ID: 984839946

View in Genome Browser
Species Human (GRCh38)
Location 4:184059079-184059101
Sequence ACGTGCTCCCCTGCATTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984839943_984839946 27 Left 984839943 4:184059029-184059051 CCGATTATAGTCCTGATACGGCA No data
Right 984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG No data
984839944_984839946 16 Left 984839944 4:184059040-184059062 CCTGATACGGCAGAAGCATTTAG No data
Right 984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984839946 Original CRISPR ACGTGCTCCCCTGCATTTCC TGG Intergenic
No off target data available for this crispr