ID: 984782884

View in Genome Browser
Species Human (GRCh38)
Location 4:183541869-183541891
Sequence GCGCCAGAAGGAGAATCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984782878_984782884 -6 Left 984782878 4:183541852-183541874 CCTTGCACAGCCCCCGAGCGCCA No data
Right 984782884 4:183541869-183541891 GCGCCAGAAGGAGAATCCACTGG No data
984782877_984782884 -5 Left 984782877 4:183541851-183541873 CCCTTGCACAGCCCCCGAGCGCC No data
Right 984782884 4:183541869-183541891 GCGCCAGAAGGAGAATCCACTGG No data
984782875_984782884 7 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782884 4:183541869-183541891 GCGCCAGAAGGAGAATCCACTGG No data
984782876_984782884 -4 Left 984782876 4:183541850-183541872 CCCCTTGCACAGCCCCCGAGCGC No data
Right 984782884 4:183541869-183541891 GCGCCAGAAGGAGAATCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984782884 Original CRISPR GCGCCAGAAGGAGAATCCAC TGG Intergenic
No off target data available for this crispr