ID: 984821445

View in Genome Browser
Species Human (GRCh38)
Location 4:183886098-183886120
Sequence AGGCAGATGCAAAATCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 409
Summary {0: 1, 1: 5, 2: 2, 3: 36, 4: 365}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984821441_984821445 -2 Left 984821441 4:183886077-183886099 CCGATGGTTGCTGGATGGTGTAG 0: 2
1: 0
2: 0
3: 5
4: 88
Right 984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG 0: 1
1: 5
2: 2
3: 36
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984821445 Original CRISPR AGGCAGATGCAAAATCAGGA GGG Intronic
901560586 1:10067126-10067148 AGGCAGAAGCTAAGACAGGATGG - Intronic
902175290 1:14645524-14645546 AGGCAAGAGCCAAATCAGGAAGG - Intronic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903025854 1:20429491-20429513 GGGCAGATGCAAAGCCAGGGTGG - Intergenic
903680757 1:25095190-25095212 AGGCAGAAGGAACAACAGGAAGG + Intergenic
903920484 1:26796624-26796646 GGGCATATGCAAAAACACGAGGG + Intronic
905471181 1:38193267-38193289 AGGCAGAGGGAACAGCAGGAAGG + Intergenic
905522889 1:38613920-38613942 AGGCAGAAGCAAGGTCAGTAGGG - Intergenic
905602556 1:39266503-39266525 AGGCAGATGGGACATCAGGAGGG + Intronic
906948420 1:50315398-50315420 AGGCACTTGCACAATCTGGAGGG - Intergenic
906956233 1:50377158-50377180 AGGCAGAGGCAGAATTATGAAGG + Intergenic
907186585 1:52614284-52614306 AGGCAGATGCCAGATCATGCAGG + Intergenic
907263724 1:53241256-53241278 GGGCAGAAGCCAAATCATGAAGG + Intergenic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
907472564 1:54683500-54683522 GGGCAGGAGCAGAATCAGGAAGG - Intronic
909872788 1:80764306-80764328 ATGCAGAGGCCAAATCAGAAAGG - Intergenic
909891282 1:81010272-81010294 AGGAAGATGGAAAATCACCAAGG + Intergenic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
910656126 1:89620479-89620501 AGACACATGCAAAATCAGGGAGG + Intergenic
911669981 1:100597036-100597058 AGGCAGATGCAAAAGCAAAAAGG - Intergenic
913691282 1:121282183-121282205 AGGCACCTGCAAAATCAGGCTGG + Intronic
914146261 1:144997798-144997820 AGGCACCTGCAAAATCAGGCTGG - Intronic
915224389 1:154401896-154401918 AGGCTGATGAGAAAGCAGGAGGG + Intergenic
916234501 1:162573154-162573176 AGGCACATACAAACTCAGAATGG + Intronic
916479387 1:165201501-165201523 AGGCAGATGCCTAGCCAGGATGG - Intergenic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
920095412 1:203483421-203483443 GGGCAGATGGGAAATCAGGGGGG - Exonic
920458259 1:206117134-206117156 AGGAAGATGGGGAATCAGGACGG + Exonic
920478606 1:206300659-206300681 AGGCACCTGCAAAATCAGGCTGG + Intronic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
922956491 1:229605833-229605855 TGGCACATTCAAAATCAGGGCGG - Intronic
924083621 1:240425265-240425287 AGGCAGATGAAAAACAAGTATGG + Intronic
924593568 1:245426227-245426249 GAGCAGATGGAAAAACAGGAAGG - Intronic
924623891 1:245684927-245684949 AGGCAGAGGCCAAGCCAGGATGG + Intronic
1063362473 10:5469535-5469557 AGTCAGAAGCAAACACAGGAAGG + Intergenic
1063866946 10:10374912-10374934 ATGGAGATGGAAAAGCAGGAAGG + Intergenic
1064940378 10:20727881-20727903 AGGCATCTGCAAACACAGGAGGG - Intergenic
1065261589 10:23929082-23929104 ATGCAGAGGCCAAATCAGGTAGG + Intronic
1065857967 10:29845703-29845725 AGTCTGGTGAAAAATCAGGAAGG + Intergenic
1067181214 10:43987266-43987288 AGGCAGTTGCACACCCAGGAGGG + Intergenic
1067813869 10:49456056-49456078 AGTTAGTTGCAAAATAAGGATGG + Exonic
1067940407 10:50650445-50650467 AGCCAGATGCAAAAGCAGAGGGG + Intergenic
1068345877 10:55777052-55777074 AGGCTAATGCAGAAGCAGGAAGG + Intergenic
1069836463 10:71311620-71311642 AGGAAGAAGCAAATGCAGGAAGG + Intergenic
1069906316 10:71734629-71734651 AGGCAGAGGCAGCAGCAGGAGGG - Intronic
1069972548 10:72184700-72184722 AAGTAGATACAAAATCAGTATGG + Intronic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1072034410 10:91551323-91551345 AGGCAGATGATTATTCAGGATGG - Intergenic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073633518 10:105173696-105173718 AGGCAGAAGTCAAATCATGAAGG - Intronic
1074339956 10:112618814-112618836 AGGGAGATGCAAAAACACAATGG + Intronic
1075256112 10:120926965-120926987 AGGCAGAGGGAAACTCAGGGAGG + Intergenic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1076330379 10:129660135-129660157 AGGGAGATGAAAAATCAGAATGG - Intronic
1076597248 10:131631718-131631740 AAGCAGAAGGAAAACCAGGAAGG - Intergenic
1077112019 11:866109-866131 AGGCCGGGGCAAAAGCAGGAGGG + Intronic
1077436943 11:2546498-2546520 AAGTAGATACAAAATCAGTAAGG - Intronic
1078423751 11:11233069-11233091 AGGAGGAGGCAAACTCAGGAAGG + Intergenic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1078947387 11:16084860-16084882 AGGTAGATCTAAAATCAGGAGGG + Intronic
1079780912 11:24603245-24603267 AGTCAGATGCAACGGCAGGATGG - Intronic
1080379778 11:31756324-31756346 AGGCAGAGGCAGAATCTGTAGGG - Intronic
1080452189 11:32387008-32387030 AGCCAGATGCAAAATAAGAGGGG + Intergenic
1080755295 11:35191417-35191439 AAGCCGATGCAAACTCAAGAGGG - Intronic
1081217208 11:40416339-40416361 AGGCAGATGAGAAAGCAGTAGGG + Intronic
1081548979 11:44095112-44095134 ATGCATATGCAAAAACAAGAGGG - Intergenic
1082110046 11:48264333-48264355 CGGGAGCTGGAAAATCAGGAAGG - Exonic
1082234540 11:49807781-49807803 AAGCAGATGCAAAAACAAAAAGG - Intergenic
1083612087 11:64009187-64009209 AGGCAGGTCCTAAATCAGGATGG - Intronic
1084919376 11:72456977-72456999 TGGCAGATGCAGAATCTTGATGG - Intergenic
1085632688 11:78132383-78132405 AGGCAGAAGGAGAGTCAGGAAGG - Intronic
1087347056 11:96984775-96984797 AGACAGATGGACAGTCAGGAAGG + Intergenic
1087552589 11:99670582-99670604 AGGCAAAGCCTAAATCAGGAAGG - Intronic
1088060644 11:105645101-105645123 ATGCAGCTTCATAATCAGGAAGG + Intronic
1088360596 11:108985071-108985093 GGCCAGATGCAAAATGAGGTAGG + Intergenic
1089479989 11:118796840-118796862 AGGCAGATGAAAAGCAAGGAGGG - Intergenic
1090830329 11:130416543-130416565 AGCTAGATCCAAATTCAGGACGG - Intronic
1091254279 11:134170113-134170135 AGGTAGATGAGAAATCATGATGG + Intronic
1091287169 11:134413855-134413877 GGGCAGGTGCAGAAGCAGGATGG + Intergenic
1091733022 12:2895139-2895161 TGGTACTTGCAAAATCAGGAGGG + Intronic
1091951448 12:4596355-4596377 AGGGAGAGGCACAGTCAGGAAGG - Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1095203691 12:39415178-39415200 AGTTAAATTCAAAATCAGGACGG + Intronic
1095961362 12:47836226-47836248 TGGAAGATGCAAGAGCAGGAGGG + Intergenic
1096390340 12:51223861-51223883 AGGCAGACACCAAATCAGGTAGG + Intergenic
1097247330 12:57613790-57613812 GGGCAGATGGAAAAGCAGGCAGG - Intronic
1098568819 12:71966168-71966190 AGGCATCTGAAAAATCAAGAAGG + Intronic
1099556330 12:84112242-84112264 AGAAAGCTGCAGAATCAGGAAGG - Intergenic
1099726042 12:86429510-86429532 ACCCAGATGGAAAATCAGTAAGG - Intronic
1099934106 12:89105083-89105105 ATGTAAATGCAAAATCAAGAAGG + Intergenic
1101201198 12:102438190-102438212 AAGCTGAGGCAAAGTCAGGAAGG + Intronic
1101299874 12:103468206-103468228 AAGCAGGCTCAAAATCAGGAAGG - Intronic
1102752482 12:115307667-115307689 AGGCAGGGCCAAAATCTGGAAGG - Intergenic
1104258737 12:127163356-127163378 AGGTAGCTGCAAAAAAAGGAAGG + Intergenic
1104285058 12:127417657-127417679 AAGCAGAAGGAAAGTCAGGAAGG - Intergenic
1104418761 12:128617595-128617617 GGGCAGATGCAGAGTCAGGTGGG + Intronic
1104427484 12:128690032-128690054 AGGCAGGTGCAGACTCAGGAAGG + Intronic
1104439777 12:128785327-128785349 AGGCAGTGGGCAAATCAGGAGGG + Intergenic
1105972028 13:25438143-25438165 GGGCAGATGAGAAATGAGGAAGG + Intronic
1106791122 13:33155542-33155564 AAGAAGATACAAAATCAGGGAGG - Intronic
1106859768 13:33893137-33893159 AGGGAGATGCCAAATCAGAGTGG + Intronic
1107283741 13:38765833-38765855 AGGCTCATGCAAAATGAAGATGG - Intronic
1107372169 13:39764903-39764925 ATGCAGATTAAAAATCAGAAAGG - Intronic
1107423976 13:40275001-40275023 AGGCAGATGGCCTATCAGGAAGG - Intergenic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1108485041 13:50915331-50915353 AGGCAGACACAAAGTCAAGACGG - Intronic
1109041230 13:57339844-57339866 AGGCAGGTACAATAACAGGAAGG + Intergenic
1110602034 13:77386477-77386499 AGGCAGAGGTCAAATCTGGAGGG + Intergenic
1110761326 13:79233723-79233745 AGGCAGTTGCAGGACCAGGAAGG - Intergenic
1110784068 13:79502553-79502575 AGATAGAGGGAAAATCAGGAGGG + Intronic
1112078428 13:95938285-95938307 AGGCAGAGGCCAGATCATGAAGG + Intronic
1112439498 13:99415785-99415807 AGGCCCCTGAAAAATCAGGAAGG - Intergenic
1112663107 13:101536679-101536701 AGGCAGATTAAAAATCCTGAGGG - Intronic
1112882583 13:104125471-104125493 AGGCAGGCACAAATTCAGGAAGG - Intergenic
1113271494 13:108679579-108679601 AACCAGATGCAAAATTATGATGG - Intronic
1113702763 13:112399430-112399452 AGGCAGATGCCAAGACAGGGAGG + Intronic
1114457637 14:22866948-22866970 AGGCAGATGCAAAAGGAAGCAGG - Intergenic
1114852436 14:26397148-26397170 TGGCAGATACAAGATCAGGTGGG - Intergenic
1115919918 14:38361069-38361091 AGGCAGAAGGAAAATAATGAGGG + Intergenic
1117313159 14:54548493-54548515 AAACAGAGGCAAAATCAGGAAGG - Intergenic
1117587341 14:57223662-57223684 AGGCAGATGGAAAATTGGTAAGG + Intronic
1117897965 14:60507449-60507471 AGGCAGGGGCAAAATAAAGAGGG - Intronic
1118294329 14:64554951-64554973 AGGCAAGTGCAAAATTAGGGTGG + Intronic
1118547347 14:66906208-66906230 AAGGAGATGCTAAATCATGATGG - Intronic
1119133171 14:72193292-72193314 AGGCAGAAGTAAAACCAGCAGGG - Intronic
1120789015 14:88562527-88562549 AGGCAGAACCAAACCCAGGAGGG + Intergenic
1121891572 14:97597297-97597319 ATGCATATGCAAATTCAGCAAGG + Intergenic
1122206091 14:100148755-100148777 AGGCTGAAGCAAATTCAGGGAGG - Intronic
1122776703 14:104120046-104120068 AGGCAGATGCAACTTCTGGGTGG + Intergenic
1124867692 15:33509378-33509400 AGTGAGATGCTAAATCTGGATGG - Intronic
1125938621 15:43659054-43659076 AACCACATGCATAATCAGGAAGG + Intronic
1127049943 15:55071196-55071218 AAGCAGATAGAAAATCAGCAAGG + Intergenic
1127843122 15:62847289-62847311 AGGCATTTGGAAAAGCAGGAAGG + Intergenic
1128254299 15:66185682-66185704 AGGCAGCAGCGACATCAGGATGG + Intronic
1128824723 15:70703143-70703165 AGGCCGGTGCAAATTCAGGGTGG + Intronic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1130678486 15:85975297-85975319 AGGGAGAGACAAAATCAGAATGG - Intergenic
1131965173 15:97834610-97834632 AGGCAGTTACCAGATCAGGAGGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132413406 15:101603003-101603025 GGGCAGGTGCCAAATCAGGCTGG + Intergenic
1132624411 16:883931-883953 AGGTAGATAGAAAATAAGGAAGG - Intronic
1133564982 16:6984967-6984989 AGGAAAGTGAAAAATCAGGAGGG + Intronic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1135172002 16:20192872-20192894 AGACAGAGGCAAACACAGGATGG - Intergenic
1136380827 16:29894594-29894616 AGACAGATGAGTAATCAGGATGG - Intronic
1136541414 16:30929502-30929524 AGGCAGTTCCAAAAGCAGTAGGG - Intronic
1138479056 16:57289765-57289787 AGGCAGATTCTAAAACAGTAGGG + Intergenic
1138894334 16:61184698-61184720 AGGCTAAAGCAAAATCATGAGGG + Intergenic
1140119240 16:72069135-72069157 AAGCACTTGCAAAACCAGGAAGG + Intronic
1140799899 16:78476866-78476888 AAGAAGATGGGAAATCAGGAAGG - Intronic
1144133547 17:12270903-12270925 GAGCAAATGCAAAATTAGGAAGG - Intergenic
1145901974 17:28495429-28495451 GGGCAGATGAGAAATTAGGAGGG - Intronic
1146111113 17:30090285-30090307 AGGCAGATGAAACAGCAAGAAGG + Intronic
1147005756 17:37402429-37402451 AGGAAGATGCTAGATCTGGAAGG + Intronic
1147251621 17:39155884-39155906 GGGCAGAGGCAAAAACTGGAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148690457 17:49524124-49524146 AAGCAGATGCAAACTCAGAGAGG + Intergenic
1148896462 17:50841949-50841971 AGGAAGATGAAAAAGCAGGCAGG + Exonic
1149480820 17:57001766-57001788 ATGCAGAGGCAAAATCAGTCAGG + Intronic
1150995900 17:70317152-70317174 TGGAAGATGCAAAATGAGGTTGG - Intergenic
1151437972 17:74109913-74109935 TAGCAGATGAAAATTCAGGATGG + Intergenic
1151557776 17:74855158-74855180 AGGCAGATGGACAGACAGGAGGG + Intronic
1152480967 17:80552276-80552298 AGGCAGAGGCCAAATCATGAAGG - Intronic
1154269379 18:12906285-12906307 AGGCAGCTGCAGAGACAGGAAGG - Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155565173 18:27126638-27126660 AGGCAGAGGCCACATCATGAAGG + Intronic
1156134265 18:34017771-34017793 ACGCAGAAGAAAAATCAGAAGGG - Intronic
1156966597 18:43102059-43102081 AGGAAGCTGTAAAATCAAGAAGG - Intronic
1157238582 18:45987588-45987610 AGACAAATTCAAAAACAGGAAGG + Intronic
1157506392 18:48229778-48229800 AGGGAGATGGACAGTCAGGAAGG - Intronic
1157603517 18:48910822-48910844 AGGCAGAAGCCAATTCAGAAAGG + Intergenic
1158866887 18:61646525-61646547 AGGCAGAAGAAACAGCAGGAGGG + Intergenic
1159391465 18:67798108-67798130 TGGTAGATGCAAACACAGGATGG - Intergenic
1160380143 18:78448373-78448395 AGGAAGATGGAAAGGCAGGAGGG - Intergenic
1162670519 19:12253672-12253694 AGGCAGAAAAAAAAACAGGAAGG + Intronic
1164559915 19:29283635-29283657 AGGCAGAGGGAATATCAGCAGGG + Intergenic
1166246895 19:41535328-41535350 AGGCAGAAGAAATATCAGCAGGG + Intergenic
1166524290 19:43501567-43501589 AGGGAGAAGGAAAACCAGGAGGG + Intronic
1167419689 19:49395591-49395613 GGCCAGATGGAAAAGCAGGAGGG - Intronic
925549607 2:5057834-5057856 AGACAGAAGCTAAATGAGGAAGG - Intergenic
925866700 2:8234485-8234507 GGGCAGGTGCAAAAGCAGAAGGG - Intergenic
926386674 2:12342225-12342247 AGGCAGAGGCAAAATCTTGGAGG - Intergenic
926400258 2:12489411-12489433 TGGCAGATGCACAAGCAGGTAGG - Intergenic
927637556 2:24827292-24827314 AGGCAGCAGGAAAATGAGGAGGG - Intronic
929120465 2:38480111-38480133 AGACACATCCAAAAGCAGGAGGG + Intergenic
931231119 2:60375704-60375726 ATGCAGATGTAAAATCTGAAAGG - Intergenic
931233696 2:60395597-60395619 AGCCAGATGCAAAATCTGAAAGG + Intergenic
932194592 2:69772403-69772425 AGGCAGGTGGAAAATGAGGTGGG + Intronic
933677187 2:85067211-85067233 AGGCAGAAGCAAGCTCAGGGAGG - Intergenic
935191421 2:100781721-100781743 AGGCTGATGCAGCATCAGGCTGG - Intergenic
935875330 2:107500054-107500076 AGACACATGGAACATCAGGAAGG - Intergenic
936980818 2:118263599-118263621 AGGCAGCTGCAAGTTAAGGAAGG + Intergenic
937114319 2:119393648-119393670 AGGCAGAGGCAGAACCTGGAAGG - Intergenic
938930718 2:136084295-136084317 AGGCAGAGGCGAACTCAGGCAGG - Intergenic
938991736 2:136636591-136636613 AGGCTGAGGCTAAATCAGGTAGG - Intergenic
939098008 2:137858009-137858031 ACGCAGATGAAAATGCAGGAGGG - Intergenic
939850222 2:147295556-147295578 AGGTAGATGCAAAATCTGGATGG - Intergenic
940101648 2:150046834-150046856 ATGCAGATGGAAAATCAGGGTGG + Intergenic
940118643 2:150238511-150238533 AGGCAGAGGCAAAGGCTGGATGG + Intergenic
940846847 2:158651317-158651339 AGCCAGATGCAAACTGAGGGTGG - Intronic
941014584 2:160340581-160340603 AGGCAGGTGCAAATTCAAGTAGG + Intronic
941413347 2:165187745-165187767 AGGCAGAGGCCAGATCATGAAGG - Intronic
942222454 2:173783940-173783962 AGGCAGATGCATTCACAGGAGGG + Intergenic
943848907 2:192690488-192690510 AGGCAGATGCAGAAATAGAATGG - Intergenic
945869854 2:215215293-215215315 AGGGAGAGGGAAAATCAGGGTGG + Intergenic
946734031 2:222736516-222736538 TGGCAGATGCTAAAACTGGAAGG - Intergenic
946860684 2:223997772-223997794 AGGCAGATGCAAAAGCAGGAAGG + Intronic
947220284 2:227785173-227785195 AGTTAGTTGCAAAATCAAGAGGG - Intergenic
948356864 2:237384983-237385005 AGGCAGAAGGAAGAGCAGGAGGG - Intronic
1170139003 20:13106583-13106605 AGGCAGAGGCTATATCAGGAAGG + Intronic
1170185341 20:13583257-13583279 AGGCAGAGGCAAGCTCAGGCTGG - Intronic
1170956237 20:20982392-20982414 ACTCAGATGCATAATTAGGATGG - Intergenic
1172871569 20:38138829-38138851 AGGCAAATGGAATATAAGGAAGG - Intronic
1173115865 20:40242056-40242078 AGGAAGTTGGAAAAACAGGAAGG + Intergenic
1173544669 20:43885873-43885895 AGGCAAAGGCAGAATCAGGGAGG - Intergenic
1173696322 20:45017476-45017498 AGGCAGGTGCAAAGTCAGAAAGG + Intronic
1173878604 20:46393498-46393520 AGGGAGAGGCAAAATCAATATGG - Intronic
1173881554 20:46416868-46416890 AACCATATGGAAAATCAGGAAGG + Intronic
1174758169 20:53180524-53180546 AGACTGAACCAAAATCAGGAAGG - Intronic
1175086513 20:56463995-56464017 AGGGAGATGAAAAACCAGGCAGG + Intergenic
1175709930 20:61211366-61211388 AGGCAGATGAAATAACAGGAGGG - Intergenic
1177460791 21:21407058-21407080 AGTCATTTTCAAAATCAGGAAGG - Intronic
1177742328 21:25169062-25169084 AGGCAGATTCAAAATCCATAGGG + Intergenic
1179329398 21:40384234-40384256 AGGCAGAGGTGAAATCGGGATGG + Intronic
1180013596 21:45068288-45068310 AATCAGATGCAAAAACAGTATGG - Intergenic
1181928883 22:26383256-26383278 AAGCATCTGCATAATCAGGAGGG + Intronic
1182306833 22:29375644-29375666 AGGCTGATGCAATGTCAAGATGG + Intronic
1182892566 22:33831326-33831348 ACGCACATGCAAGATCAGAAGGG - Intronic
1183285640 22:36961037-36961059 TGGAATATGCAACATCAGGAAGG + Intergenic
1184474079 22:44711325-44711347 AGGCAGAGGGAACAGCAGGATGG + Intronic
949421742 3:3873190-3873212 AGGCAGGTGGAAAATCAAGAGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950277326 3:11673711-11673733 CAGCAGATACAAAATCAGAATGG + Intronic
950392812 3:12710032-12710054 GGGCAGTGGCAAAATTAGGAAGG - Intergenic
951145451 3:19221043-19221065 TGGCAGAAGGAAAATCAGAATGG - Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
954223430 3:49168051-49168073 GGGCAAATGGAAAACCAGGAAGG + Intergenic
959933928 3:112010857-112010879 AGGCAGATGGAAAGTGAGAATGG - Intronic
961375887 3:126465527-126465549 AGGCAGACGGAAACACAGGAGGG + Intronic
962916949 3:139912815-139912837 AGGAAGATGGGATATCAGGAGGG - Intergenic
963002541 3:140695690-140695712 AGGAAGAGGAAAAATCAGGAAGG - Intronic
963698481 3:148593149-148593171 AAGCAGATGGAAAATCAATAAGG + Intergenic
963873096 3:150441386-150441408 AGGTAGAAGGAAAAACAGGAGGG - Intronic
964929640 3:162001622-162001644 AGGCACATGAAAAAATAGGAAGG - Intergenic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966538640 3:181064022-181064044 ATGCAGATGGAATTTCAGGAGGG - Intergenic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
969956328 4:10895000-10895022 AGGGAGATGGAGAATAAGGAAGG + Intergenic
970888098 4:21009852-21009874 TGGCACAGACAAAATCAGGACGG - Intronic
971238487 4:24865718-24865740 TGGCAGATGCAGAATCATAATGG - Intronic
971353620 4:25874504-25874526 AAGCAGAAGGAAAATAAGGAGGG + Intronic
972147039 4:36040621-36040643 AGCCAAGAGCAAAATCAGGAAGG - Intronic
973875838 4:55217555-55217577 ACTCAGAAGCAAAAACAGGAAGG - Intergenic
974748454 4:66105665-66105687 ATGCTGATGCAAAATGAGAAGGG + Intergenic
975800373 4:78055280-78055302 TAGCAGCTGCAAAATTAGGAGGG + Intergenic
976687239 4:87827847-87827869 AGCCAGATGCAGAATCATGGAGG - Intronic
976768781 4:88628098-88628120 AAGCAGATACAAAATTAGTAAGG - Intronic
977705288 4:100063984-100064006 AGGCACAAGCAAGATCAGGCAGG + Intergenic
978168531 4:105639422-105639444 AGGCAGACACAAAATCTGAAAGG - Intronic
979670719 4:123357546-123357568 AGGAAGAAGGAAAAGCAGGAGGG - Intergenic
980143225 4:128947329-128947351 ACGCAGATGGAAACTCAGAAGGG + Intronic
980643938 4:135617259-135617281 AGGCAGATGTCAAATGAGGAAGG - Intergenic
981263697 4:142754974-142754996 AGGCAGGTGCAATATGAGGCAGG - Intronic
981625307 4:146748005-146748027 AGGCAGATGCAGAAGCAGCAAGG - Intronic
982100376 4:151961263-151961285 AGGCAGATGGAAAATAGGAAGGG - Intergenic
982119612 4:152129438-152129460 AGGCAGACAGAAAATCAGTAAGG - Intergenic
983264157 4:165490018-165490040 AGGCTGATGAAAAATCAGTGAGG + Intronic
983301810 4:165935128-165935150 AAGGAGATGGAAAATCAGAAAGG + Intronic
983491204 4:168391780-168391802 AGGCAGTTGCAAGAACAGTAGGG - Intronic
984287662 4:177753515-177753537 AAGCTGATGCAAACTCAGAAAGG - Intronic
984821436 4:183886046-183886068 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
984821453 4:183886150-183886172 AGGCAGATGCAAGATCAGGAGGG + Intronic
984821461 4:183886202-183886224 AGGCAGATGCAAGATCAGGAAGG + Intronic
984821469 4:183886254-183886276 AGGCAGATGCAAGATCAGGAGGG + Intronic
985372708 4:189303155-189303177 TGGCAGATGCAAATCCAGGCAGG - Intergenic
985987374 5:3527386-3527408 TGGCAGATGCAAAGAGAGGAGGG + Intergenic
986039108 5:3969692-3969714 AGGCAAGTCCAAAATCAAGAGGG + Intergenic
986258120 5:6118828-6118850 AGGCAGCTGCACTATCAGCATGG + Intergenic
987979766 5:25067777-25067799 AGGCAGATGTACAAACAGGATGG - Intergenic
988495874 5:31745646-31745668 GGGAAGATGCTAAAACAGGAAGG - Intronic
988940141 5:36137399-36137421 AGTCATATGCAAGATCAGGAGGG - Exonic
989180731 5:38574282-38574304 AGGCAGATGAAATAGCATGAGGG - Intronic
989238509 5:39176908-39176930 AGGCAGGAGCAAAAACAGAAAGG + Intronic
991253212 5:64586389-64586411 AGGCAGAGGAAAAAACTGGAAGG - Intronic
991460866 5:66856651-66856673 AATCAGATTTAAAATCAGGAAGG - Intronic
992372050 5:76153303-76153325 AGGAAGGTACAATATCAGGAAGG - Intronic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
993801549 5:92349393-92349415 AGGCAAAAGCCAAATCAGAAAGG - Intergenic
995492333 5:112706541-112706563 AGGCAGAGGCCAAATCAGGTAGG - Intergenic
996125779 5:119724119-119724141 AAGCAGCTGAAAAATCAAGAAGG + Intergenic
996286260 5:121796732-121796754 TGGCACATCCAAAATCTGGAGGG + Intergenic
997146845 5:131443643-131443665 AGGCTGATGCTAAATCATGCAGG - Intronic
998417692 5:141957636-141957658 AGGCAGCTGCAACACCTGGAAGG + Exonic
999447195 5:151649505-151649527 AGGCAGTTGCTAAACCAGGTGGG + Intergenic
999824091 5:155257772-155257794 AGGAAAATGGAAAAGCAGGAAGG - Intergenic
1002191126 5:177478197-177478219 AGGCAGTGGCAGAATCATGAGGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002368678 5:178732228-178732250 AGCCACATCCAATATCAGGAAGG + Intergenic
1002826955 6:782779-782801 AGGCAGCTGCACCATCAGAAGGG + Intergenic
1003670908 6:8158297-8158319 AGTCAGATAGAAAATCAGTAAGG - Intergenic
1004839020 6:19561478-19561500 GGGCACATACAAAATCAGGAAGG + Intergenic
1005083638 6:21981626-21981648 AGGCAGGTTCCAAAGCAGGAAGG - Intergenic
1005083689 6:21981860-21981882 AGGAAGATCCCAGATCAGGAAGG - Intergenic
1005367662 6:25095455-25095477 AGGCAAATGTAAAATGACGAAGG + Intergenic
1006313944 6:33279432-33279454 GGGCAGAGGCACAAGCAGGAGGG + Intronic
1007238856 6:40410877-40410899 ATTCACAGGCAAAATCAGGATGG - Intronic
1008039081 6:46776870-46776892 AGACTGCTGCAAAATCAGGAAGG + Intergenic
1008459530 6:51752113-51752135 AGGAAGATGGGGAATCAGGAAGG - Intronic
1009887403 6:69640066-69640088 AGGCAGGAGCAAAATCATGTAGG + Intergenic
1010075503 6:71792494-71792516 AGGGAGATGCTAAATCAGAGTGG + Intergenic
1010326584 6:74570510-74570532 AGGCAGAGGCCAGATCATGAAGG + Intergenic
1012802751 6:103853518-103853540 AGACATATGTAAAATCAGGTTGG + Intergenic
1014591706 6:123280529-123280551 AGGAAGATTCAAAATTATGAAGG - Intronic
1014751159 6:125258013-125258035 AGGCAGCTGAATAATCAGCATGG - Intronic
1015366468 6:132401824-132401846 AGGCAGAGGGAAAAGGAGGAGGG + Intergenic
1015529845 6:134210720-134210742 AGGCTGAGGCAAAATCTGGGAGG + Intronic
1017020812 6:150138685-150138707 AGGTAGGAGGAAAATCAGGAGGG + Intergenic
1017630640 6:156393172-156393194 AGGGAGAGGCCAAATCACGAAGG - Intergenic
1017980245 6:159394833-159394855 AGGCAAATATAAACTCAGGAGGG + Intergenic
1018043779 6:159948222-159948244 AGGGAGATTCAAAATCTGAAAGG - Intergenic
1018771257 6:166973275-166973297 AGGCACAAACAAAATAAGGAAGG + Intergenic
1019923029 7:4174775-4174797 AGGCAGAGCCAAAATCAGCCCGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1022416250 7:30179606-30179628 AGGCCACTGCAAAATGAGGAGGG - Intergenic
1023874701 7:44280510-44280532 GGACAGATGGAAAAGCAGGAGGG + Intronic
1023945271 7:44797552-44797574 AGGCAGAGGGACAATCGGGAGGG - Intronic
1024797654 7:53037308-53037330 AGGCAAATGCTACATCTGGAAGG + Intergenic
1026011814 7:66642249-66642271 AGGCAGAGGTAAAATAAGGAAGG - Exonic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1028090887 7:86699334-86699356 ATCCAGATGCAGAATCTGGATGG + Intronic
1028129447 7:87152703-87152725 CGGCAGCTGCAACGTCAGGAAGG - Exonic
1028342083 7:89734267-89734289 AGGCAGATGCAATTTCCTGATGG - Intergenic
1028615837 7:92765933-92765955 AAACAGATGAAAAATCAGCACGG + Intronic
1028958031 7:96715518-96715540 AGCCTGATTCAAATTCAGGAAGG - Intergenic
1029382507 7:100222876-100222898 AGTGAGATGGAGAATCAGGACGG - Intronic
1029530928 7:101124881-101124903 AGGCAGATTAAAAAGCAGGAGGG + Intergenic
1033148106 7:138888668-138888690 GGGCAGATGAAAAATTAGGCAGG + Intronic
1034580749 7:152039990-152040012 CGGCAGTTGCAAAAACAGAAAGG - Intronic
1034833907 7:154334324-154334346 AGTAAGATGCAAAAGCAAGAAGG + Intronic
1035786109 8:2262477-2262499 TGGCAAATGCAAACACAGGATGG - Intergenic
1035806698 8:2459239-2459261 TGGCAAATGCAAACACAGGATGG + Intergenic
1036507925 8:9372604-9372626 AGAGAGATGCAAAATCAGAATGG - Intergenic
1036740881 8:11360747-11360769 AGGCTGATGCTGAACCAGGAAGG - Intergenic
1037385865 8:18340645-18340667 ATTCAGATAGAAAATCAGGAAGG + Intergenic
1038146857 8:24905200-24905222 AGGAAGATGCAAATTAAGAAAGG - Intergenic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038884712 8:31650464-31650486 TGGCATATGTAAAAACAGGAGGG - Intronic
1039942797 8:42105592-42105614 AGGGAGATACAAAATGAGAAGGG + Intergenic
1042146946 8:65739952-65739974 TGGCAGAGGCAATGTCAGGAGGG - Intronic
1042346247 8:67731017-67731039 GGAAAGATGCAAAATCAGCATGG - Intronic
1042846859 8:73177133-73177155 AGGCAGAAGCCAGATCAGAAGGG + Intergenic
1044151147 8:88776014-88776036 AGGCAGAGGGTAAAGCAGGATGG + Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1045001165 8:97879430-97879452 AGGCAGATTCAAAATCACAAGGG + Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046187414 8:110739871-110739893 AGACTGATTCAGAATCAGGATGG - Intergenic
1046897396 8:119487699-119487721 AGGTAGAAGAAAAACCAGGAGGG - Intergenic
1047301483 8:123617220-123617242 AGAAAGATGGAAAATCTGGAAGG + Intergenic
1047822184 8:128533090-128533112 AGGCAGGGGCAAGATCAGAAAGG + Intergenic
1047978996 8:130160287-130160309 CGGCAGAGGCAAACACAGGAGGG + Intronic
1048170974 8:132105935-132105957 TGGCAAATGCAAAATGAGAATGG - Intronic
1048427127 8:134333099-134333121 ATGCAGATGAAGAGTCAGGAAGG + Intergenic
1050103969 9:2146369-2146391 AGAAATATGCGAAATCAGGATGG + Intronic
1050615333 9:7395829-7395851 GGGAAGATACAAAATAAGGATGG + Intergenic
1051255688 9:15210918-15210940 TGGGAGATGCAAATTCATGAGGG - Intronic
1052360739 9:27553807-27553829 AGGGATATGCAGAATCTGGAAGG + Intronic
1053008389 9:34619583-34619605 AGGTAGAAGGAAAACCAGGAGGG + Intronic
1053902600 9:42809598-42809620 AGTAAGATGCAAAATAATGAAGG - Intergenic
1054740422 9:68800758-68800780 AGGCATTTGCTAAATCAGAAAGG + Intronic
1055177380 9:73336537-73336559 AGGCAGATGGAAAATCTGCAGGG - Intergenic
1056493096 9:87127214-87127236 AGGCAGGGGCCAAATCAGGGAGG - Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1056854859 9:90117806-90117828 AGGCAGGAGCAAATCCAGGAGGG - Intergenic
1056942306 9:90966035-90966057 TTGCATATGGAAAATCAGGAAGG + Intergenic
1057200706 9:93138315-93138337 AGACGGATGCACAAACAGGAAGG - Intergenic
1057809964 9:98250253-98250275 AGGCAGAGGTGAGATCAGGAGGG + Intronic
1057837240 9:98455093-98455115 AGGTAGATGGAATAGCAGGAGGG - Intronic
1057880699 9:98790757-98790779 ATGCAGATGCATCATCATGAAGG + Intronic
1058181272 9:101803090-101803112 AGGCAGATGCAAAAATAGTGGGG + Intergenic
1058211630 9:102176928-102176950 TGTCAGATGCAAAACCAAGAAGG - Intergenic
1058651209 9:107177075-107177097 AGGCAGATGGAAAAACAGGCGGG + Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059837292 9:118170278-118170300 GCGCAGATGCAAAAGCAGAATGG - Intergenic
1059948498 9:119437768-119437790 AGGCAGAAGAAAACTAAGGATGG - Intergenic
1060043016 9:120317809-120317831 AGGAAGATTCAAAAACATGAAGG - Intergenic
1060442676 9:123656183-123656205 AGGCAGAGGCAAAGACAGGGTGG + Intronic
1061579116 9:131526045-131526067 AAACAGATGCAACAGCAGGAGGG + Intronic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186117927 X:6324733-6324755 AGGAAGAGGAAAAATCTGGAAGG - Intergenic
1188000463 X:24975535-24975557 AAGCAGATGAGAAATCAGGCTGG - Intronic
1191089621 X:56606222-56606244 AGGAAGATGGAAATTCAGCATGG - Intergenic
1192576414 X:72246556-72246578 AGTCAGAGGCCAGATCAGGAAGG - Intronic
1193692065 X:84658578-84658600 ATGCAGATATAAAATCAGAAAGG + Intergenic
1194562139 X:95435547-95435569 GGGCAAATGCAAAATCAGTTAGG - Intergenic
1194602845 X:95944420-95944442 AGGCAGCTTCAAAATCAGCAAGG + Intergenic
1196816539 X:119669517-119669539 AGGCCTCTGCAAGATCAGGAAGG - Intronic
1196943269 X:120798637-120798659 AGGGAGAAGCAATGTCAGGATGG + Intergenic
1197634459 X:128899372-128899394 AGGCAGATGTAAAAAAAGAATGG + Intergenic
1197634975 X:128904503-128904525 AGGCAGGTGCTATATCAGGTTGG + Intergenic
1197697605 X:129567656-129567678 AAACAAAGGCAAAATCAGGAAGG - Intronic
1197841581 X:130753453-130753475 AGTCAGATGGAAAAACAGAAAGG - Intronic
1198511731 X:137358836-137358858 AGAGAGATGCAAAATGAAGATGG - Intergenic
1198675785 X:139128505-139128527 AGGCAGAGGCCAGACCAGGAAGG - Intronic
1198802639 X:140462987-140463009 AGGCAGAGATAAAACCAGGATGG - Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199467242 X:148152515-148152537 TGGCAGCAGCAAAAGCAGGAAGG - Intergenic