ID: 984839143

View in Genome Browser
Species Human (GRCh38)
Location 4:184051985-184052007
Sequence GTCTCCCTGCCCCACCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984839143_984839147 5 Left 984839143 4:184051985-184052007 CCTGGCAGGTGGGGCAGGGAGAC No data
Right 984839147 4:184052013-184052035 GGTAAACCGACGGAGCTAGCTGG No data
984839143_984839149 17 Left 984839143 4:184051985-184052007 CCTGGCAGGTGGGGCAGGGAGAC No data
Right 984839149 4:184052025-184052047 GAGCTAGCTGGTAGTGTTCTAGG No data
984839143_984839146 -5 Left 984839143 4:184051985-184052007 CCTGGCAGGTGGGGCAGGGAGAC No data
Right 984839146 4:184052003-184052025 GAGACAGATGGGTAAACCGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984839143 Original CRISPR GTCTCCCTGCCCCACCTGCC AGG (reversed) Intergenic
No off target data available for this crispr