ID: 984840773

View in Genome Browser
Species Human (GRCh38)
Location 4:184065362-184065384
Sequence CGGTATGAGCACCTTGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984840771_984840773 -8 Left 984840771 4:184065347-184065369 CCTCATGGATCGTCACGGTATGA No data
Right 984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG No data
984840767_984840773 8 Left 984840767 4:184065331-184065353 CCCAGTGGCTGGTCATCCTCATG No data
Right 984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG No data
984840768_984840773 7 Left 984840768 4:184065332-184065354 CCAGTGGCTGGTCATCCTCATGG No data
Right 984840773 4:184065362-184065384 CGGTATGAGCACCTTGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984840773 Original CRISPR CGGTATGAGCACCTTGTACA GGG Intergenic
No off target data available for this crispr