ID: 984830238

View in Genome Browser
Species Human (GRCh38)
Location 4:183966132-183966154
Sequence AGGGGTCAAAACTCCCTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 153}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984830238_984830243 1 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830243 4:183966156-183966178 CAGCTCTATATGGCCAAGAGTGG 0: 1
1: 0
2: 1
3: 6
4: 97
984830238_984830247 20 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830247 4:183966175-183966197 GTGGTTATGCCTGAGACGGTGGG No data
984830238_984830239 -9 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830239 4:183966146-183966168 TTGACCCCTTCAGCTCTATATGG 0: 1
1: 0
2: 0
3: 6
4: 86
984830238_984830245 16 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830245 4:183966171-183966193 AAGAGTGGTTATGCCTGAGACGG 0: 1
1: 0
2: 1
3: 14
4: 154
984830238_984830249 24 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830249 4:183966179-183966201 TTATGCCTGAGACGGTGGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 112
984830238_984830246 19 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830246 4:183966174-183966196 AGTGGTTATGCCTGAGACGGTGG 0: 1
1: 0
2: 0
3: 6
4: 98
984830238_984830248 23 Left 984830238 4:183966132-183966154 CCAGGGAGGGAGTTTTGACCCCT 0: 1
1: 0
2: 0
3: 22
4: 153
Right 984830248 4:183966178-183966200 GTTATGCCTGAGACGGTGGGTGG 0: 1
1: 0
2: 0
3: 3
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984830238 Original CRISPR AGGGGTCAAAACTCCCTCCC TGG (reversed) Intronic
901150813 1:7100011-7100033 AGGGGGCAATAGACCCTCCCGGG - Intronic
901214822 1:7549292-7549314 AGAAGTCAAAACACCCTCCACGG - Intronic
905837818 1:41143406-41143428 AGGGATTAAAAGTCCCTACCTGG - Intronic
912695273 1:111836857-111836879 AGGATTCCAAACTCCATCCCCGG + Intronic
913968194 1:143394124-143394146 AGGGATCAAAAATCCCTCCAGGG - Intergenic
914062573 1:144219716-144219738 AGGGATCAAAAATCCCTCCAGGG - Intergenic
914116577 1:144746638-144746660 AGGGATCAAAAATCCCTCCAGGG + Intergenic
914245946 1:145885936-145885958 TGGGCTCAAAACTCCGCCCCTGG + Intergenic
914869700 1:151462632-151462654 ATGGGTCAAAACTGTCTCCCAGG - Intergenic
915227076 1:154419180-154419202 TGGGGACAAGACTTCCTCCCTGG + Intronic
915739288 1:158106230-158106252 AGGGGCCACAACTCCCTCCTGGG - Intergenic
918118110 1:181514474-181514496 AGGGGTCAAAACACCAGCCCTGG - Intronic
921617213 1:217283381-217283403 AGGGAGCAAAACCCCCTTCCAGG + Intergenic
922645328 1:227280915-227280937 GGGGGTCAGAACTGCCTCTCAGG + Intronic
924486420 1:244487753-244487775 AGGGGTAAATAATCCATCCCAGG + Intronic
1062771899 10:107967-107989 AGGGGTCAAAGCTTCCTTCTGGG + Intergenic
1064987621 10:21226584-21226606 AGGGCTCAATGCTCCCTCCGTGG + Intergenic
1068323064 10:55445321-55445343 AGGGATGAAAACTCCCAACCAGG + Intronic
1068545106 10:58335558-58335580 AGGGGTCAAAACTAGCCCCATGG - Intronic
1069771889 10:70905544-70905566 AGGGGCCAGAGCTCCCACCCGGG - Intergenic
1075529838 10:123219816-123219838 AGGGCAGAAAACTCCCACCCTGG - Intergenic
1076638904 10:131901001-131901023 AAGGGAAAAAAATCCCTCCCCGG + Exonic
1076941006 10:133608591-133608613 AGGGATCCAAACTCCTTCTCTGG - Intergenic
1077502744 11:2916706-2916728 AGGGGCCAAAACTGACGCCCAGG + Exonic
1080409066 11:32006198-32006220 AGGGGACAAAGCTCCCGCCCTGG + Intronic
1081595232 11:44454281-44454303 AGTGGTCAAATCACCCACCCTGG + Intergenic
1082874297 11:57972407-57972429 ATAGATCAAAACTACCTCCCCGG - Intergenic
1084555733 11:69874771-69874793 AGAGGTTAAATGTCCCTCCCGGG + Intergenic
1084710047 11:70838550-70838572 AGGAGTCAGGACTCCATCCCAGG - Intronic
1084738379 11:71120918-71120940 AGGGCTCCAAACTGCCTCTCAGG + Intronic
1085117222 11:73940249-73940271 AGGGATCCAAACTCCTTCCCTGG + Intergenic
1088218151 11:107536900-107536922 AGGGGTCAAACGTCCCTGGCTGG - Intronic
1091369837 11:135048736-135048758 CGGAGGCAAAACTCCTTCCCTGG - Intergenic
1095598174 12:43982854-43982876 AGGGGTCAAAATACCTTCTCCGG - Intronic
1100161629 12:91867286-91867308 AGGACTCAACACTCCTTCCCTGG + Intergenic
1104856014 12:131902842-131902864 AAGGGCCACAACTGCCTCCCTGG - Intronic
1105417623 13:20227048-20227070 AGAGGTCACAACTCCCCCCCAGG + Intronic
1105544805 13:21343571-21343593 AGGGTTCAGAGCTCCCTCACTGG - Intergenic
1106702991 13:32249711-32249733 AGGTCCCTAAACTCCCTCCCAGG - Intronic
1110943864 13:81388874-81388896 AGAAGTCAAAACTCCACCCCTGG + Intergenic
1112115695 13:96350730-96350752 AGGTGTTAAAACACCCTCCAAGG - Intronic
1112325871 13:98442543-98442565 AGGTGTGAATATTCCCTCCCCGG + Intronic
1112383218 13:98913123-98913145 AAGTGTAAAATCTCCCTCCCTGG - Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1112753177 13:102602503-102602525 AGGGGTCATAAAGGCCTCCCAGG - Intronic
1117766345 14:59087294-59087316 AGGGGAAAAAAATCCCTGCCTGG - Intergenic
1118349572 14:64963915-64963937 AGGAGTGAGAAATCCCTCCCGGG - Intronic
1123480466 15:20626872-20626894 TGGGGTCAAAAGCCCCTTCCTGG + Intergenic
1123637542 15:22373495-22373517 TGGGGTCAAAAGCCCCTTCCTGG - Intergenic
1124392545 15:29272805-29272827 AGGGCTGAAAACTCCTACCCTGG - Intronic
1126721197 15:51582008-51582030 ATTGATCAAAACTCACTCCCAGG - Intronic
1127238826 15:57087963-57087985 AGGGGTCAAACATGGCTCCCAGG - Intronic
1129466361 15:75726251-75726273 AAGGGTCAAGACTTCCTCCTTGG + Intronic
1130980263 15:88807514-88807536 AGGGGCCCAGACTCCCTCGCAGG - Intronic
1133217069 16:4299077-4299099 AGGGTCCAACACTCCCTCCAGGG - Intergenic
1134195331 16:12155195-12155217 AGGAGAGAAAACTCCATCCCAGG + Intronic
1135574630 16:23575799-23575821 AGAGGTCAAAACACCCTGCTAGG - Intergenic
1139280895 16:65769556-65769578 AGGGCCAAAAACTCCATCCCTGG + Intergenic
1139457145 16:67089826-67089848 ATCAGTAAAAACTCCCTCCCAGG + Intronic
1140406129 16:74712854-74712876 AGGGCTAGAATCTCCCTCCCTGG + Intergenic
1142806880 17:2375981-2376003 TGGGCTCAGAACTCCCTTCCAGG - Intronic
1143773248 17:9181561-9181583 TGGGGTCAAATCTTGCTCCCAGG - Intronic
1143774040 17:9186178-9186200 TGGTGTCAATACTCCCTCCCTGG + Intronic
1144732722 17:17537775-17537797 ATGTCTCAAATCTCCCTCCCCGG - Intronic
1147330478 17:39696284-39696306 TGGGGTCAGAACTCACGCCCTGG - Intronic
1147594882 17:41710553-41710575 AGGGGGCATAACCCCCTCCATGG + Intergenic
1147989963 17:44326622-44326644 AGGGCTCCACACTGCCTCCCCGG + Intergenic
1150061157 17:62069387-62069409 TGGGGTCAAAACTCCATACTTGG + Intergenic
1150224482 17:63516275-63516297 TGAGGACAAAACTCCCTCCTTGG - Intronic
1150566545 17:66346453-66346475 AGAGTTCAAAAGTCCATCCCGGG - Intronic
1150619924 17:66800407-66800429 ATGGGGCAAAAATCCCTTCCTGG - Intronic
1151094943 17:71486305-71486327 AGGTGCCAAAACCACCTCCCTGG + Intergenic
1151707097 17:75774890-75774912 AGGGGTGAAAACTACCCACCTGG + Intergenic
1152609496 17:81308626-81308648 AGGGGTCAGAGCTGCATCCCTGG - Intergenic
1155417504 18:25614868-25614890 AGGTATCAGAATTCCCTCCCTGG + Intergenic
1157006994 18:43595114-43595136 AGAGGTCAAAACTGGCACCCAGG + Intergenic
1157071323 18:44412183-44412205 AGGGATCACATCTCCATCCCAGG + Intergenic
1157551840 18:48587544-48587566 AGGCCTCTGAACTCCCTCCCAGG - Intronic
1159889213 18:73938816-73938838 ACTGGGCAAAACTCCCTTCCAGG + Intergenic
1160929149 19:1561530-1561552 GGATGTCAAAACCCCCTCCCAGG + Intronic
1161229167 19:3163934-3163956 TGGAGTCCAACCTCCCTCCCAGG + Intergenic
1163962539 19:20710584-20710606 AGGGATCCAAACTCCTTCTCTGG + Intronic
1165067859 19:33239463-33239485 TGGGGCCAGCACTCCCTCCCCGG + Intergenic
1167215946 19:48164681-48164703 AGTTGCCAAAACTTCCTCCCTGG - Intronic
1167753901 19:51398711-51398733 AGGGATCCAAACTCCTTCTCTGG + Intergenic
1168624102 19:57903090-57903112 AGGGATCCAAACTCCTTCTCTGG - Intronic
1202701981 1_KI270712v1_random:171588-171610 AGGGATCAAAAATCCCTCCAGGG - Intergenic
926178907 2:10622803-10622825 AAAGCTCAAAACTCCCTCCCAGG + Intronic
927102092 2:19795754-19795776 TGGGGTCTCAACTCCCACCCTGG - Intergenic
934172893 2:89555038-89555060 AGGGATCAAAAATCCCTCCAGGG - Intergenic
934283207 2:91629395-91629417 AGGGATCAAAAATCCCTCCAGGG - Intergenic
934518078 2:95001324-95001346 TGGGCCCAAACCTCCCTCCCAGG - Intergenic
935300262 2:101687783-101687805 TGGGGTCACAACTCACTCTCAGG + Intergenic
935722678 2:105993430-105993452 AGGGATCCAAACTCCTTCCCTGG - Intergenic
938144870 2:128824791-128824813 AAGGGTCAAAACTCCTTGCCAGG + Intergenic
938856681 2:135319978-135320000 AAGTGCCAAAACTCCCTCCTAGG + Intronic
943072175 2:183153818-183153840 TGGGGTCAAAGCTCCCACACAGG - Intronic
944848206 2:203690245-203690267 AGTGGTAAAGACTCTCTCCCTGG + Intergenic
1168893616 20:1309410-1309432 AGGGGTCACAACACCCGCACGGG + Intergenic
1170093616 20:12620700-12620722 AGTGGATAAAATTCCCTCCCGGG + Intergenic
1170970214 20:21108797-21108819 AGGCGTCTACACTGCCTCCCAGG - Intergenic
1172500287 20:35421403-35421425 AAGGATCAAGAGTCCCTCCCTGG + Intergenic
1173685331 20:44919356-44919378 AGGGGAAGAAAGTCCCTCCCCGG + Intronic
1175941297 20:62538710-62538732 TGAGGTCAAAGTTCCCTCCCCGG + Intergenic
1176292799 21:5055245-5055267 AGGGCTCACTGCTCCCTCCCTGG + Intergenic
1179864461 21:44208405-44208427 AGGGCTCACTGCTCCCTCCCTGG - Intergenic
1181442039 22:22941738-22941760 AGGGGCCAAATCTCCTTCCTGGG - Intergenic
1182609282 22:31533063-31533085 AGGCATCAAAAGTCCCTCTCGGG + Intronic
1183665674 22:39244525-39244547 AGAGGTGCAAACTCCCGCCCGGG + Exonic
1185201087 22:49505863-49505885 AGGAATCAAAACTCAATCCCAGG + Intronic
950292330 3:11795357-11795379 AGGAGTCAGAACTAACTCCCAGG - Intronic
950583865 3:13879671-13879693 AGGCGGCACACCTCCCTCCCCGG + Intronic
951749054 3:26013660-26013682 AGAGGTTAAACCTCCCTACCTGG + Intergenic
952108681 3:30097444-30097466 AGGGGTGGAAGCTGCCTCCCTGG - Intergenic
952262996 3:31758680-31758702 AGGGCTGAAAACTCCACCCCTGG + Intronic
955248770 3:57255544-57255566 ATGGTTCAAAACTTCCTCCTAGG - Intronic
956309272 3:67860876-67860898 AGGAGTCAAGACTACCTCCAAGG + Intergenic
960803973 3:121564969-121564991 AAGGGTCAGAGCCCCCTCCCTGG + Intergenic
961476428 3:127149726-127149748 ATGGGTCTAAACACCCTCCCAGG + Intergenic
965856852 3:173099824-173099846 AGAGGTCAAAATTCCATCACAGG + Intronic
968181047 3:196595515-196595537 AGGGATCAAATGTCCCACCCAGG - Intergenic
974504981 4:62758231-62758253 AGGTGTGAATACTCCCTCCATGG + Intergenic
981480507 4:145233951-145233973 ATAGGTCAAAACTCCCTGCTAGG - Intergenic
983229080 4:165112304-165112326 AGGGGGCGAATCTCCCTTCCTGG - Intronic
984830238 4:183966132-183966154 AGGGGTCAAAACTCCCTCCCTGG - Intronic
985424152 4:189812174-189812196 AGGTGTAAATACTCCCTCCATGG - Intergenic
990286904 5:54309888-54309910 ACGGGTCTAAACTACCTCGCAGG - Intronic
992565962 5:77995460-77995482 AGCCGACAAACCTCCCTCCCAGG + Intergenic
994206766 5:97044303-97044325 AGGGGTGAAAACACTATCCCAGG + Intergenic
994303148 5:98171187-98171209 AGGTGTTAATGCTCCCTCCCAGG + Intergenic
995767643 5:115636315-115636337 AGGGGTCAAAAATCCCTTGGGGG + Intergenic
996602967 5:125288211-125288233 AAGGGTCAAGACTCACACCCCGG - Intergenic
998787423 5:145727775-145727797 AGGGATCCAAACTCCTTCCCTGG + Intronic
1000216156 5:159158723-159158745 TGGGGTCAAAAGCCCCTTCCTGG + Exonic
1000732740 5:164856348-164856370 AGGGGTCATATTTCCTTCCCTGG - Intergenic
1000772800 5:165378177-165378199 AGGGGAAAAAACTACCTTCCCGG - Intergenic
1002996240 6:2287627-2287649 AAGGATCACAACTCCCTGCCTGG + Intergenic
1003406821 6:5832980-5833002 AGGGTTCAGAGCTCCCTCACTGG + Intergenic
1003640265 6:7869954-7869976 AGGGGCCATAGCTCCCTTCCTGG - Intronic
1006256589 6:32837586-32837608 GGGGGTCAAAATCACCTCCCAGG + Exonic
1006823806 6:36918802-36918824 AGGGTTCACAGCTCCTTCCCTGG + Intronic
1011297315 6:85838914-85838936 GGGGGTCAATACCCCCCCCCCGG + Intergenic
1013631037 6:111986156-111986178 AGGGGAATAATCTCCCTCCCAGG - Intergenic
1015338467 6:132069408-132069430 AGGGTTCAAAAAACCTTCCCTGG - Intergenic
1019380922 7:723030-723052 AGGGGTGAAAGGTACCTCCCTGG + Intronic
1024926134 7:54617681-54617703 AGGGGTCACAGCTCTCTCTCTGG - Intergenic
1034367313 7:150562355-150562377 AGGTATCCAAACTCCCTCTCAGG + Intergenic
1037159246 8:15747793-15747815 AGGGGAGAAAACTCCCTCCATGG - Intronic
1039101188 8:33943539-33943561 AGGGGTTCAGACTCCCTCCCTGG + Intergenic
1039581552 8:38671002-38671024 AGGGGTCCAAAATCCCAGCCTGG + Intergenic
1040386645 8:46918865-46918887 AGGGGCCATCACTGCCTCCCAGG + Intergenic
1041730951 8:61062133-61062155 CTGGGTCAAAACTCCACCCCTGG + Intronic
1042100393 8:65270298-65270320 AGGGATCAAAACACAGTCCCTGG + Intergenic
1042692070 8:71510941-71510963 AGGAGAAAAGACTCCCTCCCTGG - Intronic
1045214537 8:100134215-100134237 AGGTGTCAAAACTTCTCCCCAGG + Exonic
1045857481 8:106781004-106781026 CTGGGTCAAAACTCTCTCTCTGG + Intergenic
1049329975 8:142045346-142045368 TGGGCTCACCACTCCCTCCCGGG + Intergenic
1049555894 8:143281847-143281869 GAGGGTCAAAACCTCCTCCCTGG + Intergenic
1049577561 8:143396790-143396812 AGGGGCCTTAACTCCCTCCCTGG - Intergenic
1055483946 9:76738470-76738492 AGGTGTTAAAAGTGCCTCCCAGG - Intronic
1056070915 9:82985687-82985709 AGGCCTCAAAATTCCCTACCTGG - Intronic
1056210619 9:84361595-84361617 AGGGGACAAAACACTCTCGCGGG - Intergenic
1056337725 9:85591377-85591399 AGGGGTCAAAACTGAATCCTAGG + Intronic
1056830314 9:89911863-89911885 AGGGCTAAAATCCCCCTCCCGGG + Intergenic
1059774599 9:117462821-117462843 AGGGGCCATAACTCTGTCCCTGG - Intergenic
1061715377 9:132515348-132515370 AGGGCTGACACCTCCCTCCCAGG + Intronic
1062022465 9:134326076-134326098 CGGGAGCAGAACTCCCTCCCCGG - Intronic
1186207964 X:7219707-7219729 AGGGTTAAAAACTCCCAGCCTGG - Intronic
1187471496 X:19573783-19573805 AGGGTTCATAACTCCACCCCTGG - Intronic
1187612992 X:20962097-20962119 AGGGAACAAAAGTCTCTCCCTGG + Intergenic
1189305929 X:39986588-39986610 AGGAGCCAACCCTCCCTCCCAGG + Intergenic
1190071759 X:47285416-47285438 AAGGGTCAGAAGTCCCTCCCAGG - Intergenic
1193344232 X:80387199-80387221 AGGGGGCACATCTCCCTCCATGG + Intronic
1194916536 X:99715693-99715715 AGGGGTGAGAACTACCTCACAGG + Intergenic
1200204305 X:154304737-154304759 AGGGGACAAAACCAACTCCCTGG - Intronic
1200395553 X:155984700-155984722 AGGGAACCAAACTCCTTCCCTGG + Intergenic