ID: 984782879

View in Genome Browser
Species Human (GRCh38)
Location 4:183541857-183541879
Sequence CACAGCCCCCGAGCGCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984782875_984782879 -5 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782879 4:183541857-183541879 CACAGCCCCCGAGCGCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984782879 Original CRISPR CACAGCCCCCGAGCGCCAGA AGG Intergenic
No off target data available for this crispr