ID: 984833848

View in Genome Browser
Species Human (GRCh38)
Location 4:184000642-184000664
Sequence TGAACCCAGTGTTCAAGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 157}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984833848_984833849 -7 Left 984833848 4:184000642-184000664 CCTACTCTTGAACACTGGGTTCA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 984833849 4:184000658-184000680 GGGTTCAGATTACACTTCCTTGG 0: 1
1: 0
2: 0
3: 19
4: 179
984833848_984833850 -4 Left 984833848 4:184000642-184000664 CCTACTCTTGAACACTGGGTTCA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 984833850 4:184000661-184000683 TTCAGATTACACTTCCTTGGTGG 0: 1
1: 0
2: 1
3: 13
4: 168
984833848_984833851 4 Left 984833848 4:184000642-184000664 CCTACTCTTGAACACTGGGTTCA 0: 1
1: 0
2: 0
3: 15
4: 157
Right 984833851 4:184000669-184000691 ACACTTCCTTGGTGGAACCTTGG 0: 1
1: 0
2: 0
3: 38
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984833848 Original CRISPR TGAACCCAGTGTTCAAGAGT AGG (reversed) Intronic
901007004 1:6176856-6176878 TGAAGCCAGGGGTCAAGAGCTGG - Intronic
907509276 1:54946274-54946296 TCACCCCAGTGTTCAAGCCTGGG - Intergenic
908328044 1:63043191-63043213 TGAACACAGAGCTCAAAAGTAGG + Intergenic
908782839 1:67707298-67707320 TGATCCCTGTGTTCTAAAGTGGG - Intronic
910143039 1:84047613-84047635 TGAAACCAGTGTGAAAGAGTAGG - Intergenic
912094916 1:106127528-106127550 TGAACCCATTGTTCAAGTGCTGG + Intergenic
916116454 1:161488824-161488846 TGAGCCCAGGGTTCATGATTGGG + Intergenic
916232294 1:162552301-162552323 TGAAGCCAGACTACAAGAGTTGG - Intergenic
916469716 1:165111435-165111457 GGTAACCAGTGTTAAAGAGTGGG - Intergenic
916734479 1:167595459-167595481 TGATTCTAGTGTTCTAGAGTAGG - Intergenic
917593132 1:176498078-176498100 TGAACACAGTGGTGGAGAGTTGG + Intronic
918483937 1:185009637-185009659 TGAAACCAGTGTAAAATAGTGGG - Intergenic
918576462 1:186066791-186066813 GGAACCCAGTATTTAAGAGGTGG - Intronic
919363619 1:196628172-196628194 AGAACCTTGTCTTCAAGAGTGGG + Intergenic
921914821 1:220595623-220595645 GGTAGCCAGTGTTCAAGATTAGG + Intronic
924105813 1:240648103-240648125 TGAACTCAGTCTTGAAGAATGGG + Intergenic
1063051774 10:2457504-2457526 TGAACACAGTTTTCAAGGCTAGG - Intergenic
1064864944 10:19869056-19869078 AGAACTCAGGGTTCAAGATTTGG + Intronic
1067493449 10:46737929-46737951 TGAATCCAGTTTTTAAGAGTGGG - Intergenic
1067601211 10:47602475-47602497 TGAATCCAGTTTTTAAGAGTGGG + Intergenic
1071652755 10:87410350-87410372 TGAATCCAGTTTTTAAGAATGGG + Intergenic
1075309883 10:121405214-121405236 GGAACCCTCTGTTCAGGAGTTGG - Intergenic
1075390906 10:122090952-122090974 TGAGCCCAGAGTTCAAGACTAGG - Intronic
1077905641 11:6530732-6530754 TGAACCCCCTGTACAAGAGGAGG - Intronic
1078628806 11:12983201-12983223 TGAAGCTAGTGCTCAAGAATTGG - Intergenic
1080036290 11:27715246-27715268 AGTACCCAGTGTCCAAGACTGGG + Intronic
1090010016 11:123038006-123038028 TGAACCCAGGATTCAAGTGGAGG - Intergenic
1091308242 11:134554521-134554543 TGGACCCAGAGTGCATGAGTTGG - Intergenic
1101728531 12:107407709-107407731 TGAAGCCAGGGCTGAAGAGTTGG + Intronic
1103268480 12:119651434-119651456 TGAACCCAGTGCTCCAGTCTGGG + Intergenic
1106002376 13:25736382-25736404 TGAACCCTGTGTTCCTGGGTAGG + Intronic
1106593600 13:31118746-31118768 TGAAACCACTGTTAAAGTGTCGG - Intergenic
1107159575 13:37210675-37210697 TGGACCCAGTGTTGTACAGTAGG + Intergenic
1108479161 13:50849677-50849699 TGCACTCAGGGTTTAAGAGTTGG - Intergenic
1109676015 13:65676420-65676442 TGAAGCCAGAGTCCAAGACTTGG + Intergenic
1113316755 13:109188783-109188805 GGAATCCAATGTTCAAGAGAAGG + Intronic
1113894956 13:113758809-113758831 TGAACCCAGAGATCAAGGGCTGG + Intergenic
1114139660 14:19895378-19895400 TGACCACAGTGTTCAAGTGGGGG + Intergenic
1120729312 14:87984181-87984203 TCAACACAGTTTTCAAAAGTGGG + Intronic
1121691518 14:95880906-95880928 TGAACCCTGTGTTCTAGATGAGG + Intergenic
1124474122 15:30017011-30017033 TGAATCCAGTGCTCCAGTGTTGG + Intergenic
1124802345 15:32846023-32846045 TGAACCCAGTGTTCAAACCTAGG + Intronic
1126917507 15:53482432-53482454 TAAAACCAGAGGTCAAGAGTGGG - Intergenic
1127857260 15:62962791-62962813 TCACCCCAGTGTTCCAGAGCTGG + Intergenic
1127933145 15:63610932-63610954 TGTACCCAGTGTTCAGGAGGTGG + Intronic
1128515724 15:68340718-68340740 TGGACCCAGTCTTCAAGAAAGGG - Intronic
1130059524 15:80559533-80559555 TAAATCCAGAGTTCAAGAGCTGG - Intronic
1130726704 15:86446446-86446468 TGAAGCCAGTGTTTGAGAGCAGG + Intronic
1131824383 15:96306309-96306331 TGAACCCAGAGTTCTGGAGATGG - Intergenic
1132552175 16:558067-558089 TCAGCCCAGTGTGCAAGAGCTGG + Intergenic
1133003359 16:2862853-2862875 TGGATCCAGTGTTCACGATTTGG + Intergenic
1139975856 16:70809729-70809751 TGAACCCAGCGTTCATGTGAGGG + Intronic
1140238469 16:73180172-73180194 TGACCCCTGGGTCCAAGAGTTGG - Intergenic
1146240812 17:31223097-31223119 TAAACCCAGTGCTCCACAGTGGG - Intronic
1146630081 17:34463433-34463455 TGAAATCAGTGCTCATGAGTGGG + Intergenic
1156227114 18:35120145-35120167 TGAGTGCAGTGGTCAAGAGTGGG - Intronic
1162105703 19:8368441-8368463 TGACCTCAGTGTCCAGGAGTGGG + Intronic
1164969484 19:32519218-32519240 TGAAACCAAGTTTCAAGAGTTGG + Intergenic
1167842743 19:52135334-52135356 TGGTGCCAGTGTTCAAGGGTGGG - Intronic
1168182683 19:54672801-54672823 TGAACCCAGTTTTTAATGGTTGG - Intronic
925337446 2:3108515-3108537 TAAACCCATTTTTCAAGAGCAGG - Intergenic
926676748 2:15630807-15630829 GGCACCTACTGTTCAAGAGTTGG + Exonic
927300366 2:21505393-21505415 TGAACCCAGGAAACAAGAGTGGG - Intergenic
927457927 2:23273385-23273407 GGAAGCCAGTATTCAAGAGGTGG - Intergenic
928011023 2:27607891-27607913 TGAACCTAGAGTCAAAGAGTGGG + Exonic
928980439 2:37130837-37130859 TGAATACAGTGTTCTAGAGAGGG - Intronic
929482184 2:42320375-42320397 TGTACCCAGGGTTCAAAACTAGG - Intronic
929910205 2:46083371-46083393 TGGACACAGTTTTTAAGAGTAGG - Intronic
931174951 2:59845132-59845154 TGGACCCAGAGTTCAGGAGGGGG - Intergenic
931872137 2:66472771-66472793 TGGACCAAGTTTCCAAGAGTGGG - Intronic
932286095 2:70533074-70533096 TGAGCCCAGAGTTCAAGACCAGG - Intronic
933377776 2:81502078-81502100 TGAACCCAGTATTCTAGATCTGG + Intergenic
937469668 2:122164417-122164439 TGAACCCAGTGATCAATTGTAGG - Intergenic
938132210 2:128726194-128726216 TGAGGCCGGTGTTAAAGAGTGGG + Intergenic
942507117 2:176654848-176654870 TGACCCCAGTCTTGCAGAGTTGG + Intergenic
946365687 2:219247630-219247652 TGATCCCAGAGCTCAAAAGTGGG - Intronic
947331608 2:229034884-229034906 GGAACCCAGTGATCAAAACTAGG + Intronic
947703455 2:232255202-232255224 AGAACCCAGTGATGAAGAGGAGG + Intronic
947992864 2:234500550-234500572 TGAACCCAGAGTTCCACAGCAGG - Intergenic
1169654784 20:7911106-7911128 GGAAGCCAGAGTGCAAGAGTGGG + Intronic
1169726035 20:8733298-8733320 TGAAGCCAGAGTTCATGAGGAGG + Exonic
1170148133 20:13199755-13199777 TGAAGCCTGTGTTCAAGAAGCGG + Intergenic
1170466678 20:16628600-16628622 TGAACCCAGTGTTGGAGCTTTGG + Intergenic
1172971288 20:38874722-38874744 TGACCCCAGGTTTTAAGAGTTGG - Intronic
1173928820 20:46801202-46801224 TCAACCCAGGGCTCAAGCGTAGG - Intergenic
1174576555 20:51541905-51541927 TGAACCCAGTTATCAAGGGTAGG - Intronic
1177735137 21:25079826-25079848 GGAACCCAGTCTGCAATAGTTGG - Intergenic
1181694026 22:24584122-24584144 TGAACACCCTGTTCCAGAGTAGG + Intronic
1183772041 22:39934981-39935003 TGAACCCAGTATTCAAGATATGG - Intronic
949401212 3:3666765-3666787 TGTAGCCAGTGTTGACGAGTGGG + Intergenic
951048284 3:18065559-18065581 TGAAGCCAGTTTTCAGGAGGAGG + Intronic
953220109 3:40961829-40961851 TGATCCCAGTAGTCAAGAATTGG - Intergenic
953871769 3:46633162-46633184 TCACTCCAGTGTTCAAGGGTTGG - Intergenic
954701295 3:52452247-52452269 TGAACTCTGTGTTCAGGGGTTGG + Exonic
954737907 3:52721981-52722003 TGAAACCTGTGATCCAGAGTGGG + Intronic
959653654 3:108776385-108776407 AGGATCCAGGGTTCAAGAGTTGG + Intergenic
960487850 3:118275074-118275096 TGAACACAGTGATCAACAGCAGG - Intergenic
961280357 3:125761804-125761826 AGAGCCCACTCTTCAAGAGTCGG + Intergenic
962164186 3:133031939-133031961 TGAGCCAAGTATTCAAGAATAGG + Intergenic
963698166 3:148588721-148588743 TGAGCCCAGAGTTCAAGTGAAGG + Intergenic
967439463 3:189490098-189490120 TGAACCTTGTGTTCAACATTTGG - Intergenic
969159020 4:5239141-5239163 GGAGCACAGTGTTCAAGAGGAGG + Intronic
971354061 4:25878719-25878741 TCTACACAGTGTTCAAAAGTCGG + Intronic
971624459 4:28900115-28900137 TCAACAGAATGTTCAAGAGTGGG - Intergenic
972123945 4:35740503-35740525 TGGATCCAGTGTTCAAGGGCAGG - Intergenic
974502305 4:62722376-62722398 TTCACTCTGTGTTCAAGAGTAGG + Intergenic
975086932 4:70353075-70353097 TGAACTAAGTGTTCAACAGTTGG - Intergenic
975328378 4:73085781-73085803 TGAACCCAGAGTTCAAGGCCAGG + Intronic
979074118 4:116249969-116249991 TGTACACAGTGTTCAACATTTGG - Intergenic
979101024 4:116614460-116614482 TAAACCCAGATTTCAAAAGTTGG + Intergenic
979945514 4:126826406-126826428 TGGAGCCAGTGTTCAAGGGCAGG - Intergenic
982326011 4:154128793-154128815 GGAAACCAGTGCTCCAGAGTAGG + Intergenic
984708926 4:182868496-182868518 TGAACCCAGTGCCCATGAGGAGG - Intergenic
984833848 4:184000642-184000664 TGAACCCAGTGTTCAAGAGTAGG - Intronic
985892331 5:2725230-2725252 TGGACCCAGAGTTCAAGAACAGG - Intergenic
987657533 5:20825151-20825173 TGGATCCAATGTTCAAGAGCAGG + Intergenic
990092599 5:52072316-52072338 TGAACCCTGTGTTCATCAGTTGG + Intronic
990472561 5:56129759-56129781 ACATCCCAGTGTTCAAGAGAAGG - Intronic
994188779 5:96844215-96844237 AGAACCAATTGTTGAAGAGTTGG - Intronic
998284409 5:140844532-140844554 TCAACCCTTTGTTCATGAGTTGG + Intronic
998536102 5:142932229-142932251 TGAAACCAGTGTACCAGAGGTGG + Intronic
998974758 5:147633225-147633247 TGAATTCAGTGTTAAAGAGCTGG - Intronic
1000216245 5:159159547-159159569 TATACCCAGTTTTCAAGATTTGG + Intronic
1001367770 5:171161427-171161449 TGTACCCAGAGTTCCAGAGAAGG + Intronic
1001573569 5:172747036-172747058 AGAACCCAGTGTTTAAAATTAGG - Intergenic
1004063126 6:12217667-12217689 GGAACCCAGTGTTCAGAAGAGGG - Intergenic
1004681757 6:17902617-17902639 TGAACTGTGTCTTCAAGAGTGGG - Intronic
1008551921 6:52640865-52640887 GGAAGCCAGGGTTCAAGATTTGG - Intergenic
1010307010 6:74336530-74336552 TCAAGCCAGTGTTCAGGGGTAGG + Intergenic
1011417169 6:87133977-87133999 GGAGTCCAGTGTTCAAGAGCAGG + Intergenic
1015548507 6:134387063-134387085 TGAGTCCAGAGTTCAAGAATGGG - Intergenic
1015566290 6:134574738-134574760 TGAGCCCAGTTTTGCAGAGTTGG - Intergenic
1015716004 6:136192426-136192448 TGAACCCCCTGTTCAAGTTTGGG - Exonic
1016053178 6:139551362-139551384 TGAAATCACTGTTCAAGAGAAGG - Intergenic
1017082833 6:150685178-150685200 GGAGCCCAGTGCTCAAGTGTGGG - Intronic
1017370246 6:153697002-153697024 TGAACCCAAAGTCAAAGAGTGGG - Intergenic
1017421320 6:154275821-154275843 TGCACCCATTGCTCTAGAGTTGG + Intronic
1018488684 6:164269865-164269887 TCAACCCAAAATTCAAGAGTTGG - Intergenic
1019949601 7:4360738-4360760 TGAACCAAGTGTGCAAGCATAGG - Intergenic
1023169304 7:37375161-37375183 GCAACACAGTGTTCAAGAGAAGG + Intronic
1023387080 7:39669438-39669460 TGAAACATGTGTTAAAGAGTGGG + Intronic
1026792910 7:73346406-73346428 AAATCACAGTGTTCAAGAGTGGG + Intronic
1027949052 7:84789322-84789344 TTAACCCAGTGCTCTAGATTAGG + Intergenic
1029075812 7:97933060-97933082 AGAGCCCACTCTTCAAGAGTCGG - Intergenic
1029261738 7:99307315-99307337 TGCACTCAGTGTTCAAGAAATGG - Intergenic
1032281666 7:130508066-130508088 AGAACTCAGTGGTCAAGTGTGGG - Intronic
1032952742 7:136934269-136934291 TTACCACAGTGTTCAAGAGAAGG - Intronic
1034833553 7:154330984-154331006 AGCACCCAGTGTTAAAGAGGAGG - Intronic
1036241714 8:7087275-7087297 AGAGCCCACTCTTCAAGAGTCGG + Intergenic
1036260121 8:7232833-7232855 GGAGCCCACTCTTCAAGAGTCGG - Intergenic
1036306496 8:7606691-7606713 GGAGCCCACTCTTCAAGAGTCGG + Intergenic
1036312158 8:7691389-7691411 GGAGCCCACTCTTCAAGAGTCGG - Intergenic
1036357341 8:8054679-8054701 GGATCCCACTCTTCAAGAGTCGG + Intergenic
1036831021 8:12019805-12019827 AGAGCCCACTCTTCAAGAGTCGG - Intergenic
1036901167 8:12670250-12670272 AGAGCCCACTCTTCAAGAGTCGG - Intergenic
1037631123 8:20657217-20657239 CAGACACAGTGTTCAAGAGTTGG - Intergenic
1040081170 8:43287671-43287693 GGAACCCAGAGGTCCAGAGTAGG - Intergenic
1040802667 8:51360755-51360777 TGAACACAGTTTGAAAGAGTTGG - Intronic
1042618858 8:70681560-70681582 TGAACTCAGTTTTCATGAGAAGG + Intronic
1046851536 8:118979635-118979657 TCATCCCAGTGTTCAAGAGCTGG + Intergenic
1047910933 8:129528329-129528351 AGTACCCAGTGTACAAGTGTTGG + Intergenic
1048126515 8:131641445-131641467 GGAACCCAATGTTCAAGGGCAGG - Intergenic
1050588682 9:7140397-7140419 TGTAACCAGTGTCTAAGAGTAGG + Intergenic
1051618209 9:19027140-19027162 TGATCCCAATGATCAAGAGGAGG + Intronic
1052826525 9:33180114-33180136 TGAGCCCAGAGTTCAAGACCAGG - Intergenic
1055381259 9:75709254-75709276 TGAGGTCACTGTTCAAGAGTGGG - Intergenic
1057038217 9:91827469-91827491 TGAACCTAGTGTTCAGAAGCAGG - Intronic
1057318388 9:93988102-93988124 TGAATCTAGTGTTCCAGTGTTGG - Intergenic
1060792835 9:126497537-126497559 TGACCCCTGTGGTCAGGAGTGGG - Intronic
1189288159 X:39866667-39866689 TGTACCAAGGGTTGAAGAGTTGG - Intergenic
1190700370 X:52983776-52983798 TGATCCAAGTCTCCAAGAGTTGG + Intronic
1192496470 X:71619489-71619511 TGAAGACAGTGTTCATGAGTAGG - Intergenic
1198587998 X:138144179-138144201 TCAACTCAGTCTTCAAGAGTTGG - Intergenic