ID: 984811449

View in Genome Browser
Species Human (GRCh38)
Location 4:183798525-183798547
Sequence TCCCCCGCAGTCGCCGCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984811449_984811454 -5 Left 984811449 4:183798525-183798547 CCCTGGGCGGCGACTGCGGGGGA No data
Right 984811454 4:183798543-183798565 GGGGACGCGCCGGGAAGCTAGGG No data
984811449_984811455 1 Left 984811449 4:183798525-183798547 CCCTGGGCGGCGACTGCGGGGGA No data
Right 984811455 4:183798549-183798571 GCGCCGGGAAGCTAGGGTTGAGG No data
984811449_984811453 -6 Left 984811449 4:183798525-183798547 CCCTGGGCGGCGACTGCGGGGGA No data
Right 984811453 4:183798542-183798564 GGGGGACGCGCCGGGAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984811449 Original CRISPR TCCCCCGCAGTCGCCGCCCA GGG (reversed) Intergenic