ID: 984820194

View in Genome Browser
Species Human (GRCh38)
Location 4:183875336-183875358
Sequence GGGTTTTAGAAGATGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984820179_984820194 25 Left 984820179 4:183875288-183875310 CCGCTTCCTCAAGGCTTTCATGG 0: 1
1: 0
2: 1
3: 25
4: 329
Right 984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG No data
984820182_984820194 19 Left 984820182 4:183875294-183875316 CCTCAAGGCTTTCATGGTAGGTG 0: 1
1: 0
2: 0
3: 9
4: 105
Right 984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG No data
984820178_984820194 28 Left 984820178 4:183875285-183875307 CCTCCGCTTCCTCAAGGCTTTCA 0: 1
1: 0
2: 1
3: 13
4: 156
Right 984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG No data
984820177_984820194 29 Left 984820177 4:183875284-183875306 CCCTCCGCTTCCTCAAGGCTTTC 0: 1
1: 0
2: 1
3: 15
4: 263
Right 984820194 4:183875336-183875358 GGGTTTTAGAAGATGGGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984820194 Original CRISPR GGGTTTTAGAAGATGGGGCA GGG Intronic
No off target data available for this crispr