ID: 984812697

View in Genome Browser
Species Human (GRCh38)
Location 4:183808505-183808527
Sequence TTTGTTACAAATTAATAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984812697_984812698 -9 Left 984812697 4:183808505-183808527 CCTGGTTATTAATTTGTAACAAA No data
Right 984812698 4:183808519-183808541 TGTAACAAAAAGTTTGTCCAAGG No data
984812697_984812700 21 Left 984812697 4:183808505-183808527 CCTGGTTATTAATTTGTAACAAA No data
Right 984812700 4:183808549-183808571 TTAATCGTTAGTAGACTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984812697 Original CRISPR TTTGTTACAAATTAATAACC AGG (reversed) Intergenic
No off target data available for this crispr