ID: 984836458

View in Genome Browser
Species Human (GRCh38)
Location 4:184026661-184026683
Sequence TTATAGTATGGTATCCTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984836458_984836461 -2 Left 984836458 4:184026661-184026683 CCAACCAGGATACCATACTATAA No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984836458 Original CRISPR TTATAGTATGGTATCCTGGT TGG (reversed) Intergenic
No off target data available for this crispr