ID: 984803722

View in Genome Browser
Species Human (GRCh38)
Location 4:183735806-183735828
Sequence CCGCCCAGTCCCGGAGCGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984803722_984803741 23 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803741 4:183735852-183735874 CCCCCCCCTCCCCCCGGCCCGGG No data
984803722_984803743 24 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803743 4:183735853-183735875 CCCCCCCTCCCCCCGGCCCGGGG No data
984803722_984803739 22 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803739 4:183735851-183735873 CCCCCCCCCTCCCCCCGGCCCGG No data
984803722_984803736 17 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803736 4:183735846-183735868 CTGACCCCCCCCCCTCCCCCCGG No data
984803722_984803732 -8 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803732 4:183735821-183735843 CTGGGCGGGTGGGCCGGCGGGGG No data
984803722_984803730 -10 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803730 4:183735819-183735841 GACTGGGCGGGTGGGCCGGCGGG No data
984803722_984803733 -7 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803733 4:183735822-183735844 TGGGCGGGTGGGCCGGCGGGGGG No data
984803722_984803734 -6 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803734 4:183735823-183735845 GGGCGGGTGGGCCGGCGGGGGGG No data
984803722_984803747 27 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803747 4:183735856-183735878 CCCCTCCCCCCGGCCCGGGGCGG No data
984803722_984803731 -9 Left 984803722 4:183735806-183735828 CCGCTCGCTCCGGGACTGGGCGG No data
Right 984803731 4:183735820-183735842 ACTGGGCGGGTGGGCCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984803722 Original CRISPR CCGCCCAGTCCCGGAGCGAG CGG (reversed) Intergenic
No off target data available for this crispr