ID: 984782887

View in Genome Browser
Species Human (GRCh38)
Location 4:183541879-183541901
Sequence GAGAATCCACTGGCTCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984782883_984782887 -9 Left 984782883 4:183541865-183541887 CCGAGCGCCAGAAGGAGAATCCA No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782880_984782887 -6 Left 984782880 4:183541862-183541884 CCCCCGAGCGCCAGAAGGAGAAT No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782875_984782887 17 Left 984782875 4:183541839-183541861 CCTTCTGCATTCCCCTTGCACAG No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782882_984782887 -8 Left 984782882 4:183541864-183541886 CCCGAGCGCCAGAAGGAGAATCC No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782881_984782887 -7 Left 984782881 4:183541863-183541885 CCCCGAGCGCCAGAAGGAGAATC No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782877_984782887 5 Left 984782877 4:183541851-183541873 CCCTTGCACAGCCCCCGAGCGCC No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782876_984782887 6 Left 984782876 4:183541850-183541872 CCCCTTGCACAGCCCCCGAGCGC No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data
984782878_984782887 4 Left 984782878 4:183541852-183541874 CCTTGCACAGCCCCCGAGCGCCA No data
Right 984782887 4:183541879-183541901 GAGAATCCACTGGCTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984782887 Original CRISPR GAGAATCCACTGGCTCCTCA GGG Intergenic
No off target data available for this crispr