ID: 984813413

View in Genome Browser
Species Human (GRCh38)
Location 4:183816146-183816168
Sequence GTGAAGAGTAAGAGGAATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984813410_984813413 20 Left 984813410 4:183816103-183816125 CCAGCGATTTCATGAGTGATTCA No data
Right 984813413 4:183816146-183816168 GTGAAGAGTAAGAGGAATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984813413 Original CRISPR GTGAAGAGTAAGAGGAATAT TGG Intergenic
No off target data available for this crispr