ID: 984832262

View in Genome Browser
Species Human (GRCh38)
Location 4:183986781-183986803
Sequence CCAGAGCCTGAGCTCTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 347}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984832262 Original CRISPR CCAGAGCCTGAGCTCTGTTG GGG Intronic
900103780 1:973739-973761 CCCAAGCCTGAGGTCTGTTCAGG + Intronic
903658865 1:24965020-24965042 CCAGAGCCTGGGCTCTGTCAAGG - Intronic
903744616 1:25578105-25578127 GAAGAGCCAGAGCCCTGTTGGGG - Intergenic
906556993 1:46721846-46721868 CCAGAGCCTGTGCTCTCTGTGGG + Intergenic
907576098 1:55527159-55527181 CCAGACCCTGAACTCTGTGAGGG + Intergenic
909185385 1:72480175-72480197 CCACAGCCTGAGCTCTATGTTGG + Intergenic
909200759 1:72687690-72687712 CCATAGCCTGAGCTCTATGTTGG + Intergenic
911229013 1:95340159-95340181 CTATAGTCTGAGCTCTGTTAGGG + Intergenic
911686288 1:100780832-100780854 CCACAGCCTGAGCTCTATGTTGG + Intergenic
914245678 1:145884350-145884372 CAAGAGTATGAACTCTGTTGAGG - Intronic
915243022 1:154537306-154537328 CCAGAACGTGAGCTTTGTGGTGG + Intronic
915575295 1:156771884-156771906 CAGGAACCTGAGATCTGTTGGGG + Intronic
916852567 1:168718558-168718580 CCAGAGCCGGATCTTTGTGGGGG + Intronic
917091797 1:171360163-171360185 GCAGAGCTTGAGCACTGTTCTGG - Intergenic
917472530 1:175337799-175337821 CCACACCTTGAGCTCCGTTGAGG - Intronic
917892426 1:179452993-179453015 CCACAGCCTGAGCTCTATGTTGG - Intronic
918051319 1:180975239-180975261 CCAGAGCCAGAACTCGGTGGTGG - Exonic
918245751 1:182657556-182657578 CAACTGCCTGAGATCTGTTGGGG - Intronic
918711552 1:187737056-187737078 CCACAGCCTGAGCTCTATATTGG + Intergenic
920597921 1:207291746-207291768 CCATGGCCTGAGCTCTGTGTTGG - Intergenic
920666739 1:207968483-207968505 CCAAAGCCTGTGCTGTGGTGGGG + Intergenic
920673161 1:208020240-208020262 CCAGGGTCTGTGCTCTGTTCTGG + Intergenic
920895985 1:210049789-210049811 CCACGGCCCGAGCTCTGTGGTGG + Intronic
921378302 1:214497091-214497113 CCAGAAATTGAGCTCTATTGGGG + Intronic
921747766 1:218756908-218756930 CCAGAGGCTGTGCTGTGGTGGGG + Intergenic
921904493 1:220482390-220482412 CAAGACCCTGGGGTCTGTTGGGG + Intergenic
1062830506 10:602373-602395 CCAGAGCCATTGCTCTGCTGTGG - Intronic
1063813622 10:9744519-9744541 CCACAGCCTGTGCTCTTTTCAGG + Intergenic
1065075941 10:22079797-22079819 ACAGAGTTTGAGCTCTGCTGAGG - Intergenic
1065857924 10:29845279-29845301 CTAGGGCCTGGGCTCAGTTGGGG - Intergenic
1067814687 10:49464709-49464731 CCACAGCCTGAGCTCTTTGTTGG - Intronic
1068229853 10:54157410-54157432 CCACAGCCTGAGCTCTATGTTGG + Intronic
1069264236 10:66438205-66438227 ACAGAGCTTGAGCTCTGCTAAGG - Intronic
1069622225 10:69844912-69844934 GGAGAGCCTGGGCTCTGTTTTGG + Intronic
1069803883 10:71105119-71105141 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1069825058 10:71249897-71249919 CCACAGCCTGAGCACTGGAGTGG - Intronic
1071345593 10:84688809-84688831 CCAGCGCCTGAACACTGTTAAGG - Intergenic
1071395389 10:85218555-85218577 CCACAGCCTGAGCTCTATATTGG - Intergenic
1071476670 10:86031590-86031612 CCAGAACCTGACCACTGTTTAGG + Intronic
1072305350 10:94101700-94101722 AGAGAGCCTGAGCTCTTTGGAGG + Intronic
1074965824 10:118490042-118490064 CCATGGCCTGAGCTCTATTTTGG - Intergenic
1075360855 10:121832400-121832422 TCAGACGCTGAGCTCTGTTAGGG - Intronic
1075543685 10:123337405-123337427 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1076464845 10:130671986-130672008 CCAGAGCCTGAGCTCTATGTTGG + Intergenic
1077467735 11:2741576-2741598 CCCAGGCCTGAGCTCTGTTCGGG + Intronic
1079032338 11:16994885-16994907 CAGGAGCCTGTGCTCTGGTGGGG - Intronic
1081077695 11:38696631-38696653 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1081875346 11:46404668-46404690 CCAGAGCCTCAGCTTAGCTGGGG + Intronic
1083335414 11:61918963-61918985 CCAGACCCTGAGCTGGGCTGGGG - Intronic
1083445828 11:62707509-62707531 CCTTGGCCTCAGCTCTGTTGGGG + Intronic
1083681675 11:64354400-64354422 CCAGATCCTGGGCTCCGCTGCGG - Intronic
1084121246 11:67070320-67070342 CCCCAGCCTGAGCTCTGATATGG - Intronic
1084270562 11:68027101-68027123 CCACAGCCTGAGCTCTGCCCAGG + Intronic
1084488293 11:69463819-69463841 GCCCAGCCTGACCTCTGTTGTGG - Intergenic
1084678657 11:70652048-70652070 CCAAGGCCAGAGCCCTGTTGTGG - Intronic
1084936169 11:72587878-72587900 CCCGGGCCTGAGGTCTGCTGGGG - Intronic
1085204100 11:74719996-74720018 CCATTGCCTGAGCTCTTTTCAGG + Intronic
1085588199 11:77731696-77731718 CCACAGCCTGAGCTCTGCATTGG - Intronic
1086759028 11:90603738-90603760 CCACAGCCTGAGCTCTATATTGG - Intergenic
1087084454 11:94202472-94202494 CCAGAGCTTGGTATCTGTTGGGG - Intergenic
1087130916 11:94668652-94668674 CCAGACCCTGAAGTCTGCTGGGG - Intergenic
1087868316 11:103261329-103261351 ACAGAGCTTGAGCTCTGCTAAGG + Intronic
1089331640 11:117693031-117693053 CTGGAGCCTGGGCTCTGATGTGG + Intronic
1089731051 11:120519071-120519093 CTAGAGCATGGGCTCTGTGGGGG + Intronic
1091022900 11:132116737-132116759 CAAAAGCGTGAGCTCTGCTGAGG + Intronic
1091089967 11:132762323-132762345 GCAGAGCCTGAGCCCTGTCCTGG + Intronic
1091302126 11:134514543-134514565 CCAGCACCTGAGCTCTGGTGTGG - Intergenic
1091473545 12:751994-752016 CCGGAGCCTGAGCTCTGAGTCGG - Intergenic
1093775245 12:23066162-23066184 CCAGTGCCTGAACTCTGTTTGGG + Intergenic
1096409352 12:51365799-51365821 ACAGAGCCAGAGCCCTGGTGAGG - Intronic
1096413022 12:51391027-51391049 CCAGAGCCTGGGGGCTTTTGGGG - Intronic
1098512385 12:71332008-71332030 CCAGAGGCTGAGCTGTGGGGAGG + Intronic
1099525905 12:83719256-83719278 CCATGGCCTGAGCTCTGTGTTGG - Intergenic
1101226592 12:102694008-102694030 CCAGAGCCAGCGCGCTGTGGGGG + Intergenic
1102248901 12:111372419-111372441 CCACAGCCTGAGCTCTGTGTTGG + Intergenic
1103588416 12:121973181-121973203 CCACAGCCTGAGCTCTATGTTGG - Intronic
1104198416 12:126564143-126564165 GCAGAGCCTGAGCTTTGTGAGGG - Intergenic
1104689693 12:130816181-130816203 CCAGCGCCTGAGCACAGCTGAGG + Intronic
1106810058 13:33350318-33350340 CCAGAGCCTGGGATCTGCTGTGG - Intronic
1109522494 13:63532029-63532051 CCACAGCCTGAGCTCTATGTTGG - Intergenic
1111083484 13:83342902-83342924 CCACAGCCTGAGCTCTATGTTGG - Intergenic
1112861268 13:103831451-103831473 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1114649044 14:24271528-24271550 CCAGCGCCTGGGCTCTGTGGCGG - Exonic
1114680758 14:24482058-24482080 CCAGAGGCTGAGCTGGGTTCTGG + Intergenic
1115822358 14:37225507-37225529 CCATGGCCTGAGCTCTATGGTGG + Intronic
1116182923 14:41558147-41558169 CCTTAGCCTGAGCTCTGTAAGGG + Intergenic
1118598000 14:67451042-67451064 CCACAGCCTGAGCTCTATGTTGG - Intronic
1118763248 14:68893503-68893525 GGGCAGCCTGAGCTCTGTTGTGG - Intronic
1119200542 14:72748743-72748765 CCACAGCCTGAGCTCTATGTTGG - Intronic
1119657923 14:76430813-76430835 CCAGAGCCTCATCCCTGCTGGGG - Intronic
1120221781 14:81742523-81742545 GCAGAGCCAGAGCTCTAGTGGGG + Intergenic
1120271733 14:82321594-82321616 ACAGCGCCTGAGCTCTGCTAAGG - Intergenic
1120773784 14:88410886-88410908 CCAGTGCTTGAGCTCTGCTAAGG - Intronic
1121286515 14:92740277-92740299 CCAGAGACTGGGATGTGTTGCGG + Intronic
1121823766 14:96993540-96993562 CCATAGCCTCATCTCTGCTGAGG + Intergenic
1121940543 14:98066280-98066302 ACACAGCCTCAGCTCTTTTGAGG + Intergenic
1202888352 14_KI270722v1_random:130601-130623 CCAGATCATGAGCTCCTTTGAGG + Intergenic
1124384458 15:29195022-29195044 TCAGTGCCTGAGGTCTGCTGTGG - Intronic
1125471712 15:40010932-40010954 CCAGAGCCTGGCCTTTGTTAGGG + Intronic
1125673035 15:41487072-41487094 CTAGATCCTGAGCCCTGCTGAGG + Intergenic
1127389083 15:58490877-58490899 CCAGAGCCTGAGAAGTGTGGAGG + Intronic
1128085549 15:64883994-64884016 CCAGAACCTGAATTCTGTTCCGG + Intronic
1128418067 15:67465349-67465371 CCACTGCCTGAGCTCTGTCTAGG + Intronic
1128458091 15:67844225-67844247 CCAGAGCCCTTGCTCTGCTGGGG + Intergenic
1128569328 15:68722132-68722154 CAAGGGCCTGAGCTCAGTTCTGG + Intronic
1128883735 15:71266086-71266108 CCAGAGCTTGAGCGCTGTGATGG - Intronic
1128891882 15:71338855-71338877 CCAGACCCTGACCTCAGTTCTGG - Intronic
1129620165 15:77137015-77137037 CCACAGCCTGAGCTCTACAGTGG - Intronic
1131531203 15:93193616-93193638 CCAGAAGCTCAGCTCTGTTTTGG + Intergenic
1133833416 16:9345178-9345200 CCAGACCTTGAGCTCTGCGGGGG - Intergenic
1134440756 16:14298487-14298509 CCAGAGGCTGAGCACGGCTGCGG + Intergenic
1135166319 16:20142132-20142154 CCAGAGACTGTGCTGTGTGGAGG + Intergenic
1136025152 16:27464163-27464185 TCAGAGCCTGAGCCCTGAGGGGG - Intronic
1136674800 16:31893206-31893228 CCACAGCCTGAGCTCTGTATTGG + Intronic
1137500812 16:49010609-49010631 CCAGATCCAGAGCTCTCCTGGGG + Intergenic
1137661505 16:50210704-50210726 TCAGAGCCTGCCCTCTGCTGGGG + Intronic
1137828155 16:51517409-51517431 ACAGTGCCTGAGCTCTGCTAAGG + Intergenic
1137944387 16:52719699-52719721 CCAGAGCCTTTGTTCTGTTAGGG - Intergenic
1138718012 16:59046453-59046475 CCAGAGGCTGTGCTGTCTTGTGG - Intergenic
1139136524 16:64211511-64211533 CCAGAGTGTGAGGTCTGGTGTGG + Intergenic
1139699834 16:68701262-68701284 TCAGAGCCTGGGCTCTGTGATGG + Intronic
1140896971 16:79333285-79333307 CCAGAGTCTGAGCTCAGGTGGGG - Intergenic
1140952866 16:79835890-79835912 GCAGAGACTGAGCTAGGTTGAGG + Intergenic
1141281587 16:82634181-82634203 CCAGAGGCTGAGCTCATTTCCGG - Intronic
1141515216 16:84539635-84539657 CCAGATCCTGAGCTCTTTGAGGG - Intronic
1141581017 16:84998713-84998735 TGAGAGCTGGAGCTCTGTTGGGG - Intronic
1141696298 16:85621255-85621277 CCTGGGTCTGTGCTCTGTTGGGG + Intronic
1141880861 16:86858259-86858281 CAAGAGCCTGAGCACAGTTTTGG - Intergenic
1141903470 16:87007605-87007627 CCAGAGCCTGAGCACTTCTAGGG + Intergenic
1142164408 16:88578201-88578223 CTAGAGCCTGACCTCTGGAGAGG + Intronic
1142320040 16:89375956-89375978 CCGCAGCCTGTGCTCTGCTGTGG + Intronic
1142326151 16:89415991-89416013 CCTTAGCATGAGGTCTGTTGTGG - Intronic
1143992479 17:10978024-10978046 CCAGAACATGAGCTATGTAGTGG - Intergenic
1144626488 17:16846755-16846777 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1144879944 17:18425956-18425978 CCTGACCCTGAGGTCTCTTGGGG + Intergenic
1145152289 17:20518428-20518450 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1146163639 17:30572635-30572657 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1146656288 17:34637095-34637117 CTAGATCCTGGGCTCTGTAGGGG - Intronic
1147580633 17:41625446-41625468 CCTGACCCTGAGGTCTCTTGGGG - Intergenic
1148772718 17:50076439-50076461 CCAGAGCCTGTGCCTGGTTGAGG - Exonic
1149646715 17:58246491-58246513 CCTGGGGCTGGGCTCTGTTGGGG - Intronic
1150156275 17:62856036-62856058 CTAGAGCCTGAGCCGTGATGTGG + Intergenic
1150326986 17:64265136-64265158 CAAGAGCCTGAGATCTGTGTGGG - Intergenic
1151064128 17:71131500-71131522 ACAGCGCTTGAGCTCTGTTAAGG - Intergenic
1151556250 17:74848146-74848168 GGAGAGCCTGACCTCTTTTGGGG - Intronic
1151698630 17:75730983-75731005 CCAGAGTCTGAGCCCTTCTGGGG + Intronic
1152263581 17:79280485-79280507 ACAGAGCTTGAGCTCCGGTGTGG - Intronic
1152557859 17:81063485-81063507 CCTGAGGCTGAGCTCTCCTGCGG + Intronic
1153396934 18:4633162-4633184 CCATAGACTGAGCTCTGCTCTGG + Intergenic
1153543200 18:6179465-6179487 CCAGGCTCTGGGCTCTGTTGAGG + Intronic
1153717800 18:7868710-7868732 GCAGAGCTTGAGCTCTGTGCTGG + Intronic
1153864560 18:9252178-9252200 CCTGATCCTGAGCTCTAGTGAGG - Intronic
1154355364 18:13620188-13620210 CCGGGGCCTGAGCCCTGCTGCGG + Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157148556 18:45191196-45191218 GCAGAGGCTGTGCCCTGTTGAGG + Intergenic
1157408808 18:47446609-47446631 CCATAGCCTGAGCTCTATATTGG - Intergenic
1158530560 18:58256293-58256315 CCAGCGCCTGGGCTCTGCCGCGG - Intronic
1159581387 18:70237350-70237372 GCAGTGCCTGAGCTCTGCTAAGG + Intergenic
1160798735 19:957352-957374 CCAGAGCCTGGGGGCTGCTGGGG - Intronic
1161326608 19:3667310-3667332 CCAGACACTCACCTCTGTTGGGG + Exonic
1163837610 19:19584580-19584602 CCACACCTTGAGGTCTGTTGGGG - Intronic
1165269951 19:34697291-34697313 ACAGTGCTTGAGCTCTGTTAAGG + Intergenic
1202663743 1_KI270708v1_random:97393-97415 CCAGATCATGAGCTCCTTTGAGG + Intergenic
926533599 2:14082711-14082733 GCAGAGCTTGAGCTCTGTGCCGG - Intergenic
927139225 2:20118361-20118383 CCAGAGCCTCATCACTGTGGTGG + Intergenic
927288288 2:21379277-21379299 CCACAGCCTGAGCTCTATGTTGG + Intergenic
927730133 2:25463916-25463938 ACAGAGCCCAGGCTCTGTTGAGG - Intronic
929557224 2:42933016-42933038 CCAAGGCCAGAGCTCTCTTGAGG + Intergenic
930263122 2:49170239-49170261 TCACAGCCTGAGCTCTGTGTTGG - Intergenic
930854259 2:55995636-55995658 CCAGAGCCTGTGTTTGGTTGTGG - Intergenic
931648819 2:64450449-64450471 CCACAGCCTGAGCACTGATGTGG - Intergenic
932614974 2:73226111-73226133 CCAGGGCATGAGGTCTGGTGGGG - Exonic
933673676 2:85033734-85033756 CCACAGCATGAGCTTTGGTGGGG + Intronic
934521619 2:95023689-95023711 CCAGAGGCTGGGCTCTGCTTGGG + Intergenic
934738358 2:96701857-96701879 CCAGGTTCTGAGGTCTGTTGAGG - Intergenic
935178217 2:100667995-100668017 CCAGAGCTTGAGTTCCTTTGTGG + Intergenic
935961550 2:108430072-108430094 GCAGAGCTTGAGCACTGTTCTGG - Intergenic
936831843 2:116656133-116656155 CCACAGCCTGAGCTCTATGTTGG + Intergenic
937121771 2:119445368-119445390 CCAGAGGCTGAGTTCTCTGGAGG + Intronic
937434814 2:121871568-121871590 CCAGAGGCTGAGCTCTATGCTGG + Intergenic
937834516 2:126458960-126458982 TCAAAGCCAAAGCTCTGTTGAGG + Intergenic
939180434 2:138796567-138796589 GCAGAGCTTGAGCTCTGTTTTGG - Intergenic
939781049 2:146448194-146448216 TCAGAACCTGTGCCCTGTTGTGG - Intergenic
940008560 2:149032052-149032074 CAAGAGGCTGAGCTCTCCTGGGG + Intergenic
942411098 2:175709737-175709759 GCAGAGCTTGAGCTCTGTGCTGG - Intergenic
944010161 2:194965218-194965240 CCACAGTCTGAGCTCTGTGTTGG + Intergenic
944828015 2:203504401-203504423 CCACAGCCTGAGCTCTATGTTGG + Intronic
945075014 2:206030134-206030156 CCTTACCCTGACCTCTGTTGTGG - Intronic
945196058 2:207238581-207238603 GCTGAACCTGATCTCTGTTGTGG - Intergenic
947270329 2:228327371-228327393 CCAGAGACTGAGCACTGTGTGGG + Intergenic
1169305656 20:4488162-4488184 CCAGAGCCTGAGTTCTTTCCTGG + Intergenic
1170291468 20:14774504-14774526 CCACAGCCAAAGCTCTGCTGGGG - Intronic
1170370271 20:15640508-15640530 CCAGAGGCTCCGCTCTGCTGTGG + Intronic
1170823349 20:19772649-19772671 CCTGAGCCAGACCTCTGTTCAGG + Intergenic
1171187087 20:23130224-23130246 ACGCAGCCTGAGCCCTGTTGAGG + Intergenic
1172535881 20:35672871-35672893 CCAGTGCCAGAGCTCTGATGGGG - Intronic
1172593792 20:36135637-36135659 CCAGAGCCTCAGATATGTAGAGG - Intronic
1173081453 20:39872047-39872069 CCAGAGCCTGTGCTCTTTGAAGG - Intergenic
1173163756 20:40671692-40671714 CCTGAGCCCAAGGTCTGTTGAGG - Intergenic
1174307120 20:49621126-49621148 CCAGCCTCTGAGCTCTGGTGAGG - Intergenic
1175041005 20:56050525-56050547 ACAGTGCCTGAGCTCTGCTAAGG + Intergenic
1175725101 20:61312769-61312791 GCAGAGCTCGAGCTCTGTTCTGG - Intronic
1175785242 20:61708068-61708090 CCAGGACCTGGGCTCTGCTGGGG + Intronic
1175966945 20:62664546-62664568 CCAGAGCTTCAGCTCAGGTGGGG - Intronic
1176422897 21:6530753-6530775 TCAGACCTTGACCTCTGTTGGGG + Intergenic
1176946523 21:14989067-14989089 CCTGTACCTGAGCTTTGTTGAGG + Intronic
1177118169 21:17110166-17110188 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1178538306 21:33428622-33428644 CCAGATCTTGAGCTCTGATATGG - Intronic
1179231191 21:39505287-39505309 CCAGAACATAAGCTCTGTGGGGG - Intronic
1179332056 21:40412964-40412986 CCACAGCCTGAGCTCTATGTTGG - Intronic
1179571547 21:42281537-42281559 CCAGAGCCTGTGCCGTGGTGTGG + Intronic
1179971010 21:44836488-44836510 CCAGAGCCTGGGAACTGTGGAGG + Intergenic
1180080138 21:45482910-45482932 CGAGAGAGTGAGCTCTCTTGGGG + Intronic
1180150985 21:45947715-45947737 CCAGAGCCCAACCTCTGTTCAGG - Intergenic
1180330472 22:11474277-11474299 CCAGATCATGAGCTCCTTTGAGG + Intergenic
1180707978 22:17821415-17821437 CCAAACCCTTACCTCTGTTGAGG + Exonic
1181421329 22:22801060-22801082 CCTGAGCCCCAGCTCTGCTGTGG + Intronic
1182021216 22:27083286-27083308 GCATAGCCAGAGCTCTGCTGTGG + Intergenic
1182104740 22:27681416-27681438 CCAGAGCAGGAGCTCTGTGAGGG - Intergenic
1183094049 22:35541511-35541533 CCAGATGCCCAGCTCTGTTGGGG - Intronic
1185079858 22:48703673-48703695 CCAGAGCATGAGCTTCGTGGTGG + Intronic
950690931 3:14657007-14657029 GTAAAGCCTGAGGTCTGTTGGGG - Intronic
952267573 3:31801416-31801438 CCAGAGTCTTAGGGCTGTTGGGG - Intronic
953381298 3:42474623-42474645 CCACACCCTGGGCTCTGTTGGGG - Intergenic
953749394 3:45597666-45597688 CCATAGCCTGAGTCCTGCTGGGG + Intronic
954147367 3:48641000-48641022 CCAGAGCCCGTGCTCTGATCTGG - Intronic
954508137 3:51097114-51097136 ACAGCGCTTGAGCTCTGCTGAGG - Intronic
955002223 3:54938066-54938088 TCAGATCCTGAGCTTTGATGTGG + Intronic
956844481 3:73169870-73169892 CCACAACCTGGGCTCTGATGTGG - Intergenic
956938607 3:74131983-74132005 CCATAGCCTGAGCTCTATATTGG + Intergenic
957092234 3:75742355-75742377 CCAGATCATGAGCTCCTTTGAGG - Intronic
957132931 3:76245261-76245283 CCAGAGCTTGAACCCTTTTGGGG + Intronic
957736980 3:84215452-84215474 CCACAGCCTGAGCTGTATTTTGG + Intergenic
958684704 3:97378196-97378218 CCACAGACTGAGCTCTGTGGTGG - Intronic
958805548 3:98805775-98805797 ACAGAGCCTGAGGTCAGTTTGGG - Intronic
958869939 3:99546005-99546027 CCAGATTCTCAGCTGTGTTGAGG - Intergenic
959730028 3:109590714-109590736 CCATAGCCTGAGCTCTATGTTGG + Intergenic
961375803 3:126465077-126465099 CCAAAGCCGGTGCTCTGCTGTGG + Intronic
961434418 3:126906731-126906753 CCAGAGCGTTAGCTCTGTGAAGG + Intronic
961513542 3:127419257-127419279 CAAGAGGCTGATCTCTGTGGGGG + Intergenic
962162188 3:133011782-133011804 CCACAGCTTGAGCTCTGTGTTGG + Intergenic
962261312 3:133909931-133909953 CCAGAGACTGAGCTGATTTGAGG + Intergenic
962872688 3:139511868-139511890 CCAGAGCCTGAGTTTTGGTGGGG - Intergenic
963383684 3:144563420-144563442 CCAGGGTCTGTGCTCTGTTCTGG + Intergenic
964298386 3:155259572-155259594 CCAGAGAATGAGGTCTGTGGTGG - Intergenic
964904893 3:161707708-161707730 ACAGCGCTTGAGCTCTGCTGAGG + Intergenic
965610409 3:170537731-170537753 TCAGAGCCTGAGCGCTGAAGTGG + Intronic
965811107 3:172592479-172592501 CCCCAGCCTGAGGTCTGTTAGGG + Intergenic
968241851 3:197096399-197096421 TCAGAGCCTGAGGGCTGGTGAGG - Intronic
968349340 3:198039845-198039867 CCAGAAGCTGAGCTCTGAAGAGG - Intronic
968755393 4:2413321-2413343 CCACAGCCTGAGTGCTGATGTGG + Intronic
969194615 4:5550875-5550897 CCACAGCCTGAGCTCTATGTTGG - Intronic
969234419 4:5855576-5855598 CCAAACCCTGAGCTCTGTGAGGG - Intronic
969290556 4:6236470-6236492 CCAGAGCAGGAGATCTGTAGAGG + Intergenic
969448083 4:7256798-7256820 GCAGAGTGTGAGGTCTGTTGGGG + Intronic
969869380 4:10095170-10095192 CCAAGGCCTGAGCGCTGGTGCGG + Intronic
970554230 4:17215263-17215285 CCACAGCCTGAGCTCTGCATTGG + Intergenic
972581836 4:40401931-40401953 CCAGAGCCTGATTTCTTTTGGGG - Intergenic
975307781 4:72868496-72868518 GCAGAGCCCGAGCACTGTGGTGG - Intergenic
976061201 4:81130502-81130524 GCAGAGCTCGAGCTCTGTTCTGG + Intronic
976259898 4:83135630-83135652 CCACGGCCTGAGCTCTGTGTTGG + Intronic
977610262 4:99023084-99023106 CCAGCGCCTTTGCTCTGTTGCGG + Intronic
978087163 4:104668131-104668153 CCACAGCCTGAGCTCTGTGTTGG + Intergenic
978923725 4:114217411-114217433 ACAGAGCCTGTGCACTGGTGAGG - Intergenic
979405934 4:120310553-120310575 CCAAAGCCTGAGCTCTATGTTGG + Intergenic
980219477 4:129897167-129897189 CCAGAGCCTGAGCTATGACTTGG - Intergenic
980769383 4:137351507-137351529 GCAGAGCTTGAGCTCTGTGCTGG - Intergenic
980823636 4:138047747-138047769 ACAGAGGCTGAGCTCTGGTCTGG + Intergenic
980844886 4:138312640-138312662 GAACAGCCTGAGCTCTGTTCTGG - Intergenic
980923358 4:139110237-139110259 CCAGAGCATGTGCTCTGCTATGG - Intronic
981144807 4:141311900-141311922 CCAAAGCCTGAGCCATCTTGTGG + Intergenic
981539067 4:145829713-145829735 CCAGGGGCTGAGGTCTGCTGGGG - Intronic
981820377 4:148880367-148880389 CCACAGCCTGAGCTCTACTTTGG + Intergenic
982334511 4:154218334-154218356 ACAGAACCTGAGAACTGTTGGGG - Intergenic
982482969 4:155934195-155934217 CCACAGCCTGAGCTCTATGTTGG - Intronic
982868221 4:160544176-160544198 CCACAGCCTGAGCTCTATGTTGG + Intergenic
983219684 4:165032226-165032248 CCACAGTCTGAGCTCAGTCGTGG - Intronic
984009021 4:174348120-174348142 ACAGTGCCTGAGCTCTGCTAAGG - Intergenic
984282382 4:177687070-177687092 ACACAGCCTGAGCTCTTTGGTGG + Intergenic
984832262 4:183986781-183986803 CCAGAGCCTGAGCTCTGTTGGGG + Intronic
985174827 4:187189562-187189584 CAAAAGCCTGAGCTCTTTTAGGG - Intergenic
987066079 5:14291052-14291074 CCTGAGCCTGAGTTCTTTTTGGG - Exonic
987493796 5:18616640-18616662 CCACAGACTGAGCTCTGTGCTGG + Intergenic
988009202 5:25461689-25461711 CCATAGCCTGAGCTCTATGTTGG - Intergenic
989159754 5:38379024-38379046 CCAGGCTCTGAGCTCTGTTCTGG + Intronic
989224543 5:39011185-39011207 CAACAGCCTGAGCTCTGTCTTGG - Intronic
989532545 5:42524817-42524839 CCACAGCCTGAGCTCTGTGTTGG - Intronic
989778130 5:45233234-45233256 CCACAGCCTGAGCTCTCTGTTGG + Intergenic
990512261 5:56499450-56499472 CCAATGCCTGAGTTCAGTTGGGG + Intergenic
992292386 5:75292755-75292777 GCAGAGCTTGAGCTCTGTGCTGG + Intergenic
992747689 5:79835443-79835465 CCGGGGCCTGAGCTTGGTTGCGG + Intergenic
994721508 5:103385680-103385702 GCAGAGCTTGAGCACTGTTCTGG + Intergenic
997081694 5:130746933-130746955 CCACAGCCTGAGCTCTATGTTGG - Intergenic
997839073 5:137221913-137221935 CCAGTGCCTGAGCCCTGTGGAGG - Intronic
999031629 5:148299514-148299536 CCACATCCTAAGATCTGTTGTGG + Intergenic
999107999 5:149090927-149090949 CCATGGCCTGAGCTCTGTGTTGG - Intergenic
999502323 5:152159814-152159836 ACAGAGCTTGAGCTCTGCTAAGG - Intergenic
1000009213 5:157216002-157216024 CCAGGGCCTGAGCACTCTTGGGG + Intronic
1000820136 5:165973162-165973184 ACAGCGCTTGAGCTCTGTTAAGG - Intergenic
1001795497 5:174498891-174498913 CCATGGCCTGAGCTCTATTTTGG - Intergenic
1005561301 6:27044636-27044658 CCAGCACCAGAGCTCTGTGGTGG + Intergenic
1005972953 6:30775780-30775802 CCAGAGCATGACTTCTGGTGAGG - Intergenic
1006988614 6:38194096-38194118 CCAGACCCCCAGCTCTCTTGGGG + Intronic
1007127439 6:39439281-39439303 CAAGGTCCTCAGCTCTGTTGAGG - Intronic
1008664401 6:53701861-53701883 CCAGAGCCTGCCATCTGTTCTGG - Intergenic
1008922227 6:56854286-56854308 CCAGAGCCTAACCTTTGATGTGG + Intronic
1014068157 6:117150822-117150844 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1018435090 6:163752139-163752161 TCGCAGCCTTAGCTCTGTTGCGG + Intergenic
1019551997 7:1607848-1607870 CCAGGGCCTGAGCTGGGCTGGGG + Intergenic
1019798855 7:3072907-3072929 CCAGCTCTGGAGCTCTGTTGGGG + Intergenic
1020519531 7:9168876-9168898 ACAGAGCTTGAGCTCTGCTAAGG - Intergenic
1021598605 7:22342203-22342225 CCAAAGCCTGAGCTCTATGTTGG + Intronic
1022096569 7:27145056-27145078 CGAGAGACTGGGCTCTGTTGGGG + Intronic
1022966718 7:35481095-35481117 GAATTGCCTGAGCTCTGTTGAGG - Intergenic
1023313160 7:38908694-38908716 ACAGAGCTGGAGCACTGTTGCGG - Intronic
1024297576 7:47857730-47857752 CCAGAGCCTGGGATCTGTCCAGG - Exonic
1024299369 7:47875030-47875052 CCAGGGCCTCAGCTCTGTGTTGG - Intronic
1024495505 7:50041286-50041308 GCAGAGCTTGAGCTCTGTGCTGG - Intronic
1024573329 7:50743645-50743667 CCAGAGCCTGAGTCCTGAAGGGG + Intronic
1025093042 7:56078637-56078659 CCTGAGCCTGTGCCCAGTTGTGG + Intronic
1025161644 7:56666468-56666490 ACAGAGCCAGTGCACTGTTGAGG + Intergenic
1025745845 7:64242029-64242051 ACAGAGCCAGTGCACTGTTGAGG - Intronic
1029454194 7:100659520-100659542 CTAGAACCTGAGCTCTGTCCTGG + Intergenic
1030140979 7:106303998-106304020 GCAGAGCTTGAGCACTGTTCTGG + Intergenic
1030358559 7:108570057-108570079 CCAGCGCCTCAGCTCTGTGGAGG + Exonic
1032074105 7:128828228-128828250 TGAGAGGCTGAGCTCTGCTGTGG - Intergenic
1034393146 7:150801168-150801190 CCAGAGCCTGCGGACTGTGGAGG + Exonic
1037075158 8:14706617-14706639 CCATAGCCTGAGCCAAGTTGTGG + Intronic
1037591172 8:20313291-20313313 CCTGACCCTGAGTTTTGTTGCGG + Intergenic
1039056474 8:33541010-33541032 CCAGGGCATGTGCTCTGTAGAGG - Intergenic
1039778801 8:40763188-40763210 CTAGATCCTGATCTGTGTTGGGG + Intronic
1039945839 8:42128433-42128455 CCAAGGCCTGAGCTCTCTTGAGG + Intergenic
1041459683 8:58098050-58098072 ACAGAGCTTGAGCTCTGCTAAGG - Intronic
1042533358 8:69835654-69835676 CCAGAGCCAGCTCTCTGGTGAGG - Intergenic
1046308818 8:112405906-112405928 CCAGAGTCTGAGAACTGTAGTGG + Intronic
1048871675 8:138804207-138804229 ACAGAGCCCGAGCTCTGTGTAGG + Intronic
1048986693 8:139738615-139738637 CCAGAGTCTGATCGGTGTTGCGG - Intronic
1049255274 8:141610433-141610455 CCAGAGCCTGAACTGTCCTGGGG + Intergenic
1050805374 9:9670687-9670709 CCACAGCCTGAGCTCTATGTTGG - Intronic
1052220645 9:26017720-26017742 CCACAGCCTGAGCTCTATGTTGG + Intergenic
1052314855 9:27105726-27105748 CCAGAGACTGAGAAGTGTTGTGG - Intergenic
1053356961 9:37454302-37454324 ACTCAGCCTGAGCTCTGTTAAGG - Intronic
1056639375 9:88357594-88357616 CCACAGCCTGAGCTCTATGTTGG - Intergenic
1056924400 9:90820528-90820550 CCACAGCCTGAGCTCTACGGTGG + Intronic
1058174515 9:101722161-101722183 CCACAGCCTGAGCTCTATGTTGG - Intronic
1058259872 9:102815016-102815038 CTAGTGCTTGAGCTCTGCTGAGG + Intergenic
1059383046 9:113943430-113943452 CTATATCCTGAGCTCTGTTAGGG + Intronic
1060393951 9:123302630-123302652 CCAGGCCTTGAGCTGTGTTGTGG - Intergenic
1060653637 9:125352468-125352490 CCACAGCCTGAGCTCTGTGTTGG + Intronic
1060736020 9:126067025-126067047 TCAAAGACTGAGCTCTGCTGGGG + Intergenic
1061318291 9:129811688-129811710 CCTGAACCTGAGCTCAGGTGAGG + Intergenic
1062537191 9:137026267-137026289 CCAGACCCTGAGCTCTGCCCAGG + Intronic
1062580819 9:137228524-137228546 CCAGCGCCTGACCTCTGGGGTGG + Intronic
1186954741 X:14669636-14669658 CCACAGCCTGAGCTCTATGTTGG + Intronic
1187811891 X:23188402-23188424 GCAGAGCCTGTGGACTGTTGCGG - Intergenic
1188325543 X:28797053-28797075 CAACAGCCTGAGCTCTGTGTTGG + Intronic
1189637214 X:43023700-43023722 CCATAGCCTGAGCTCTATGTTGG + Intergenic
1190957918 X:55214499-55214521 CCAGAGCCTGAGAAGTGTAGTGG - Intronic
1191055317 X:56233921-56233943 CCAGAGCCTAGGCTCTGCTCCGG + Intronic
1193797207 X:85891480-85891502 CCACAGCCTGAGCTCTATGTTGG - Intronic
1194220449 X:91183244-91183266 CCACAGCCTGAGCTCTATGTTGG - Intergenic
1195003258 X:100662635-100662657 CTTGGGCCTGAGGTCTGTTGTGG + Intronic
1196960166 X:120992563-120992585 GCAGAGCTTGAGCGCTGTTCTGG + Intergenic
1197710557 X:129663739-129663761 CCACAGACTGAGATCTTTTGAGG + Intergenic
1198857489 X:141033397-141033419 CCACGGCCTGAGCTCTGTGTTGG - Intergenic
1198905207 X:141553974-141553996 CCACGGCCTGAGCTCTGTGTTGG + Intergenic
1199278084 X:145969891-145969913 CCACAGCCTGAGCTCTATATTGG - Intergenic
1199362904 X:146943515-146943537 GCACAGCCTGAGCTCTATTTTGG + Intergenic
1199890285 X:152072209-152072231 CCAGAGCCTGATCTCTGAGTGGG + Intergenic
1200208503 X:154334726-154334748 CCAGAGCCTGAGCCCTTTCTCGG - Intergenic
1200548906 Y:4554069-4554091 TCAGAGCTTGAGCGCTGTTCTGG + Intergenic
1200556961 Y:4646996-4647018 CCACAGCCTGAGCTCTATGTTGG - Intergenic
1200756454 Y:6994824-6994846 CCAGAGCCAGAGCTCAGCAGAGG + Intronic