCCGG - Intronic
1176221216 20:63970033-63970055 CGGGGGCGGGGGCGGGGGCCCGG + Intronic
1176278349 20:64286938-64286960 CGGGGTCGGGGTCGGGGTCAGGG + Intronic
1176952411 21:15064133-15064155 GGGGGCCGGCCCCTGGCTCCTGG + Intronic
1177894638 21:26844871-26844893 CGGAGCGGGCTCCGGGGTCTCGG - Exonic
1178610399 21:34074042-34074064 GCGGGCCGGCGCCGGGATCGGGG - Intronic
1178865098 21:36320410-36320432 CGGGGGCTGCGGCGGGGCCCGGG + Intronic
1179150739 21:38806181-38806203 CGGGGCCTGGGCGGGGGTCGCGG + Intronic
1179457244 21:41508053-41508075 CGGCGCCGGTACCAGGGTCCCGG - Exonic
1179605611 21:42513728-42513750 CGGGGCCGGGGCCGGAGCCGGGG + Intronic
1179675077 21:42975239-42975261 CGAGGCCGGGGCCGGGGTCGCGG - Intronic
1179780095 21:43694080-43694102 CGGGGGCTGCGCTGGGCTCCCGG - Exonic
1180005520 21:45018907-45018929 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1180093253 21:45543010-45543032 GAGGGCGGGCGGCGGGGTCCCGG - Intronic
1180216177 21:46324786-46324808 CGCGGCCGGGGCCGGGGGCGTGG + Intronic
1180782801 22:18530101-18530123 CCGGGCCGGCGCCGCGGGCGCGG + Intronic
1181002901 22:19996108-19996130 CAGGGCCAGAGCCGGGGGCCTGG + Intronic
1181126363 22:20704133-20704155 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1181239691 22:21469439-21469461 CCGGGCCGGCGCCGCGGGCGCGG + Intergenic
1182904015 22:33920921-33920943 AGGGGCGGGCGCTGGGGTCCGGG + Intronic
1183149733 22:36028365-36028387 CGGGCCCGGCGCCGCCGCCCGGG - Exonic
1183410234 22:37650650-37650672 CGGAGCCGGAGCCGGGGTGGTGG - Exonic
1183506992 22:38214842-38214864 CCGGGCCGTGGGCGGGGTCCGGG - Exonic
1183531095 22:38353785-38353807 CGGGCCCAGCCCCGGGTTCCAGG + Intronic
1183545915 22:38454889-38454911 CGGGGCCGGAGCGGCGGGCCCGG + Intronic
1183692741 22:39400019-39400041 CGGGCCCGGCCCCCGGGTCAAGG + Intronic
1183702234 22:39457288-39457310 CCGGGGCGGCGGCGGGGGCCCGG - Intergenic
1183780300 22:39995004-39995026 CGGGGCCGGGGCCAGGGCCGGGG + Exonic
1183780304 22:39995010-39995032 CGGGGCCAGGGCCGGGGCCGGGG + Exonic
1183780308 22:39995016-39995038 CAGGGCCGGGGCCGGGGCCGGGG + Exonic
1183780379 22:39995314-39995336 CGGCGCCGGCGCGGGGGCCTTGG - Exonic
1184439201 22:44498247-44498269 CAGGGGCGGGGCCGGGGTCGCGG + Exonic
1184465881 22:44668729-44668751 CGGAGCCGGAGCCCGGGGCCGGG - Intronic
1184465885 22:44668735-44668757 CGGAGCCGGAGCCGGAGCCCGGG - Intronic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1184620424 22:45672248-45672270 CGGGGGCGGCGCCTGGGTCCAGG - Intronic
1184697951 22:46150358-46150380 CGGGGCCGAGGCCCGGGGCCCGG + Intergenic
1184759406 22:46536469-46536491 CGGGGCCGGCGCGACGGGCCCGG - Exonic
1184979672 22:48086861-48086883 CGGGGCGGGGGTCGGGGCCCGGG + Intergenic
1184979686 22:48086885-48086907 CGGGGCGGGGGTCGGGGCCCGGG + Intergenic
1185278759 22:49961049-49961071 CGGGGCCGGGGCCGGGGCCAGGG + Intronic
1185313765 22:50170313-50170335 CGGGGGCGGCGGCGGGATCCCGG - Intergenic
1185315653 22:50178182-50178204 CAGGGGCGGGGCCGGGGCCCGGG - Exonic
1185333349 22:50261325-50261347 CGGGGCCTGCGCGGGGTGCCCGG - Intronic
1185343000 22:50299910-50299932 CGGTGCCGGCGCCGGGGGAGGGG - Intronic
1185374144 22:50474560-50474582 GAGGGCCGGGGCCGGGGGCCGGG - Intronic
1185403045 22:50628186-50628208 CGGGGCCGGGGGCGGGGCCGGGG + Intergenic
1185403050 22:50628192-50628214 CGGGGGCGGGGCCGGGGGCGGGG + Intergenic
1185403053 22:50628198-50628220 CGGGGCCGGGGGCGGGGCCGGGG + Intergenic
949089451 3:10914-10936 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
949089454 3:10920-10942 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
949089457 3:10926-10948 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
949089460 3:10932-10954 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
949089463 3:10938-10960 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
949089466 3:10944-10966 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
950422639 3:12907813-12907835 CAGGGCTGGCTCCGGGGTCCGGG - Intronic
950487705 3:13282754-13282776 GCGGGCCGGGGCCGGGGCCCGGG + Intergenic
950487709 3:13282760-13282782 CGGGGCCGGGGCCCGGGTCGGGG + Intergenic
950509920 3:13420019-13420041 CCGGGCGGGCGCCGTGGGCCGGG - Intronic
950729800 3:14947689-14947711 CGGGGGCGCCGCCGGGGTCGCGG - Intronic
950730095 3:14948589-14948611 CGGGGGCGGGGCCGGGGGCGGGG + Intronic
952418999 3:33114563-33114585 CGGGGCCGGGGCCTGGGACGGGG - Intronic
952888343 3:38025130-38025152 CGGGGGCGGGGCCAGGGCCCAGG + Intronic
952888380 3:38025232-38025254 CGGGGGCGGAGCCAGGGTCCGGG + Intronic
952970949 3:38649734-38649756 CGGGGTCGGGGGCGGGGTCGGGG + Intergenic
953027443 3:39153263-39153285 CGCGGCCGGAGTCGGGGGCCGGG - Intronic
953901421 3:46846067-46846089 CGGGGCCTGGGCCGGGGCCGGGG - Intergenic
953974393 3:47371390-47371412 GGGGGCCGGCGGCGGGGTGGGGG - Intergenic
954004025 3:47578328-47578350 CGGGGCCGGGGGCGGGGCCGGGG - Intronic
954004232 3:47578916-47578938 CGGGGCCGGCGCGGCGGGCGGGG - Exonic
954214568 3:49117178-49117200 AGGGGCTGGCCCCGGGGCCCAGG - Exonic
954277958 3:49554668-49554690 CGGGGCCGGGGCCCGGGCCGGGG - Exonic
954277962 3:49554674-49554696 CGGGGCCGGGGCCGGGGCCCGGG - Exonic
954277998 3:49554782-49554804 CGGGGCCGGGGCCGGGGCCAGGG - Exonic
954278001 3:49554788-49554810 CGGGACCGGGGCCGGGGCCGGGG - Exonic
954361317 3:50124291-50124313 CGGGGCCTGGGCCGGGGCCAGGG - Intergenic
954361320 3:50124297-50124319 CGGGGCCGGGGCCTGGGCCGGGG - Intergenic
954361324 3:50124303-50124325 CGGGGCCGGGGCCGGGGCCTGGG - Intergenic
954361327 3:50124309-50124331 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
954391265 3:50269252-50269274 CGGGGCTGCCGCCGTGATCCCGG + Exonic
955356705 3:58237877-58237899 CGGGCCCGGCGGCGGGACCCAGG + Exonic
955387713 3:58492368-58492390 CGGGGCCTGGGCGGGGGTTCCGG + Intronic
955818797 3:62874855-62874877 CGGCGCCGGCGCCGGAGCCGGGG - Exonic
956659324 3:71583061-71583083 CGGGGCCGGTGCGGGGTCCCGGG - Intronic
956677935 3:71753422-71753444 CGGCGCCCGCGCTGGGGTCACGG - Intronic
956761369 3:72447439-72447461 CGGCTTCGGGGCCGGGGTCCCGG - Intergenic
960096631 3:113696315-113696337 CGGGGCGGGGGGCGGGGGCCAGG - Intronic
961081668 3:124033440-124033462 GGGGCCCGGGGCCGGGGTGCGGG - Intergenic
961081672 3:124033447-124033469 TGGGGCCGGGGCCCGGGGCCGGG - Intergenic
961299822 3:125915683-125915705 CGGGGCCAGCGGCGGGCCCCAGG - Intergenic
961612808 3:128153836-128153858 CGGGGCGGGAGCCGGGCTCAGGG + Intronic
961666838 3:128497941-128497963 CGGGGCCGGGGCCGGGGCAGGGG - Intergenic
961666842 3:128497947-128497969 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
963091589 3:141487538-141487560 CGCGGCCGGGGGCGCGGTCCGGG + Intronic
966732553 3:183162858-183162880 CGGCGCAGCCGCCGGGGCCCGGG + Exonic
966886445 3:184380177-184380199 CGGGGCCGGGGCCGGGGCCGGGG - Exonic
966886449 3:184380183-184380205 GGGGGCCGGGGCCGGGGCCGGGG - Exonic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967493648 3:190120422-190120444 CGGGGCCCTCGCCGGGGGGCGGG + Exonic
968068985 3:195774264-195774286 TGGGGCAGGCGCCGGGGACCTGG - Exonic
968092808 3:195909096-195909118 CGAGGCCCGGGCCGGGGTGCAGG - Intronic
968178171 3:196568989-196569011 CGGCGCCGGCCCCGGGGGCTGGG + Exonic
968372783 4:11132-11154 CGGCGCCGGGGCGGGGGTCGGGG + Intergenic
968372796 4:11181-11203 CGGCGCCGGGGCGGGGGTCGCGG + Intergenic
968433966 4:575726-575748 GGGGGCCGCGGCCGGGGCCCCGG - Intergenic
968514806 4:1011585-1011607 CGGGGGCGGGTCGGGGGTCCGGG + Intronic
968514839 4:1011695-1011717 GGGGGCCGGGGCCGGGATCCCGG - Intronic
968514841 4:1011702-1011724 CGGGGCCGGGGGCCGGGGCCGGG - Intronic
968616318 4:1579249-1579271 CGCGGGCGGGGCCGGGGGCCGGG - Intergenic
968674980 4:1872045-1872067 CGGGGCCGGCGCCGGGGCCAGGG + Intronic
968702723 4:2064488-2064510 CGGGGCCGGAGCCTGGCCCCGGG - Exonic
968750605 4:2387058-2387080 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
968879822 4:3293109-3293131 CGGGGCCGGGGCCGGGGCGGGGG + Intronic
969493021 4:7510626-7510648 CGGGGCCGGCGCCTTGTTCTGGG + Intronic
969559728 4:7939471-7939493 GTGGGCCCGCGCGGGGGTCCCGG - Exonic
972245609 4:37243708-37243730 CGGGGCCGTCCTCGGGTTCCGGG - Intergenic
972265337 4:37453998-37454020 CGGCGGCGGCGGCGGGGTCCCGG - Intronic
972511376 4:39770946-39770968 CGGGGCTGGCTTTGGGGTCCTGG + Intronic
973292435 4:48483672-48483694 CGGGGCCGGCGCTGGAGGCAGGG - Exonic
973754808 4:54064341-54064363 CGGGGTTGGCGCCGGGGTACCGG + Exonic
973775001 4:54233972-54233994 CGGGAACGGCGTCGAGGTCCAGG + Intronic
975870775 4:78776366-78776388 CGGAGCGGGCGGCGGGGCCCAGG + Exonic
976199015 4:82561547-82561569 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
976297325 4:83485166-83485188 CGGGGCCTGCGCCGGCGCACGGG + Exonic
976600710 4:86935283-86935305 CGGCGGCGGCGTCGGGGGCCGGG - Intronic
978503448 4:109433498-109433520 CGGGGCCGGCACTGGGGCCACGG + Intergenic
979785671 4:124712778-124712800 CGGGGGCGGGGGCGGGGTCTGGG - Intergenic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
982042398 4:151409115-151409137 CGGGGGCGGGGGCGGGGGCCGGG - Intergenic
983061509 4:163166479-163166501 TGGCTGCGGCGCCGGGGTCCCGG + Exonic
984713008 4:182901941-182901963 GGGGGCCGGGGCAGGGGTGCAGG - Intronic
984778586 4:183504903-183504925 CGGGGCCGGCGCCGGGGTCCCGG - Intergenic
984973588 4:185210431-185210453 CGCGGCGGGCTCCGGGCTCCGGG + Intronic
985068352 4:186144723-186144745 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
985129013 4:186723562-186723584 CGGAGCCCGAGCCGGGGACCGGG + Intronic
985462611 4:190121434-190121456 CGGCGCCGGGGCGGGGGTCGGGG - Intergenic
985467498 5:11841-11863 CGGGGTCGGGGTCGGGGTCAGGG - Intergenic
985467500 5:11847-11869 CGGGGTCGGGGTCGGGGTCGGGG - Intergenic
985537435 5:473147-473169 CGGGGCCTGCGCCGGGGGCGGGG - Intergenic
985660785 5:1155734-1155756 CGGGCGCGGCTGCGGGGTCCAGG + Intergenic
985660862 5:1155923-1155945 CGGGGCGGGCGCGGGAGGCCGGG + Intergenic
985713862 5:1445259-1445281 AGGGGCGGGGGCCGGGGACCGGG - Intronic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986330812 5:6714622-6714644 AGGGGGCGGCCCCGGGGCCCAGG + Exonic
986695949 5:10354143-10354165 AGGGGCCGGGGCCGGGGTCGGGG + Intronic
986695951 5:10354149-10354171 CGGGGCCGGGGTCGGGGCCTCGG + Intronic
986721612 5:10564436-10564458 CGGGGCGCGGGCCGGGGGCCGGG - Intronic
987374222 5:17218581-17218603 CCGGGCCGGGGCCGGGACCCAGG - Intronic
988825333 5:34929759-34929781 CGGGGTCGGGGCCCGGGCCCGGG - Exonic
988825346 5:34929783-34929805 GGCGGCCGGCGCTGGGGCCCGGG - Exonic
989178883 5:38556720-38556742 CGGGGCCGGGGCCGGGGGCAGGG - Intronic
989637994 5:43556788-43556810 CGGGGCCGGAGCCGGGGCCTGGG - Exonic
989983286 5:50667422-50667444 CGTGGCCGGAGCGGGGGTCTAGG + Intronic
990699653 5:58460726-58460748 CGGGCCCGCAGCCGGGATCCCGG + Intergenic
992527972 5:77630169-77630191 GGGGCAGGGCGCCGGGGTCCGGG + Exonic
992939664 5:81750521-81750543 CGGGGTCGGGGCCGGGGTCGGGG - Intronic
993502711 5:88680551-88680573 GGGGGCCCGCGCGGGGCTCCTGG + Intergenic
995764596 5:115602053-115602075 GGGGGCCGCCGCCGGGGGCGCGG - Intronic
996404292 5:123090636-123090658 CGGCGCCGGCGCCGGCGCCCCGG - Intronic
997228608 5:132227662-132227684 CGGGGCCGGATCCGGGGCCGGGG - Intronic
998166697 5:139848398-139848420 CAGGTCCCGCGCCGCGGTCCGGG + Exonic
998166721 5:139848476-139848498 CCGGGCCCGGGCCCGGGTCCGGG + Exonic
998230764 5:140360320-140360342 TGGGGCCGGTGCCAGGGTCAGGG - Exonic
999730819 5:154475781-154475803 CGAGGCCCGCGCCGAGGACCTGG - Exonic
1001381979 5:171311318-171311340 CGGGGCCGCCGGCGGGGCCCCGG - Intronic
1001401824 5:171450719-171450741 CGGGGCCGGGGCCGGGGCCACGG + Intronic
1001401976 5:171451221-171451243 CGGGGGAGGCGCCGGGGGCCGGG - Intronic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002168714 5:177363315-177363337 CGGGGCCGGAGACGGGGGCGGGG + Intronic
1002170332 5:177371068-177371090 CCGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170336 5:177371074-177371096 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170340 5:177371080-177371102 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170344 5:177371086-177371108 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170348 5:177371092-177371114 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002170352 5:177371098-177371120 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1002452423 5:179326468-179326490 CGGGGCCGGGGGCGGGGCACAGG - Intronic
1002487654 5:179550628-179550650 TGGAGCCGGGGCCGGGGCCCGGG + Exonic
1002512762 5:179733385-179733407 CGGGGCCGTCAGCGGCGTCCAGG - Exonic
1002541169 5:179907529-179907551 CGCGCCCGGCTCCCGGGTCCTGG + Intronic
1002648406 5:180673800-180673822 CGCGTCCTGCGCCGGAGTCCTGG - Intergenic
1002897815 6:1389606-1389628 CGGGCTCGTCCCCGGGGTCCAGG + Intergenic
1003099024 6:3163095-3163117 CGGGAGAGGCACCGGGGTCCAGG + Intergenic
1003569471 6:7246752-7246774 CGAGGCAGGCGCCGGGGGCGCGG + Exonic
1003661205 6:8064170-8064192 CCGGGCCGACCCCCGGGTCCCGG - Intronic
1004690232 6:17987301-17987323 CGCGGCCGGGGCCGGGGGGCCGG - Intronic
1005826260 6:29633099-29633121 AGGAGGCGGCGCCGGGGACCAGG + Exonic
1006136829 6:31900814-31900836 CGGGGCTGGCTTTGGGGTCCTGG + Exonic
1006155201 6:32009929-32009951 CGGGCCCGGGGCCGGGGGCTGGG - Intergenic
1006161507 6:32042663-32042685 CGGGCCCGGGGCCGGGGGCTGGG - Intronic
1006337429 6:33427981-33428003 TGGGGGCGGCGGCGGGGCCCGGG - Intronic
1006369186 6:33633753-33633775 CGGGGGCGGGGCCGGGGCCGGGG + Intronic
1006369189 6:33633765-33633787 CGGGGCCGGGGCCGGACGCCCGG + Intronic
1006934081 6:37705403-37705425 AGGGGCCGGGGCCGGGCCCCAGG + Intergenic
1007236163 6:40392516-40392538 CGGGCCCTGCGGCGGGGCCCCGG + Exonic
1007444652 6:41895461-41895483 GGGTGCCGGTGCCGGGGTCGCGG - Intergenic
1007591158 6:43021678-43021700 CGGGGCCGGGGCCGGGGCCGGGG + Exonic
1007701784 6:43770126-43770148 GCGGGCCGGGGGCGGGGTCCCGG + Intergenic
1007784208 6:44270796-44270818 CGGTGGCGGCCCCGGGGTCTCGG + Exonic
1007785102 6:44275370-44275392 GGGGGCAGGCGGCGGGGTCGCGG - Intronic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1010568594 6:77449904-77449926 CTTGGCCGGCTCTGGGGTCCGGG - Intergenic
1011277439 6:85643763-85643785 CGGAGCCGGGGGCGGGGGCCGGG - Intronic
1011516983 6:88166037-88166059 CGGCGCCGGCGCCGGGCTGCTGG + Exonic
1013372667 6:109483543-109483565 TGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1013372671 6:109483549-109483571 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1013488529 6:110621229-110621251 TGGGGCTGGGGCCGGGGTCGGGG - Exonic
1014797901 6:125747812-125747834 CGGGGACGGGGTCTGGGTCCTGG + Intronic
1015149311 6:130020111-130020133 CGGGGCCGGGGCCGGCGCCGGGG + Intronic
1015816733 6:137219116-137219138 AGGGCCCGACGCAGGGGTCCCGG + Intronic
1016400861 6:143678252-143678274 CAGGGCTGGCGGCGGGGCCCCGG + Intronic
1016590160 6:145735342-145735364 CGCGGCGGGCGACGGGGCCCTGG - Exonic
1017497528 6:154995193-154995215 GGGAGCTGGCGCGGGGGTCCTGG + Intronic
1017671836 6:156777206-156777228 TGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1017671868 6:156777268-156777290 CGGGGCGGGCGGCGGCGGCCCGG + Intergenic
1017671990 6:156777772-156777794 CGCGGCCGGCGCCCGGAGCCCGG + Intergenic
1018224519 6:161615627-161615649 TGGGGCCGGAGCAAGGGTCCTGG - Intronic
1018400528 6:163415346-163415368 TCGGGCCGGGGCCGGGGCCCTGG - Intronic
1018769050 6:166956366-166956388 CGGGCCCCGCGCCGGGCTCCGGG + Exonic
1018876594 6:167827083-167827105 CGGGGCCGGGGCCGGAGGACGGG - Exonic
1019343571 7:519466-519488 CGGGGCCGGGCCAGGCGTCCAGG - Intronic
1019395712 7:816707-816729 CGGGGCGGGCGCCGGGCTGCGGG + Intronic
1019473403 7:1232978-1233000 CGGGGCCGGTGGCGGGGCGCGGG - Exonic
1019563189 7:1667842-1667864 CGGCGGCGGCGCCGGCGTCCGGG + Intergenic
1019663896 7:2241915-2241937 CGGGGCCGGCGGCGGAGTCCAGG - Intronic
1019689707 7:2403741-2403763 CAGGGCCCGGGCGGGGGTCCCGG + Intronic
1019701580 7:2476963-2476985 GGGGGCAGGCGGCGGGGGCCAGG - Intergenic
1020037722 7:4974663-4974685 CTGGCCCGGCTCGGGGGTCCGGG + Intergenic
1020117963 7:5487029-5487051 CGGGGCCTGCGGCCGGTTCCCGG + Intronic
1020130239 7:5555387-5555409 CGGGCCCGGCGTGGGGGTCGCGG - Intronic
1020274296 7:6615504-6615526 CGGCGGCGGCGGCGGGGGCCGGG + Intergenic
1021719297 7:23490573-23490595 TGGGGCCGGGGCCGGGGTCGCGG + Intergenic
1021828056 7:24573763-24573785 CGGCGGCGGCGCCGCGGTCGGGG + Intronic
1022018579 7:26376708-26376730 CGGGGCCGGGGCTGGACTCCAGG + Intergenic
1022207576 7:28179715-28179737 CGGGGCCGGGGACGCGGGCCCGG - Intronic
1022942537 7:35254204-35254226 CGGGGGCGGGGCCGCGGGCCGGG + Intergenic
1023940377 7:44765503-44765525 AGGGGGCAGCGCCGGGGCCCAGG - Exonic
1024225947 7:47327081-47327103 CAGGGCTGGCGCCTGGGCCCAGG - Intronic
1024394312 7:48848257-48848279 CGGGGCAGGCGCTGTGGGCCAGG - Intergenic
1024400954 7:48924388-48924410 CGGGGCAGGCGCTGTGGGCCAGG + Intergenic
1026765066 7:73155107-73155129 CGCGCCCGGCGCCGAGCTCCCGG + Intergenic
1026786308 7:73303800-73303822 CAGGGCGGGCGCCAGGGTCGTGG - Intronic
1026850368 7:73719734-73719756 GTGGGGCGGGGCCGGGGTCCCGG - Intergenic
1026866622 7:73828069-73828091 CAGGGCGGGGGCCGGGGGCCGGG + Intronic
1026900351 7:74033602-74033624 AGGGGGTGGCGCCGGGGTCTTGG + Intronic
1027041539 7:74964862-74964884 CGCGCCCGGCGCCGAGCTCCCGG + Exonic
1027082103 7:75237507-75237529 CGCGCCCGGCGCCGAGCTCCCGG - Intergenic
1027107774 7:75416195-75416217 CAGGGCGGGCGCCAGGGTCGTGG + Intergenic
1027592538 7:80134700-80134722 GTGGCGCGGCGCCGGGGTCCGGG + Intronic
1028752211 7:94394334-94394356 CGGGGCTGGGGGCGGGGTGCAGG + Intergenic
1029110548 7:98211364-98211386 CCGGGGCGGGGCCGGGGTCCGGG - Intergenic
1029570020 7:101363143-101363165 GGGAGCCGGCGCCGGGCTCGGGG - Exonic
1030033164 7:105387971-105387993 CGCTGCGGGCGCCGGGGTCGCGG - Intronic
1031043572 7:116862983-116863005 CGGGGCCTCCGCCGGGGCCGGGG + Intronic
1031604083 7:123748477-123748499 AGGGGCCGGGGCCGGGGCCGGGG + Intronic
1031919130 7:127588588-127588610 CGGGGCCGGCGCCCCGGTCCGGG - Intronic
1032020653 7:128405701-128405723 CAGGGCCGGCCCGGGGGTCGCGG + Intronic
1032193931 7:129779357-129779379 AGGGGCCAGCTCCGGGGCCCCGG + Intergenic
1033253178 7:139777775-139777797 CGTGGCCGGCGCCGGGGGAGGGG + Intronic
1033253203 7:139777837-139777859 CGGGCCCGGCGCGGGGGGCTCGG + Intronic
1033390643 7:140924601-140924623 CGGCGCCGGCGCCGGCGCCGCGG - Exonic
1033477030 7:141701746-141701768 CAGGGCCGGCCCCGGGCTCCCGG - Intronic
1034129037 7:148698952-148698974 CGGGGCTTTCGCCGGGGCCCAGG + Exonic
1034147133 7:148883836-148883858 GGGCGCCGGGGCCGGGGTCGGGG - Intronic
1034455401 7:151167485-151167507 CGGGGGCGGCGGCGGGGGCCCGG - Exonic
1034483612 7:151341986-151342008 CTGGGCCGGGGCCGGGGCCGGGG + Intronic
1034535121 7:151721393-151721415 CGGGGCCAGGGCCGGGGCCGAGG + Intronic
1034618310 7:152436743-152436765 CGGAGCCGGAGCCGGAGTCGCGG - Intergenic
1034994783 7:155570878-155570900 CGGGGGCGGGGGCGGGGACCAGG - Intergenic
1035212338 7:157337346-157337368 CGGGGCCGGGGCTGGGGTCTGGG + Intronic
1035409003 7:158623486-158623508 CGGGGCCGGCGACGGGTGCAGGG + Intergenic
1035580594 8:737457-737479 CGGGGACTGTGCCGGGCTCCCGG - Intronic
1035813825 8:2517114-2517136 AGGGGCCGGGGCCAGGCTCCCGG + Intergenic
1036359259 8:8065822-8065844 TGACGCGGGCGCCGGGGTCCGGG + Intergenic
1036454058 8:8892926-8892948 CGGGGCCTGCCCCGGGGCCGGGG - Exonic
1036701574 8:11016670-11016692 CGGAGGCGGGGCCGGGGGCCTGG - Intronic
1036850153 8:12194950-12194972 CGGGGCCAGGGGCGGGGCCCAGG + Intergenic
1036891699 8:12601130-12601152 TGACGCGGGCGCCGGGGTCCGGG - Intergenic
1037522040 8:19689323-19689345 GGGGTCCAGGGCCGGGGTCCTGG - Intronic
1037763151 8:21755638-21755660 GGGGGCCGGGGGAGGGGTCCTGG + Intronic
1038542496 8:28401850-28401872 CGGCGCCGGAGCCGCGGCCCCGG - Intronic
1038828458 8:31032881-31032903 CGGGCCCGGCGTGGGGGTCGCGG - Exonic
1039903153 8:41767268-41767290 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1040501439 8:48008623-48008645 TGGGACCGGCGCCGAGGCCCCGG + Intronic
1041511438 8:58659118-58659140 CGGCGCCGGCGCCGAGTGCCTGG + Intronic
1042246425 8:66712867-66712889 CCGGGCCGCCGTCGGAGTCCCGG - Intronic
1044343159 8:91070685-91070707 CCGCGCCGCCGCCGGGGTGCAGG + Intronic
1044781652 8:95749923-95749945 CGGGGCCGCTGCAGGAGTCCTGG + Intergenic
1045432048 8:102123810-102123832 CGGGGCCGGGGCCGGGGGCCGGG - Intronic
1045432052 8:102123816-102123838 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1047393721 8:124475031-124475053 CGGGGCCGCGGCCGGGGGCGGGG - Exonic
1047454617 8:124998163-124998185 CGGGATCGGCGTCGGGGTCGGGG - Intergenic
1047615411 8:126558523-126558545 CGGGGCGGGGGCGGGGCTCCCGG - Intergenic
1049109866 8:140635821-140635843 CGGGGCCTGGGGCGGGGACCCGG + Intergenic
1049194679 8:141308605-141308627 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049194683 8:141308611-141308633 AGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1049201293 8:141341808-141341830 AGAGGCCGGCGATGGGGTCCAGG - Intergenic
1049208186 8:141373057-141373079 CCGGGCAGGCGCCTGGGCCCAGG - Intergenic
1049217569 8:141415146-141415168 CGGGGCAGGCTGCAGGGTCCGGG + Intronic
1049396371 8:142402997-142403019 CGCGGCCCCCGCCGGGCTCCGGG + Intronic
1049406211 8:142452824-142452846 CGGGGACGCCGCGGGGCTCCAGG + Intronic
1049406257 8:142452973-142452995 TGGGGCCGGAGCCGCGGGCCAGG - Intronic
1049620915 8:143597962-143597984 TGGGGCGGGCGCGGGGGGCCCGG - Exonic
1049717694 8:144100687-144100709 GGGGGCCGGGGCCGGGGCCGGGG - Intronic
1049784512 8:144444129-144444151 CAGGGCCGGGGCCCGGGCCCGGG - Intronic
1049801199 8:144518174-144518196 CGGGGCCGAGGCCGGGAGCCTGG + Intronic
1049850384 8:144827345-144827367 CGGGGCTGGCGCCTGGGGGCGGG - Intergenic
1052048592 9:23821893-23821915 CGGGGCCGGCGGCGAGTTCGCGG + Intronic
1052362247 9:27573525-27573547 AGGGGCCGGGGCCGGGGCCGGGG - Intronic
1053129147 9:35605498-35605520 CAGGGCGGGAGCCGGAGTCCGGG + Exonic
1053163486 9:35829316-35829338 CGGGGCGGGGGCCGGGGACCTGG - Intronic
1053786333 9:41655227-41655249 CCGGTCCTGGGCCGGGGTCCGGG + Intergenic
1055030642 9:71768981-71769003 CGGGGCCGGCGGGAGGGGCCGGG - Intronic
1055785201 9:79863729-79863751 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1055829157 9:80359495-80359517 CGGGGCTGGGGCCGGGGCCGGGG + Intergenic
1056243261 9:84669844-84669866 CGCCGGCGGCGCCTGGGTCCAGG - Exonic
1056643407 9:88388988-88389010 CCGGGCCGGCGACGGGGGCGGGG + Intronic
1057217000 9:93234655-93234677 CAGGGCTGGCCCTGGGGTCCAGG + Intronic
1057313437 9:93955209-93955231 CGGGGCCCGCGCGGGGCTCTAGG + Exonic
1057619148 9:96619558-96619580 CGGGGCAGGCGCTGTGGGCCGGG - Exonic
1057623267 9:96655224-96655246 CGGCGCCGCCGCCCTGGTCCCGG - Exonic
1057772842 9:97983425-97983447 GGAGGCCGGCGGCGCGGTCCTGG - Exonic
1057922066 9:99105407-99105429 AGGTGGCGGCGCCGGGGCCCGGG + Intronic
1057995564 9:99819821-99819843 CGGGCTCGGCGCCGGGGGTCGGG - Intergenic
1058439084 9:104991216-104991238 CGGGGCCGGCGCTGGGGCGGGGG - Intergenic
1059305350 9:113349596-113349618 CGGAGCCGGGGCCGGGGTCCGGG + Exonic
1059305353 9:113349602-113349624 CGGGGCCGGGGTCCGGGTCCGGG + Exonic
1059633913 9:116154283-116154305 CCGGGCCGGCGGCGGGGCGCGGG - Exonic
1059769796 9:117414665-117414687 CGGCGCCCGCGCCGGGGCCGGGG - Exonic
1060106699 9:120877198-120877220 TGGGGCCGGGGTCGGGGTCTCGG + Exonic
1060139829 9:121201053-121201075 CCGGGCCGGGGCCGGGGTCTGGG - Intronic
1060770198 9:126326890-126326912 AGGGGCCGGGCCCGGGGCCCAGG - Exonic
1060831838 9:126722381-126722403 CCGGGCCGGCCTCGGGGACCTGG + Intergenic
1060970569 9:127735180-127735202 CGCGGCCGCCGCCTGGGACCTGG - Exonic
1060995543 9:127873372-127873394 GGTGACCGGCCCCGGGGTCCAGG - Intronic
1061128314 9:128690079-128690101 CGGGGGCGCCGCCGCGGGCCGGG - Intronic
1061275895 9:129569211-129569233 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061275899 9:129569217-129569239 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1061293708 9:129666157-129666179 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293712 9:129666163-129666185 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061293715 9:129666169-129666191 CGGGGCCGGGGCCGGGGCGCGGG + Intronic
1061347938 9:130042448-130042470 CGGGGCGAGCGCCGGGGGTCGGG - Intronic
1061450892 9:130666517-130666539 CAGGACCGAAGCCGGGGTCCCGG + Intronic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061559649 9:131394270-131394292 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1061559652 9:131394276-131394298 CGGGGCCGGGGCCGGGGCGTGGG + Intronic
1061559676 9:131394349-131394371 CGCGGCCGCCGCCGGGGGCCCGG + Intronic
1061680955 9:132242169-132242191 CGGGGCCGGCGTCCGAGGCCGGG + Exonic
1061987155 9:134136353-134136375 AGGGGCCGGGGCGGGGGTCCCGG - Intronic
1062022658 9:134326681-134326703 CGGGGACGGGGCCGGGGGCCGGG + Intronic
1062023002 9:134327833-134327855 CGGGGCAGGCGGTGGGTTCCAGG + Intronic
1062280861 9:135751054-135751076 CGCGGCCGGGCGCGGGGTCCCGG + Intronic
1062327515 9:136019307-136019329 CGGGGCCAGAGCTGGGTTCCAGG + Intronic
1062341451 9:136095418-136095440 CGGGGTCGGGGCTGGGGTCCGGG + Intergenic
1062346727 9:136118497-136118519 CCGCGGCGGCGCCGGCGTCCCGG + Exonic
1062362282 9:136193654-136193676 CGGGGGCGGCCACGGGCTCCGGG + Intergenic
1062389344 9:136327775-136327797 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1062499521 9:136846276-136846298 CGGCGCCAGCGCGGGGGCCCCGG - Exonic
1062595186 9:137296085-137296107 GGGGGCTGGGGCCGGGGTGCGGG - Intergenic
1062596353 9:137301548-137301570 CGGGCGCAGGGCCGGGGTCCGGG + Exonic
1062653509 9:137590354-137590376 CGGGACCGGAGCCGGGGTCGGGG + Exonic
1185621484 X:1453405-1453427 CGGGGGCGGGGACGGGGCCCGGG - Intronic
1185621490 X:1453417-1453439 CGGGGCGAGCGCCGGGGGCGGGG - Intronic
1185747472 X:2584230-2584252 CGGGGCCGGCGCGGGGCTCCGGG - Intergenic
1186463350 X:9765626-9765648 CGGGGACGTCGCGGGGGACCCGG + Exonic
1186466239 X:9786354-9786376 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1186466243 X:9786360-9786382 CGGGGCCGGGGCCGGGGCCGGGG - Intergenic
1187419544 X:19122528-19122550 CGGGGGCGGCGCCGAGGCCGCGG - Exonic
1189429716 X:40935718-40935740 CGGGGCCGGGGCCGAGGCCGCGG - Intergenic
1189915298 X:45850858-45850880 CGGGGCCGGCGCTTGCGTCAGGG - Intergenic
1190385623 X:49879942-49879964 CGGGGCGGGGGCCGGGGCCTAGG - Exonic
1190385625 X:49879948-49879970 CGGGGCCGGGGCGGGGGCCGGGG - Exonic
1190385629 X:49879954-49879976 CGGGGCCGGGGCCGGGGCGGGGG - Exonic
1190783977 X:53625834-53625856 CGGGGCCGGGGCCGGGGCCAGGG + Intronic
1190783981 X:53625840-53625862 CGGGGCCGGGGCCAGGGCCGGGG + Intronic
1190783985 X:53625846-53625868 CGGGGCCAGGGCCGGGGCCGGGG + Intronic
1190783989 X:53625852-53625874 CAGGGCCGGGGCCGGGGCCGGGG + Intronic
1190783993 X:53625858-53625880 CGGGGCCGGGGCCGGGGCCGGGG + Intronic
1190783996 X:53625864-53625886 CGGGGCCGGGGCCGGGGCCAGGG + Intronic
1191251870 X:58263699-58263721 CGGGCCCAGCGCCGGGCTGCAGG - Intergenic
1192152003 X:68718365-68718387 CGGGGCCGGGGCTGGGGCCGGGG - Exonic
1195599207 X:106726915-106726937 TGGGGCCGCCGCCTGGGGCCGGG + Exonic
1196819717 X:119693032-119693054 CAGGGCCGGGGCCGAGGGCCTGG - Intronic
1198254830 X:134915363-134915385 CGGGGCCGGAGCCTGGGGCGGGG + Intergenic
1198815063 X:140580688-140580710 AGGGGCCTGGGCCGGGGTGCAGG + Intergenic
1200209645 X:154341585-154341607 AGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209649 X:154341591-154341613 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209653 X:154341597-154341619 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200209657 X:154341603-154341625 CGGGGCCGGGGCCGGGGCCGGGG + Intergenic
1200218360 X:154378722-154378744 CGGGGCCCGCGCGGGAGTCAGGG - Intergenic
1200218387 X:154378829-154378851 CGGGGCCCGCGCGGGAGTCAGGG - Intergenic
1200221195 X:154390489-154390511 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221199 X:154390495-154390517 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221203 X:154390501-154390523 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221207 X:154390507-154390529 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221211 X:154390513-154390535 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221215 X:154390519-154390541 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221219 X:154390525-154390547 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221223 X:154390531-154390553 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221227 X:154390537-154390559 CGGGGCCGGGGCCGGGGCCGGGG - Intronic
1200221231 X:154390543-154390565 AGGGGCCGGGGCCGGGGCCGGGG - Intronic