ID: 984785813

View in Genome Browser
Species Human (GRCh38)
Location 4:183566348-183566370
Sequence GGTGGCCCTAGGCAGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984785808_984785813 21 Left 984785808 4:183566304-183566326 CCGGCATGGGCAGAGAGGCAGGT No data
Right 984785813 4:183566348-183566370 GGTGGCCCTAGGCAGAAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984785813 Original CRISPR GGTGGCCCTAGGCAGAAACA GGG Intergenic