ID: 984808645

View in Genome Browser
Species Human (GRCh38)
Location 4:183774208-183774230
Sequence CCTCACAAGAGGCAGTAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984808637_984808645 4 Left 984808637 4:183774181-183774203 CCCACAGCCAACGTCCATCTTTC No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data
984808638_984808645 3 Left 984808638 4:183774182-183774204 CCACAGCCAACGTCCATCTTTCC No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data
984808635_984808645 12 Left 984808635 4:183774173-183774195 CCCTGAATCCCACAGCCAACGTC No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data
984808640_984808645 -10 Left 984808640 4:183774195-183774217 CCATCTTTCCCAGCCTCACAAGA No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data
984808636_984808645 11 Left 984808636 4:183774174-183774196 CCTGAATCCCACAGCCAACGTCC No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data
984808639_984808645 -3 Left 984808639 4:183774188-183774210 CCAACGTCCATCTTTCCCAGCCT No data
Right 984808645 4:183774208-183774230 CCTCACAAGAGGCAGTAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984808645 Original CRISPR CCTCACAAGAGGCAGTAGTC AGG Intergenic
No off target data available for this crispr