ID: 984842361

View in Genome Browser
Species Human (GRCh38)
Location 4:184080388-184080410
Sequence TAGGATCATGCCTATGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984842356_984842361 21 Left 984842356 4:184080344-184080366 CCAAGATGTAAACTAAGATGCAT No data
Right 984842361 4:184080388-184080410 TAGGATCATGCCTATGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984842361 Original CRISPR TAGGATCATGCCTATGGACA AGG Intergenic
No off target data available for this crispr