ID: 984782875

View in Genome Browser
Species Human (GRCh38)
Location 4:183541839-183541861
Sequence CTGTGCAAGGGGAATGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984782875_984782889 21 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782889 4:183541883-183541905 ATCCACTGGCTCCTCAGGGAGGG No data
984782875_984782887 17 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782875_984782884 7 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782884 4:183541869-183541891 GCGCCAGAAGGAGAATCCACTGG No data
984782875_984782891 24 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782891 4:183541886-183541908 CACTGGCTCCTCAGGGAGGGTGG No data
984782875_984782879 -5 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782879 4:183541857-183541879 CACAGCCCCCGAGCGCCAGAAGG No data
984782875_984782886 16 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782886 4:183541878-183541900 GGAGAATCCACTGGCTCCTCAGG No data
984782875_984782888 20 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782888 4:183541882-183541904 AATCCACTGGCTCCTCAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984782875 Original CRISPR CTGTGCAAGGGGAATGCAGA AGG (reversed) Intergenic
No off target data available for this crispr