ID: 984827343

View in Genome Browser
Species Human (GRCh38)
Location 4:183938319-183938341
Sequence GTTAATTTACTAACACAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 165}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984827343_984827344 24 Left 984827343 4:183938319-183938341 CCAGTTTGTGTTAGTAAATTAAC 0: 1
1: 0
2: 0
3: 6
4: 165
Right 984827344 4:183938366-183938388 ACTTTAAAAAACTTTATTGATGG 0: 1
1: 1
2: 2
3: 75
4: 827

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984827343 Original CRISPR GTTAATTTACTAACACAAAC TGG (reversed) Intronic
910090329 1:83455010-83455032 TGTAATTTTCTAACACAAAGAGG + Intergenic
910865587 1:91785512-91785534 GCTATTTTAAAAACACAAACAGG + Intronic
911137998 1:94463497-94463519 GTTACTCTACTAATACAAACAGG + Intronic
911752047 1:101506393-101506415 CTTAATCTACTGACACAAAATGG - Intergenic
911952437 1:104192033-104192055 GGTAATTTATAAACACAAAGAGG - Intergenic
912404277 1:109423807-109423829 GTTAATAGCCTAACACTAACAGG + Intronic
916698406 1:167264566-167264588 GATATTTTAAAAACACAAACTGG - Intronic
918642479 1:186860177-186860199 ATTAATTTATTATGACAAACAGG + Intronic
921937705 1:220810161-220810183 TTTAATTTATTAATACCAACAGG + Intronic
921939267 1:220823348-220823370 GTTGATTCACTAAAAGAAACTGG - Intergenic
922698937 1:227746732-227746754 GTGACTTTACTTATACAAACAGG - Intronic
1066211957 10:33248819-33248841 GCTGATTTACCAACCCAAACAGG + Intronic
1066332285 10:34437591-34437613 GTTAATTTAAGACCCCAAACTGG - Intronic
1072829921 10:98646926-98646948 GTTTATTTACTATGAAAAACTGG - Intronic
1073651292 10:105361787-105361809 AATAATTTACAAACACAAAATGG + Intergenic
1075352575 10:121737108-121737130 GTTATTTTACTAACAAAGCCAGG - Intergenic
1077792097 11:5452038-5452060 ATTAATCTACTAACCCACACAGG - Intronic
1079863942 11:25711632-25711654 GGTAATTTATTAACAAAAAGAGG + Intergenic
1081522409 11:43895497-43895519 GGTAATTTACCAACAAAAAGAGG - Intronic
1087551068 11:99649479-99649501 GGTATTTTACTGACACAAATGGG + Intronic
1087869901 11:103279893-103279915 ATTAATTTCCTAAATCAAACAGG - Intronic
1088630507 11:111769731-111769753 CTTAATATGCTAACAAAAACTGG + Intergenic
1090584662 11:128198320-128198342 GTAAAATTACTAACAGAAAGGGG + Intergenic
1094231182 12:28105208-28105230 GTTGTTTCACTAACACAAATTGG - Intergenic
1097830589 12:64220937-64220959 GCTAATTTATTAGCAAAAACTGG - Intronic
1099606038 12:84802019-84802041 GGTAATTTACAAAGACAAAGAGG - Intergenic
1099817108 12:87664048-87664070 GTTAATTTACTACTCCAGACAGG + Intergenic
1099883072 12:88492157-88492179 CTTATTTTACCAACTCAAACAGG - Intergenic
1101450822 12:104777254-104777276 GTTAATTTACAAATCCAAATTGG + Intergenic
1102359701 12:112274220-112274242 GTTCATTTTCTAACAATAACAGG + Intronic
1103972541 12:124681081-124681103 CTTTATTTACAAAAACAAACAGG - Intergenic
1104467669 12:129003949-129003971 GGTAAGTTAGAAACACAAACTGG - Intergenic
1109085671 13:57968522-57968544 GGTAATTTACTAAGAAAAAGAGG + Intergenic
1112655224 13:101445228-101445250 CTTAGTTGACCAACACAAACTGG - Intergenic
1115061002 14:29189786-29189808 GTTATTTTACCAAGACAATCTGG + Intergenic
1115502856 14:34064745-34064767 GTTAATAAATTACCACAAACTGG - Intronic
1116689947 14:48093026-48093048 ATTTATTTGCTAACACAAAATGG + Intergenic
1119449984 14:74701317-74701339 GTTAATTTACAAAGAAAAAGAGG + Intronic
1120162814 14:81163587-81163609 GTTGATTTACTAATAAAATCAGG - Intergenic
1122526398 14:102388391-102388413 GTTAATTTAAAAAAACAAGCTGG + Intronic
1123680500 15:22759672-22759694 TTTAATTTATTAACAAATACTGG - Intergenic
1123744127 15:23305281-23305303 TTTAATTTATTAACAAATACTGG - Intergenic
1124332718 15:28834132-28834154 TTTAATTTATTAACAAATACTGG - Intergenic
1124406960 15:29401665-29401687 GTGGATATACTAACAGAAACAGG + Intronic
1126971874 15:54124122-54124144 TTTATTTTAATAACCCAAACTGG - Intronic
1129293541 15:74586717-74586739 GTTAATTTATTAACACTATAAGG + Intronic
1129505550 15:76078774-76078796 ATTAAAATACTACCACAAACTGG + Intronic
1137285475 16:47012715-47012737 GTTAATCCACTCACACAAGCAGG + Intergenic
1137577556 16:49612123-49612145 ATTAATTTACTGAAATAAACTGG - Intronic
1153524756 18:5984237-5984259 GTAAATTTATTAAGACATACTGG + Intronic
1155820652 18:30370983-30371005 GTGAATTTATTAACCAAAACTGG + Intergenic
1156945200 18:42821132-42821154 GGTAATTTACTAAGATAAAAAGG - Intronic
1159587719 18:70297228-70297250 GTTAAGTGGCTAAAACAAACTGG - Intronic
1159895331 18:73990681-73990703 GTTATTTTACTTACACATGCAGG - Intergenic
1164783362 19:30911031-30911053 GTTAATTTCTTAAAACAAATTGG - Intergenic
1168708138 19:58481187-58481209 GTTAAAATTCTAACACACACAGG - Exonic
925580351 2:5404205-5404227 GGTAATTTACAAAGAAAAACAGG + Intergenic
925913944 2:8590911-8590933 TTTAATTTAATAACATAAATTGG + Intergenic
930574503 2:53129744-53129766 CTTCATTTAGTCACACAAACAGG + Intergenic
930976560 2:57469384-57469406 AAAAATTTACTAACATAAACAGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
933245377 2:79969167-79969189 GTTAATTTAGTCACTTAAACTGG - Intronic
937653652 2:124349451-124349473 ATTAAATAACTTACACAAACGGG - Intronic
938258802 2:129880853-129880875 GTTAATTTGCTAAAGCAATCAGG + Intergenic
939009065 2:136823848-136823870 GTCAATTTCCTAATACCAACAGG - Intronic
939033852 2:137107734-137107756 GTTAACTTTCTTACACTAACTGG - Intronic
940349439 2:152665352-152665374 GTTAAATTACTAAAATAAATAGG + Intronic
940551120 2:155158068-155158090 ATTAATTTAATAATAGAAACAGG + Intergenic
940702738 2:157066278-157066300 GAAAATTTATTAACACCAACTGG - Intergenic
943782483 2:191839735-191839757 GTCATTTTAATTACACAAACAGG + Intronic
943810574 2:192183043-192183065 GTTTATTTGCTAAAGCAAACAGG - Intronic
945413517 2:209541907-209541929 GTCAAAATACTAACACTAACAGG - Intronic
945944276 2:215980013-215980035 GATAATTTACTGACAGAAATGGG - Intronic
947419007 2:229924637-229924659 GATAATTTACTAAAATAAAAAGG - Intronic
1169524758 20:6412282-6412304 GTCAATTTACCAACAAAACCAGG - Intergenic
1169818298 20:9681865-9681887 GTTTATAGACTAACAAAAACAGG - Intronic
1172679369 20:36700582-36700604 GATAATTGACTAAGACAAAAAGG - Intronic
1173421283 20:42903420-42903442 GTTAATATACTTATAAAAACTGG - Intronic
1173614154 20:44391698-44391720 GTTCATTTAATATCACAACCTGG - Intronic
1175638863 20:60609957-60609979 GTTAATTTACCTATATAAACTGG - Intergenic
1176124126 20:63467662-63467684 GTTTATTGACTAAAACAAACTGG + Intronic
1183336610 22:37251417-37251439 GGTAATTTACTAAGAAAAAGAGG + Intergenic
949690771 3:6635903-6635925 TTTAATTTAATTACACAAAATGG - Intergenic
952205334 3:31175969-31175991 GTTAACTTACATTCACAAACAGG + Intergenic
952876970 3:37954317-37954339 GTTAATTTAATAATCCAAAGTGG + Intronic
952961411 3:38592712-38592734 GTGAACTCACTACCACAAACTGG - Intronic
953094603 3:39762586-39762608 GTAAATTTACAAAAACAATCTGG - Intergenic
955028290 3:55191267-55191289 GTTAAGTTTCTAAAACATACAGG - Intergenic
955654892 3:61234522-61234544 GTTAGTTTTCTAACAGAAAATGG - Intronic
960142242 3:114162397-114162419 GTTACTTAACCAACACCAACAGG + Intronic
960546989 3:118926686-118926708 GTTACTTTACAAACAAAAACTGG + Intronic
960823874 3:121762031-121762053 GTTAATATACCAGCACAAAGAGG + Intergenic
962172105 3:133112255-133112277 GATAATTTAAAAACAAAAACAGG - Intronic
962404051 3:135085203-135085225 GTTAGTTGATTAACACAAAGAGG + Intronic
963452641 3:145503758-145503780 ATTAATGTACTTACACACACAGG + Intergenic
965916028 3:173846840-173846862 TTTAATTTAGTAACACATAGAGG - Intronic
966586354 3:181629953-181629975 GTTAAAATACTCATACAAACTGG - Intergenic
968035656 3:195545265-195545287 GTTAATTAACTAACAAACATTGG + Intergenic
968400819 4:295533-295555 GTTAATTTTTTAAAATAAACAGG - Exonic
970189812 4:13503832-13503854 GTTAATTTTCTAAGAAAAATGGG + Intergenic
971430248 4:26557779-26557801 GTTAATTTACAAAGAAAAAGAGG + Intergenic
972164395 4:36264934-36264956 GTTCATTTTCTTACACGAACAGG - Intergenic
974205349 4:58695444-58695466 GATAATTTACAAACAAAAAGAGG - Intergenic
974586148 4:63880105-63880127 GTAAATTTAGTAACAAAATCTGG - Intergenic
978256416 4:106697772-106697794 GTTATTTAATTAACACAGACTGG - Intergenic
979443654 4:120783623-120783645 GTTATTTTTCTAAATCAAACTGG + Intronic
979563473 4:122126810-122126832 GTTATTTCACTATCAAAAACAGG + Intergenic
981371858 4:143967669-143967691 GTTAATGGACTAACATCAACTGG - Intergenic
981799878 4:148643118-148643140 ATTCATTTACTAAGAAAAACAGG - Intergenic
982589054 4:157281146-157281168 AATAATTTAATAACAGAAACAGG + Intronic
982640185 4:157949234-157949256 GTTAATTTAGTACAACAAACTGG - Intergenic
983400659 4:167261647-167261669 GTTAATTTCCTAAGATAATCAGG - Intergenic
983717179 4:170797314-170797336 GTTAATAAACTAAAATAAACAGG + Intergenic
984514176 4:180718216-180718238 GTTTTTTAACTCACACAAACTGG - Intergenic
984597562 4:181688049-181688071 GTTAATTTACTCACAGAAAGTGG + Intergenic
984827343 4:183938319-183938341 GTTAATTTACTAACACAAACTGG - Intronic
984942689 4:184947922-184947944 GGTAATTTACAAACAAAAAAAGG - Intergenic
985384709 4:189433649-189433671 TTAAATTTACAAGCACAAACAGG + Intergenic
986391497 5:7291642-7291664 TTTAATTTATTAACAAATACTGG - Intergenic
987437573 5:17914739-17914761 GTGAATTTATTCACACAAAATGG - Intergenic
988750222 5:34184749-34184771 TTTAAATCACTAACACATACTGG + Intergenic
994674992 5:102809891-102809913 GTAAATTTTCAAACACAAACAGG - Intronic
995000885 5:107127723-107127745 TTTTATTTGCTAACATAAACAGG - Intergenic
995499392 5:112787221-112787243 GATAATTTATGAACACAAATGGG + Intronic
995736420 5:115305157-115305179 GTTAATTTATTTACACCAAAAGG - Intergenic
997556598 5:134804647-134804669 AATAATTTATTAAGACAAACGGG - Intronic
998090431 5:139363716-139363738 GTTAATTTACTTACTCATTCAGG - Intronic
1002942245 6:1727919-1727941 ATTAATTAATTAACACAAAAAGG + Intronic
1006479157 6:34277954-34277976 GTTACTTCACCAACTCAAACTGG + Intergenic
1010878356 6:81137470-81137492 AGTAATCAACTAACACAAACAGG - Intergenic
1010925447 6:81739690-81739712 TTTAATGTGCTGACACAAACAGG + Intronic
1015621604 6:135137847-135137869 TTTAATTTACTAACCTATACTGG + Intergenic
1016575235 6:145563014-145563036 GTTTATTTACTCACATAAAGAGG + Intronic
1018436643 6:163765696-163765718 GTAAATTTCCAAACACAAAGTGG + Intergenic
1021128746 7:16885232-16885254 GTTAATATACAAACATAAATAGG - Intergenic
1022450102 7:30506059-30506081 GATAATTTAAGAAAACAAACAGG + Intronic
1022608598 7:31843998-31844020 GTCCATTTACTAACATTAACTGG + Intronic
1023414758 7:39921386-39921408 TTTAATTTAGAAACACAAGCTGG - Intergenic
1023572973 7:41591732-41591754 GTTAATTAACAAACAAAAAGTGG + Intergenic
1027307183 7:76911457-76911479 TGTAATTTTCTAACACAAAGAGG + Intergenic
1027565159 7:79782486-79782508 GCTAATTTACTCCCACCAACAGG + Intergenic
1028785826 7:94792415-94792437 CTTAATTTAGTAACACAACTGGG + Intergenic
1030260009 7:107553843-107553865 TTTAATTAACTAACACTTACAGG + Intronic
1030576034 7:111287161-111287183 ATTAATTTATTACCACAGACAGG - Intronic
1030730308 7:112980249-112980271 GTTAATTTTAAAACACAAAATGG - Intergenic
1030772959 7:113497786-113497808 GTTAATTTTAAAACACAAAATGG - Intergenic
1030863025 7:114660189-114660211 GTTTATTTACTTAGACAAAAGGG + Intronic
1031042882 7:116856993-116857015 GTTGATTTAGCAACACATACGGG - Intronic
1035961384 8:4142234-4142256 CTTAATTTACTAATACAACAGGG + Intronic
1036102947 8:5807347-5807369 GGTAAATAACTAACACAACCCGG + Intergenic
1036534922 8:9639031-9639053 GTTAATTTAATAACAGAAGTAGG - Intronic
1036744706 8:11398175-11398197 ATTAATTTAGTAACACTATCCGG + Intronic
1037117391 8:15243171-15243193 GCAAATTTACAAACACAAATAGG + Intergenic
1038162023 8:25048899-25048921 CTTAATTTAAAATCACAAACTGG + Intergenic
1038167048 8:25095537-25095559 TTTAATTTCTTAACACCAACTGG + Intergenic
1045205814 8:100039162-100039184 TTTAATCTTCTATCACAAACTGG + Intronic
1045755086 8:105533553-105533575 GTTAATCTTATAAGACAAACTGG - Intronic
1045948675 8:107827085-107827107 TTTAATTTACTTCCATAAACAGG + Intergenic
1046187774 8:110745725-110745747 GTTAATATACTAGAACAAAATGG + Intergenic
1046534207 8:115487575-115487597 GTTAAAATATTAACACTAACAGG + Intronic
1047190721 8:122676817-122676839 CTTTATTTACAAAAACAAACAGG + Intergenic
1058820650 9:108726328-108726350 TTAAATATACTAACACAGACAGG + Intergenic
1186708991 X:12173256-12173278 TTTAATTTACTACTACAATCTGG - Intronic
1187921409 X:24205996-24206018 GTTCATTTTTTAACACATACAGG + Intronic
1188720532 X:33518062-33518084 TTTAATTTTTTAACAGAAACAGG - Intergenic
1190468004 X:50746560-50746582 TTGAATTTACCAACTCAAACAGG - Intronic
1190596379 X:52055500-52055522 CTTAATTTACCAACATATACGGG + Intergenic
1190612445 X:52198573-52198595 CTTAATTTACCAACATATACGGG - Intergenic
1200972206 Y:9164687-9164709 GAAAAATTAGTAACACAAACAGG + Intergenic
1201648009 Y:16256966-16256988 TTTAATTCATTAAAACAAACTGG - Intergenic
1201654801 Y:16328335-16328357 TTTAATTCATTAAAACAAACTGG + Intergenic
1202138824 Y:21699626-21699648 GAAAAATTAGTAACACAAACAGG - Intergenic