ID: 984831837

View in Genome Browser
Species Human (GRCh38)
Location 4:183983174-183983196
Sequence AGGATGGGCGAGTAAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 270}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984831837 Original CRISPR AGGATGGGCGAGTAAAGGGG TGG (reversed) Intronic
900166108 1:1244942-1244964 AGGAGGGGAGAGGAATGGGGAGG - Intronic
901692221 1:10980904-10980926 GGGCTGGGCGAGCAAGGGGGAGG - Intronic
902292730 1:15445790-15445812 GGGATGGGTGAGTGAGGGGGAGG - Intronic
902315702 1:15617233-15617255 AGGAAGGGCAAGAAAAGGGGAGG - Intergenic
902642502 1:17775773-17775795 AGGATGGGGGAGGAGAGGAGAGG - Intronic
903653616 1:24935502-24935524 AGGATGGGAGAGAGAAAGGGAGG + Intronic
904094693 1:27967571-27967593 AGGATAGGGGAGCTAAGGGGTGG - Exonic
905266161 1:36755653-36755675 GGGATGAGGGAATAAAGGGGAGG - Intergenic
907332738 1:53681836-53681858 AGGATGGGGGAGGAGAGAGGGGG - Intronic
912474575 1:109927538-109927560 AGGGTGGGCGTGTAGAGGGGTGG - Intronic
916167936 1:161979861-161979883 AGGAGGGGAGAGGAAAGGAGAGG + Intergenic
916429507 1:164713539-164713561 AGGAAGGGGGAGAAGAGGGGTGG - Intronic
919483824 1:198121733-198121755 AGGAGGGGCCAGGAAAGGTGGGG - Intergenic
919880984 1:201900470-201900492 AGGATGGGAGAGGAGAGGAGAGG - Exonic
921477997 1:215633254-215633276 AGGATGAGTGAGTAGAGGAGTGG + Intronic
924503389 1:244657674-244657696 AGGATGGTAGAGTAAAAGGATGG - Intronic
1063744686 10:8867273-8867295 GGGAGGGGCAAGGAAAGGGGAGG - Intergenic
1064722196 10:18240782-18240804 AGGATGGGGGAGAAAAGGGAAGG - Intronic
1065395940 10:25237947-25237969 AGGACGGGCAAAGAAAGGGGAGG - Intronic
1065708298 10:28491390-28491412 AGGCAGGGAGAGGAAAGGGGAGG + Intergenic
1069679735 10:70275408-70275430 AGGAGGGGAAAGTAAAGGGGAGG + Intronic
1070558768 10:77550193-77550215 TGGATGGGAGAGTGAAGGGTTGG + Intronic
1071137509 10:82469198-82469220 AGGAAGGGAGGGAAAAGGGGAGG - Intronic
1071481609 10:86069096-86069118 AGGATGGGCCAGGGAAGGGCAGG + Intronic
1071881678 10:89905673-89905695 AGGATGAACTAGTAAAGGAGTGG - Intergenic
1073134842 10:101214826-101214848 CGGATGGGTGGGGAAAGGGGTGG + Intergenic
1074088553 10:110226676-110226698 GGGAGGGGCGAGTGAAGGAGGGG + Intronic
1075137896 10:119802306-119802328 AGAATGGCAGAGTAAAGGGATGG + Intronic
1076736446 10:132461270-132461292 AGGATGGAGGAGGAAAGAGGAGG - Intergenic
1078593661 11:12667957-12667979 AGGAAAGGAGAGTAAAGGTGAGG + Intergenic
1078795222 11:14585678-14585700 AGGAGGGGCGAATAAAAGAGGGG - Intronic
1081997059 11:47372564-47372586 AGGATGGACGAGTAGGTGGGTGG + Intronic
1084147623 11:67273478-67273500 AGCACGGGCGAGCACAGGGGTGG - Intronic
1084699478 11:70777073-70777095 AGGATGGGTGAGTGAATGAGTGG - Intronic
1084893566 11:72249694-72249716 GGGATGGGGGAGTCAAGGGAAGG - Intergenic
1085464363 11:76713803-76713825 TGGATGGGTGAGTAGATGGGTGG + Intergenic
1086038954 11:82451629-82451651 AGGAGAAGCGAGTAAAGGGGAGG + Intergenic
1086053315 11:82619398-82619420 GGGATGAGTGAGTAAAGGAGTGG - Intergenic
1087145440 11:94806123-94806145 AGGAGGGACAAGTAAAGTGGGGG + Intronic
1088106748 11:106215185-106215207 AGGGTGGGAGAGTACAGGAGTGG + Intergenic
1089322403 11:117635265-117635287 AGAATGGGCGAGTAGAGCTGGGG - Intronic
1089525223 11:119092801-119092823 AGGATGGGCAAGTAAGTGGGGGG + Exonic
1089739900 11:120575317-120575339 AGGCTGGGCAGGGAAAGGGGAGG - Intronic
1089808760 11:121114769-121114791 TGGATGGGTGAGTGAATGGGTGG - Intronic
1091183185 11:133626001-133626023 AGAATGGGATAGCAAAGGGGAGG - Intergenic
1092449993 12:8593249-8593271 AGGATGGGGGAGGGGAGGGGAGG + Intergenic
1096465676 12:51846988-51847010 GGGGTGGGCGAGGAAAGGGGCGG - Intergenic
1098467745 12:70807195-70807217 AGGATAGACAAGTAAAGGGATGG + Intronic
1098467950 12:70809299-70809321 AGGATGGAGAAGTAAAGGGATGG + Intronic
1099121911 12:78700740-78700762 AGGAAGGGAGAGGAGAGGGGAGG + Intergenic
1100329204 12:93569794-93569816 AAGTTGGGCGAGGAAGGGGGAGG - Intronic
1101102004 12:101403620-101403642 AGGATGGCAGAGAAAAGGGATGG - Intronic
1101580415 12:106037464-106037486 AGGAGAGGGGAGGAAAGGGGAGG - Intergenic
1101995889 12:109524622-109524644 AGGATGGGCGAGGGGTGGGGAGG - Intronic
1102504208 12:113373672-113373694 TGGATGGGTGGGTAAATGGGTGG - Intronic
1105282983 13:18980162-18980184 AGGATGGGCGAGGGAAGGAGGGG + Intergenic
1105301232 13:19136715-19136737 AGGATGGGTGAGTAGACGGATGG + Intergenic
1106605608 13:31225751-31225773 AAGATGGGGGAAAAAAGGGGTGG - Intronic
1108503556 13:51089514-51089536 AGAGAGGGCGAGCAAAGGGGAGG - Intergenic
1111327538 13:86719031-86719053 AGGAGGGGCAAGAAAAGGGTAGG - Intergenic
1113340285 13:109416284-109416306 TGGATGGGCGGGTGAAGAGGAGG - Intergenic
1113641433 13:111960171-111960193 AGGATGGGTGAATAGAGGGATGG + Intergenic
1113852333 13:113424868-113424890 TGGATGGGTAAGTAAATGGGTGG - Intronic
1115620699 14:35137194-35137216 AGGATGGTGGAGTCAAGGGAGGG + Intronic
1117869867 14:60188974-60188996 GGGATGGGAGAATAAAGGAGGGG - Intergenic
1118461137 14:65988395-65988417 AGGATGGTCCAGTCAAGTGGTGG - Intronic
1118663176 14:68037194-68037216 AGGAGGGGAGGGGAAAGGGGAGG - Intronic
1119218912 14:72891240-72891262 AGGATGGGGGGATAAAGTGGTGG - Intronic
1119713941 14:76844916-76844938 AGGAAGGGACAGCAAAGGGGAGG + Intronic
1120335559 14:83149854-83149876 AGAATGGGAGATTAAAGGGCTGG + Intergenic
1121048310 14:90803737-90803759 AGGATGGGAGAGTAAAGTGTGGG + Intronic
1121451677 14:94012242-94012264 AGGGGAGGGGAGTAAAGGGGAGG - Intergenic
1122298360 14:100718047-100718069 AGTAAGGGCGGGTGAAGGGGGGG - Intergenic
1122791419 14:104185613-104185635 GGGTTGGGGGAGTAAAGGGATGG + Intergenic
1125478064 15:40061005-40061027 AGGAGGGGTGCGTAAAAGGGAGG + Intergenic
1128220538 15:65965249-65965271 AGGAGGAGAGAGAAAAGGGGAGG - Intronic
1129952732 15:79606404-79606426 AGGATAAGAGAGTGAAGGGGAGG + Intergenic
1131360213 15:91784038-91784060 GGGATGAGCAAGCAAAGGGGAGG + Intergenic
1131885546 15:96907999-96908021 AGGATGGGCGGGGGGAGGGGGGG + Intergenic
1132065330 15:98726274-98726296 ACGATGGGAGAGTAATGGGCAGG - Intronic
1132599485 16:767531-767553 AGGAGGGGCGCGTGGAGGGGGGG + Intronic
1132644753 16:993757-993779 TGGATGGGTGAGTAAATGGGTGG - Intergenic
1133531193 16:6656952-6656974 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1133531199 16:6656972-6656994 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1133531205 16:6656992-6657014 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1133531211 16:6657012-6657034 AGGACAGGAGAGGAAAGGGGAGG - Intronic
1133531217 16:6657032-6657054 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1133531223 16:6657052-6657074 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1133531234 16:6657087-6657109 AGGAGAGGAGAGTAAAGGGGAGG - Intronic
1133839243 16:9393992-9394014 AGGAAGGGGGAGGGAAGGGGAGG - Intergenic
1134435801 16:14255667-14255689 AGGATGGGGGAGGAAATGAGTGG + Intronic
1135435529 16:22424585-22424607 AGGCTGGGGGAGCAAAGCGGTGG - Intronic
1135648864 16:24188018-24188040 AGGGCGGGCGTGTGAAGGGGAGG - Intronic
1136712789 16:32253748-32253770 AGGCGGGGTGAGAAAAGGGGCGG - Intronic
1136755127 16:32675681-32675703 AGGCGGGGTGAGAAAAGGGGCGG + Intronic
1136812986 16:33194688-33194710 AGGCGGGGTGAGAAAAGGGGCGG - Intronic
1136819462 16:33304768-33304790 AGGCGGGGTGAGAAAAGGGGCGG - Intronic
1136826025 16:33361303-33361325 AGGCGGGGTGAGAAAAGGGGCGG - Intronic
1136831091 16:33460074-33460096 AGGCGGGGTGAGAAAAGGGGCGG - Intronic
1137029215 16:35506536-35506558 AGGCTGTGTGAGAAAAGGGGCGG + Intergenic
1137056060 16:35747205-35747227 AGGGTGAGAGAGTCAAGGGGCGG - Intergenic
1138159487 16:54740135-54740157 AGCATGAGGGAGGAAAGGGGAGG - Intergenic
1138765697 16:59600417-59600439 AGAATGGGAGAGTAAAATGGGGG + Intergenic
1139436975 16:66941999-66942021 AGGAAGGGGGAGCAAAGGCGAGG - Intronic
1139612233 16:68067270-68067292 AGGAGGGGAGAGGAGAGGGGAGG - Intronic
1140043606 16:71425443-71425465 GGGATGGGCGAGTGGATGGGTGG - Intergenic
1140309070 16:73831765-73831787 AGGATGGGCAAGGGAAGGGGCGG + Intergenic
1141178365 16:81735362-81735384 TGGATGGGTGAATAAATGGGTGG + Intergenic
1141389470 16:83652573-83652595 ATGAGGGGCCAGTAAAGAGGGGG - Intronic
1142044729 16:87918390-87918412 AGGCTGGGGGAGCAAAGCGGGGG - Intronic
1202991563 16_KI270728v1_random:17658-17680 AGGCGGGGTGAGAAAAGGGGCGG - Intergenic
1203057269 16_KI270728v1_random:936020-936042 AGGCGGGGTGAGAAAAGGGGCGG + Intergenic
1143510843 17:7394351-7394373 AGGATGGGAGAACAAAGGGAGGG - Exonic
1143638718 17:8182576-8182598 AGGATGGGGGAGCCGAGGGGAGG + Intergenic
1144294766 17:13863267-13863289 AGGAGAGGAGAGGAAAGGGGAGG + Intergenic
1146427902 17:32761281-32761303 TGGATTGAAGAGTAAAGGGGAGG - Intronic
1147193632 17:38750682-38750704 AGGGTGGGTGAGTACTGGGGTGG + Exonic
1151553906 17:74837079-74837101 AGGATGGGGCAGGAGAGGGGAGG - Exonic
1152355208 17:79803523-79803545 AGGCTGGGCGAGTCAAGGAATGG + Intergenic
1153503337 18:5770612-5770634 AGGATGAGGGGGGAAAGGGGAGG + Intergenic
1153805241 18:8705131-8705153 GGGAGGGGCGAGGGAAGGGGCGG - Intergenic
1155532947 18:26786012-26786034 AGGCTGGGAGAGAAAAGAGGTGG + Intergenic
1157618771 18:49003344-49003366 AGGAGGGGGGAGGAAGGGGGAGG - Intergenic
1161022390 19:2016144-2016166 AGGAGGGGCCTGTAGAGGGGAGG + Intronic
1161171318 19:2813735-2813757 GGGGTGGGGGAGTAAAGGGCTGG + Exonic
1161565455 19:4999685-4999707 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565507 19:4999881-4999903 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565525 19:4999953-4999975 TGGATAGGTGAGTAAATGGGTGG - Intronic
1161565575 19:5000138-5000160 TGGATAGGTGAGTAAATGGGTGG - Intronic
1162420847 19:10565438-10565460 AGGATGAAAGAGGAAAGGGGGGG + Intronic
1163074420 19:14876649-14876671 AGGGTTGGGGAGGAAAGGGGAGG - Intergenic
1163403046 19:17105987-17106009 AGGAGAGGCGAGGAGAGGGGAGG - Intronic
1165457981 19:35925964-35925986 AGGATGGGGGAAGAAAGGGGAGG - Intergenic
1166201815 19:41242635-41242657 AGGATGGGTGAGTTAAGAGTGGG - Intronic
1166856054 19:45783092-45783114 AGGCTGGGGGAGGAAAGTGGTGG + Exonic
1167144186 19:47672210-47672232 AGGATGGGTAAGTAGATGGGTGG + Intronic
1167144233 19:47672394-47672416 AGGATGGGTAAGTAGATGGGTGG + Intronic
1167249934 19:48394301-48394323 AGAGTGGGGGAGTCAAGGGGGGG + Intergenic
1167388773 19:49180721-49180743 TGGATGGGCGATTAAAGGGAAGG - Intronic
1168094694 19:54107941-54107963 AGGAGGGGGGACTCAAGGGGAGG - Intronic
1168698615 19:58421048-58421070 AGAATGGGCTAGAAAATGGGTGG + Intergenic
925012520 2:496433-496455 AGGAGGAGCGGGTACAGGGGAGG - Intergenic
925890427 2:8429751-8429773 AGGATGAGCCAGCACAGGGGTGG - Intergenic
925904224 2:8529671-8529693 GGGATGGAGGAGTAGAGGGGTGG - Intergenic
926283371 2:11468113-11468135 GGGTTGGGCAAGTAAAGGTGGGG + Intergenic
927020073 2:19007366-19007388 AGGGTGGACCAGTAAAGGAGAGG + Intergenic
927438446 2:23090574-23090596 AGGAGAGGAGAGCAAAGGGGAGG + Intergenic
932115782 2:69045587-69045609 AGGAAGGGCCAGTACAGGGGGGG + Intronic
932780820 2:74557245-74557267 GGGATGGGAGAGTCAAGGGAAGG + Exonic
936539360 2:113337495-113337517 AGGATGAGATAGTGAAGGGGAGG - Intergenic
937027639 2:118712356-118712378 AGGATGGGGGAGGGGAGGGGAGG + Intergenic
937354389 2:121188847-121188869 AGGATGGGCAGATAAATGGGTGG + Intergenic
938612889 2:132967575-132967597 AGGATTGGGGAGAAAAGGAGGGG + Intronic
939634129 2:144560506-144560528 AGGAGAGGCGAGGAGAGGGGAGG - Intergenic
942098479 2:172555948-172555970 AGGCGGGGAGAGAAAAGGGGCGG - Intronic
942714956 2:178881636-178881658 AGGATGAGCAAGTAGAGGTGAGG + Intronic
942944285 2:181656656-181656678 AGGGGAGGCGAGAAAAGGGGAGG + Intronic
944832741 2:203549147-203549169 AGGAGGAGAGAGGAAAGGGGAGG - Intergenic
946185665 2:217979065-217979087 AGGTGGGGGGAGCAAAGGGGGGG + Intronic
948234455 2:236377960-236377982 AGGATGGGAGAATAAAGAAGAGG - Intronic
948432335 2:237927696-237927718 AGGCTGGAAGAGGAAAGGGGCGG + Intergenic
948596531 2:239082889-239082911 AGGATGGGCGGGCGAGGGGGTGG + Intronic
948677644 2:239608181-239608203 AGAAAGGGAGTGTAAAGGGGGGG - Intergenic
1169101767 20:2956391-2956413 AGGGTGGGTGAGGAAAGGGTGGG - Intronic
1171004875 20:21454524-21454546 AGGATGGGCTAGCAGAGGGAGGG + Intergenic
1173952194 20:47002130-47002152 AGGATGGGGGACGAAAGGGGAGG - Intronic
1175817854 20:61892983-61893005 TGGATGGGTGAGTAGAGGGATGG + Intronic
1175892270 20:62321142-62321164 AGGTGGGGCCAGTGAAGGGGCGG + Intronic
1175934888 20:62509981-62510003 AGGATGGAGGGGTGAAGGGGTGG - Intergenic
1176314313 21:5227637-5227659 AGGAAGGGCGAGGAAAGGAAAGG - Intergenic
1178307698 21:31504120-31504142 AGCATGGGCGTGCAAAGGGCTGG + Intronic
1179447116 21:41439888-41439910 GGGATGGGGGAGTGGAGGGGTGG + Intronic
1180090043 21:45529237-45529259 AGGATGGGGAAGTACAGGGCCGG + Intronic
1180339315 22:11605646-11605668 AGGGTAGGCGAGTGAAGGTGGGG + Intergenic
1181425877 22:22838409-22838431 AGGAAGGGTGAGTAGAGGAGAGG - Intronic
1181519308 22:23436255-23436277 GGGATGGTTGAGTAAAGGGTGGG + Intergenic
1181822589 22:25487451-25487473 TGGATGGGTGAGTGAATGGGTGG + Intergenic
1183009688 22:34934689-34934711 AGGATGGGAGGGTAAAGGTCTGG - Intergenic
1183073850 22:35414122-35414144 AGGATGGCCGAGGAGATGGGAGG + Intronic
1183261789 22:36800083-36800105 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1183261838 22:36800257-36800279 TGGATGGGTGAGTAGATGGGTGG - Intergenic
1185409833 22:50676069-50676091 TGCATGGGTGAGTAAAGGAGGGG - Intergenic
950040138 3:9915010-9915032 AGGCTGGGCGAGTACAGCGCAGG - Intronic
953853896 3:46485985-46486007 CGGAAGGGGGAGGAAAGGGGAGG - Intergenic
954432939 3:50480893-50480915 AGGAAGGGGGAGGAAAGGGGAGG + Intronic
954432949 3:50480913-50480935 AGGAAGGGGGAGGAAGGGGGAGG + Intronic
954432954 3:50480923-50480945 AGGAAGGGGGAGGAAGGGGGAGG + Intronic
955064673 3:55524172-55524194 TGTATGGGCGAGTATAGAGGGGG - Intronic
955874748 3:63477118-63477140 TGGTTGGGCGAGTAACTGGGAGG + Intronic
960628286 3:119702846-119702868 AGGATGGGGGAGGAAAAGGCTGG - Intergenic
960815030 3:121663386-121663408 AGGATGGGGGAGGGGAGGGGAGG + Exonic
960932891 3:122872800-122872822 GGGGTGGGGGAGTACAGGGGCGG - Intronic
964213817 3:154256916-154256938 AGGATGGGAGATTAAGAGGGGGG + Exonic
964671348 3:159229725-159229747 AGGATGGGGGAGGATGGGGGAGG - Intronic
967448758 3:189598261-189598283 AGGAAGGGAGAGTAGAGGAGGGG + Intergenic
967712346 3:192723888-192723910 AGGAGAGGAGAGGAAAGGGGAGG + Intronic
968266973 3:197369908-197369930 AGGATGGATGGGGAAAGGGGAGG - Intergenic
969524042 4:7695293-7695315 TGGATGGGTGAGTGAATGGGTGG + Intronic
969550992 4:7867094-7867116 AGGAGAGGGGAGTAGAGGGGAGG + Intronic
970584697 4:17503957-17503979 AGGGTAGGGGAGTAGAGGGGAGG + Intronic
971661675 4:29426052-29426074 AGGAAGGGCGAGAAGGGGGGGGG - Intergenic
971857622 4:32062567-32062589 AGGATGGGAGAGAAAAGGCAGGG + Intergenic
972127752 4:35790221-35790243 AGGATGGGGGAGAGGAGGGGAGG + Intergenic
972278968 4:37585168-37585190 AGGAGGGGAGAGGAGAGGGGAGG + Intronic
973864188 4:55095319-55095341 GGTATGAGCGAGGAAAGGGGAGG - Intronic
977349759 4:95867584-95867606 AGGAAGAGAGAGTGAAGGGGAGG - Intergenic
977763587 4:100771136-100771158 AGGATAGGGGAGGAGAGGGGAGG + Intronic
982478139 4:155877738-155877760 AGGATGGGCAAATAAATGGTGGG - Intronic
984703198 4:182831963-182831985 AGGAGGGGAGAGGAAAAGGGGGG - Intergenic
984831837 4:183983174-183983196 AGGATGGGCGAGTAAAGGGGTGG - Intronic
985288764 4:188364554-188364576 AGGATTGGGGAGCAAAGGAGAGG - Intergenic
985942181 5:3145607-3145629 AGGAAGGGGAAGTAAAGGAGTGG + Intergenic
987729078 5:21744392-21744414 AGGATGGGAGAGGAGAGGAGAGG + Intergenic
991016909 5:61942520-61942542 AGGGAAGGCGAGGAAAGGGGAGG + Intergenic
994690683 5:103015899-103015921 ATGATGGGGGAATAAAGGTGAGG - Intronic
995157222 5:108930349-108930371 AGGAGGGGAGAGGAGAGGGGAGG - Intronic
995181305 5:109233233-109233255 AGGATGGACTAAAAAAGGGGGGG + Intergenic
995275935 5:110277850-110277872 AGGTTGGGCGGGAAAAGGAGAGG - Intergenic
998164519 5:139835349-139835371 AGGATGGGTGAGTGAATGGATGG - Intronic
998424926 5:142018499-142018521 AGGATGTTGGAGTATAGGGGTGG - Intergenic
999710290 5:154312363-154312385 AGGATTGGAGCGTAAAGTGGGGG - Intronic
1001014567 5:168128520-168128542 GGGAAGGGGGAGCAAAGGGGAGG - Intronic
1001151629 5:169233797-169233819 AGGAAGGGAGAGAAAAGGGAGGG - Intronic
1001175725 5:169467234-169467256 AGGCTGGGGGAGAAAAGGAGGGG + Intergenic
1001406512 5:171480948-171480970 AGGATGGCAGAGCCAAGGGGAGG + Intergenic
1002710024 5:181189935-181189957 AGGAGGGGCGAGGACAGTGGCGG - Intergenic
1003285230 6:4728402-4728424 AGGATGGGGGAGTGAAGAGGAGG - Intronic
1004771375 6:18786167-18786189 GGGATGGGAGAGGAGAGGGGAGG - Intergenic
1005016511 6:21379823-21379845 AGAATGGGCCAGTCGAGGGGTGG + Intergenic
1006510567 6:34519051-34519073 AGGAAGGGAGAGCACAGGGGTGG + Intronic
1006536647 6:34704577-34704599 AGGAGGGAAGAGTAAAGGGTAGG + Intergenic
1006825379 6:36930864-36930886 AGGATGGTCCAGTAGAGGAGGGG - Intergenic
1007838997 6:44700483-44700505 AGGATGGCAGAGTAACAGGGTGG + Intergenic
1008863213 6:56176850-56176872 ATGAAGGGAGAGGAAAGGGGAGG + Intronic
1008863237 6:56176909-56176931 AGGAAGGGGGAGGAAGGGGGAGG + Intronic
1012244231 6:96908741-96908763 AGGATAGGGCAGTAAAGGGAGGG - Intergenic
1013246596 6:108293580-108293602 GGGAAGGGGGAGTGAAGGGGAGG - Intergenic
1013246606 6:108293602-108293624 GGGAAGGGGGAGTGAAGGGGAGG - Intergenic
1015849000 6:137552404-137552426 AGGAAGGGGGAGGAAGGGGGAGG - Intergenic
1018155911 6:160984752-160984774 AGGAAGAGAGAGTGAAGGGGAGG - Intergenic
1020040540 7:4997642-4997664 AGGATAGGGGAGCTAAGGGGTGG - Intronic
1020629310 7:10621424-10621446 AGGATGGAAGAGTTAATGGGAGG - Intergenic
1022797302 7:33742389-33742411 AGGACTGGAGAGTAAGGGGGAGG + Intergenic
1022805124 7:33813953-33813975 AGGATGGTTGAGGAAAGGGAGGG + Intergenic
1023883790 7:44336301-44336323 AGAAAGAGCAAGTAAAGGGGCGG + Intergenic
1024146630 7:46523512-46523534 AAGAGGGGGGAGGAAAGGGGAGG - Intergenic
1026497308 7:70914268-70914290 AGGACGGGAGAGGAAAGGGGAGG - Intergenic
1028843529 7:95453767-95453789 AGGATAGGGGAGGAGAGGGGAGG - Intergenic
1028996466 7:97105517-97105539 AGGATGGTCGCTTAAAGGGGAGG + Intergenic
1029706249 7:102277919-102277941 GGGAGGGGCAAGGAAAGGGGTGG - Intronic
1029714577 7:102318935-102318957 AGGATGGGGGAACAAAGGGTGGG + Intronic
1033159017 7:138980991-138981013 AGGATGGGCGGGGAAAGCCGGGG + Intronic
1033420168 7:141198615-141198637 AGGATGGGCCAGCAAGGGGAAGG - Intronic
1034164985 7:149018809-149018831 AGGAGGGGGGAGTAGTGGGGTGG - Intronic
1035253925 7:157614148-157614170 AGGAAGGGGGAGGACAGGGGAGG + Intronic
1035435856 7:158858832-158858854 AGGAAGGGAGGGGAAAGGGGAGG - Intronic
1036550926 8:9814578-9814600 AGGAGGGGAGAGGAGAGGGGAGG - Intergenic
1036550960 8:9814678-9814700 AGGAGGGGAGAGGAGAGGGGAGG - Intergenic
1038021269 8:23553525-23553547 AGGCTGGCAGAGTCAAGGGGAGG + Intronic
1039333894 8:36568924-36568946 AGGAAGGGCCAGCCAAGGGGAGG + Intergenic
1042990069 8:74629469-74629491 AGGATGGAAGAGTAAAAGGAAGG + Intronic
1044283318 8:90381415-90381437 AGGATGGGCCTGTCATGGGGTGG + Intergenic
1044747917 8:95389124-95389146 AGACTGGGGGAGCAAAGGGGAGG + Intergenic
1049097502 8:140557691-140557713 AGTATGGGTGAGTGAGGGGGAGG + Intronic
1049861193 8:144900886-144900908 GGGATGGGCCCGGAAAGGGGTGG - Intronic
1050494245 9:6223877-6223899 AGGATGGTAGAGTAGAAGGGTGG - Intronic
1051240450 9:15050079-15050101 AGGAGGGGAGAGGAGAGGGGAGG + Intergenic
1055829014 9:80358703-80358725 AGGGTGGGAGAGGAAAGAGGAGG + Intergenic
1055936476 9:81609061-81609083 AGGAGAGGAGAGGAAAGGGGAGG - Intronic
1056038025 9:82629808-82629830 TGAATGGGCGGGTAATGGGGAGG + Intergenic
1056265217 9:84890171-84890193 GGGAGGGGGAAGTAAAGGGGAGG - Intronic
1058537728 9:105979233-105979255 AGGATGAGAGAGTATAGGGAGGG - Intergenic
1058944233 9:109841700-109841722 AGGATGGAGGGGTAGAGGGGAGG + Intronic
1059252152 9:112895515-112895537 ATGATGGGTGGGTAAATGGGTGG - Intergenic
1060756548 9:126218449-126218471 AGGATGTGCCAGGGAAGGGGAGG + Intergenic
1061212755 9:129203184-129203206 AGGGTGGGGGAGTCAAGGGTGGG - Intergenic
1061387603 9:130299711-130299733 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061387633 9:130299843-130299865 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061387640 9:130299867-130299889 TGGATGGGTGAGTGAATGGGTGG - Intronic
1061789642 9:133052291-133052313 AGGATGGGCCAGGATGGGGGTGG - Intronic
1062135501 9:134925280-134925302 AGGATGGGGGAGAAAAGGGAGGG - Intergenic
1062464814 9:136676299-136676321 AGGCTGGGCAGGTAGAGGGGTGG - Intronic
1062533928 9:137013409-137013431 GGGTGGGGCGAGTGAAGGGGCGG - Intronic
1203449904 Un_GL000219v1:102188-102210 AGGGTGGGGGAGTAATGGGAAGG + Intergenic
1185583264 X:1226934-1226956 AGGATGGGTGAGTGGATGGGTGG + Intergenic
1185583305 X:1227118-1227140 AGGATGGGTGAGTGGATGGGTGG + Intergenic
1190632896 X:52405771-52405793 AGGATGGGGGATTAGAGGGTTGG - Intergenic
1192580531 X:72277410-72277432 AGGAAGGGCGGAAAAAGGGGAGG - Intronic
1194785233 X:98075642-98075664 AGAATGGGAAAGTAAAGGGAGGG + Intergenic
1195237841 X:102919290-102919312 AGGAGGGGAGAGGAAAGGAGAGG - Intergenic
1197638488 X:128942543-128942565 AGGGAGGGAGAGCAAAGGGGTGG - Intergenic
1198107988 X:133479118-133479140 AGGATGGGAGAGAAAAGGGTAGG + Intergenic
1199772497 X:150983739-150983761 CGGCTGGGCGAGCAGAGGGGCGG + Intronic