ID: 984836461

View in Genome Browser
Species Human (GRCh38)
Location 4:184026682-184026704
Sequence AATCAGTTGTCCTGCCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984836455_984836461 7 Left 984836455 4:184026652-184026674 CCCAGGAGCCCAACCAGGATACC No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data
984836456_984836461 6 Left 984836456 4:184026653-184026675 CCAGGAGCCCAACCAGGATACCA No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data
984836457_984836461 -1 Left 984836457 4:184026660-184026682 CCCAACCAGGATACCATACTATA No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data
984836459_984836461 -6 Left 984836459 4:184026665-184026687 CCAGGATACCATACTATAATCAG No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data
984836458_984836461 -2 Left 984836458 4:184026661-184026683 CCAACCAGGATACCATACTATAA No data
Right 984836461 4:184026682-184026704 AATCAGTTGTCCTGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984836461 Original CRISPR AATCAGTTGTCCTGCCTCCT TGG Intergenic
No off target data available for this crispr