ID: 984843551

View in Genome Browser
Species Human (GRCh38)
Location 4:184090887-184090909
Sequence CAGGATGAACTCTCTGAGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984843551_984843555 24 Left 984843551 4:184090887-184090909 CCCTGCTCAGAGAGTTCATCCTG 0: 1
1: 0
2: 2
3: 9
4: 210
Right 984843555 4:184090934-184090956 ATGACATATAACTGCACAAATGG 0: 1
1: 0
2: 0
3: 15
4: 210
984843551_984843554 -4 Left 984843551 4:184090887-184090909 CCCTGCTCAGAGAGTTCATCCTG 0: 1
1: 0
2: 2
3: 9
4: 210
Right 984843554 4:184090906-184090928 CCTGAGTAACGTGAAAAGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984843551 Original CRISPR CAGGATGAACTCTCTGAGCA GGG (reversed) Exonic
900013922 1:136455-136477 CAGGCTGACCTCTCTCAGCGTGG + Intergenic
901858364 1:12058608-12058630 CAGGATTAAATGTCTGACCAAGG + Intergenic
903083268 1:20830732-20830754 CATGATGAACTGACTGATCAAGG - Intronic
904504049 1:30936178-30936200 CAGAATGTACTCTGTGGGCAGGG + Intronic
904505513 1:30949607-30949629 CAGAATGCACTCTGTGGGCAGGG + Intronic
912717669 1:111993450-111993472 CAGAATTAACTATCTCAGCAAGG - Intergenic
913052203 1:115127426-115127448 CAGGAAGGACTCTCTGAGCAAGG + Intergenic
913335783 1:117708183-117708205 CAGAACAAACCCTCTGAGCAGGG - Intergenic
914788876 1:150858848-150858870 CAGGATGATCTCTTGGAGCTAGG - Intronic
915706549 1:157849292-157849314 CAAGAGGAACTCTGTGAGGAAGG + Intronic
915734376 1:158075434-158075456 AAGGATGAACACACAGAGCAGGG + Intronic
916508315 1:165448216-165448238 CAGAAGGAACTCTCAGAGAAAGG - Intergenic
916600626 1:166290013-166290035 AAGGATGATCTGGCTGAGCAGGG + Intergenic
916868546 1:168887396-168887418 AAGGATGAACTCCCTTAGCCAGG + Intergenic
922734462 1:227971846-227971868 CAGGCTGACCTCTGTCAGCATGG - Intergenic
924145129 1:241066322-241066344 CAGCATGATCCCTTTGAGCAGGG - Intronic
1065026564 10:21544422-21544444 CAGGAAGAACTCTCTGGACTGGG + Intronic
1065968300 10:30785983-30786005 GAGGAAGAACTTTCTGAGCCTGG - Intergenic
1069577389 10:69540714-69540736 CAAGATGGACTCTCTGAGATGGG + Intergenic
1073134235 10:101211170-101211192 AAGGATGAGCTCTCTGAGGGAGG + Intergenic
1074279491 10:112037473-112037495 CAGGAAGACCTCTCTGATGAGGG - Intergenic
1076076379 10:127537151-127537173 CAGAATGATCTCCCTAAGCATGG - Intergenic
1076120552 10:127933741-127933763 CAGGGTGACCTCTCTTAGCTGGG + Intronic
1076970232 11:128524-128546 CAGGCTGACCTCTCTCAGCGTGG + Intergenic
1077792069 11:5451718-5451740 CAGAAAGAACTCTGAGAGCATGG + Intronic
1078478078 11:11651211-11651233 CATGATGAACACTCTGGACATGG + Intergenic
1078540402 11:12208719-12208741 CTGAATAAACTCTCTGACCATGG - Intronic
1080431945 11:32207533-32207555 GAGGAGGAACTCTGTGAGGACGG + Intergenic
1081730269 11:45367129-45367151 CTGGTTGGACTCTCTGAGCACGG - Intergenic
1082995306 11:59249625-59249647 CAGGGTGGGCTCTCTCAGCAGGG - Intergenic
1083002203 11:59302895-59302917 CAGGGTGAGCTCTATCAGCAGGG - Intergenic
1084737881 11:71117588-71117610 TAGGATGAAATCACTGACCATGG - Intronic
1086048467 11:82560929-82560951 TAGGGTGAACTCTCTGATCGAGG + Intergenic
1087019094 11:93584630-93584652 CATGGTCAACTCTCTGTGCATGG - Intergenic
1089973962 11:122716633-122716655 CAGACTGAAAGCTCTGAGCAAGG - Intronic
1096523006 12:52194665-52194687 CAGGCTGCACTCTCTGAGCAGGG + Intergenic
1099157599 12:79198585-79198607 CAGCATGAACTCTCTCTGGACGG + Intronic
1100518548 12:95351653-95351675 CAAGATGAACACCCTGTGCATGG + Intergenic
1100829178 12:98502422-98502444 CAGGATGAACCCTCTTCCCAGGG - Intronic
1101589700 12:106114699-106114721 AGGGATAAACACTCTGAGCAAGG + Intronic
1104300989 12:127564940-127564962 CATTGTGAACTCTATGAGCATGG - Intergenic
1104317008 12:127712341-127712363 CAGGATGATTTCACTGAGAATGG - Intergenic
1106983148 13:35314022-35314044 CAGCATAAACTCTCTGAGAGGGG + Intronic
1107269882 13:38602641-38602663 CAGAATGAACTCTGTGATCAGGG - Intergenic
1107610908 13:42112003-42112025 CAGCATTCACTCTCTGTGCAGGG - Intronic
1108842062 13:54630853-54630875 CAACATGAAATCTCTGAACATGG - Intergenic
1110565722 13:76955874-76955896 CAGGATGAACAGTCAGAGTAAGG - Intronic
1111596636 13:90420277-90420299 CAGGATGAAGCCTGTGGGCAGGG + Intergenic
1112254397 13:97816335-97816357 CAGGTTGAAATCCCTGAGGAGGG + Intergenic
1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG + Intergenic
1115886316 14:37975588-37975610 CTGGATGAAATCTCTGAGAATGG + Intronic
1116787346 14:49302266-49302288 CAGGATGTTCTCTTTCAGCAGGG - Intergenic
1118568725 14:67171850-67171872 CAGGAAGAACTCCCTTGGCAAGG + Intronic
1119175530 14:72565427-72565449 CAGCAGGAACTCTCTGGGCTGGG + Intronic
1121661845 14:95640846-95640868 CAGGGTCACCTCACTGAGCAGGG + Intergenic
1122270510 14:100566842-100566864 CAGGGTGGACTCTCAGAGCAGGG - Intronic
1123040454 14:105488170-105488192 GAGGGTGACCTCTCTGGGCAAGG + Exonic
1123475641 15:20591284-20591306 CAGGAGGAGCCCTGTGAGCAAGG + Intergenic
1123642370 15:22409079-22409101 CAGGAGGAGCCCTGTGAGCAAGG - Intergenic
1124049492 15:26182585-26182607 CAGGAAGAACCCACTGAGCCAGG + Intergenic
1128862515 15:71085808-71085830 CAGGATTGACTCCCTTAGCAAGG + Intergenic
1132697717 16:1209336-1209358 CAGGAAGAAGTCGCTGGGCAGGG - Exonic
1133270401 16:4608519-4608541 CAGGCTGGACCCTCTGAGCCCGG - Intergenic
1134532809 16:14997846-14997868 CAGGCTGAACTCGTTGAACAGGG - Intronic
1136341208 16:29644720-29644742 CAGGCTGATGTCTCTGAGAAGGG - Intergenic
1138424058 16:56918679-56918701 AAGTATGAAGTCTCTAAGCAGGG - Intergenic
1138679164 16:58672569-58672591 CAGGAAGCATTCTCTGAGGAAGG - Intronic
1139863227 16:70042888-70042910 CAGGCTGAACTCGTTGAACAGGG + Intergenic
1141543140 16:84742424-84742446 AAATGTGAACTCTCTGAGCAGGG + Intronic
1141593112 16:85081719-85081741 GAGGATGAACGCTTGGAGCAGGG + Intronic
1141850277 16:86640395-86640417 CAGGATGGACACTCTCAGCTAGG + Intergenic
1142450030 16:90169005-90169027 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450042 16:90169053-90169075 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450067 16:90169150-90169172 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450092 16:90169247-90169269 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450117 16:90169344-90169366 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450154 16:90169490-90169512 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450193 16:90169636-90169658 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450243 16:90169830-90169852 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450282 16:90169976-90169998 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450357 16:90170268-90170290 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450396 16:90170414-90170436 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142450435 16:90170560-90170582 CAGGCTGACCTCTCTCAGCGTGG - Intergenic
1142661734 17:1434966-1434988 CATGATTAAATCTCTGAGAAAGG + Intronic
1143920941 17:10330611-10330633 GAGGCTCAACTCTCAGAGCACGG + Intronic
1145938646 17:28729323-28729345 AAGGAAGAATTCTCTGAGAAGGG + Intronic
1153437212 18:5080208-5080230 CAGAATGAACAATGTGAGCATGG + Intergenic
1156235076 18:35195257-35195279 CAGGATGTACTCACAGACCAGGG + Intergenic
1156268370 18:35508642-35508664 CTGGATCAGCTCTCTTAGCAGGG - Intergenic
1156389148 18:36634438-36634460 CAGGATGAATTCTCTAATCCTGG - Intronic
1159992608 18:74927530-74927552 CAGGATGAACTTTTTCACCATGG + Intronic
1160370554 18:78369172-78369194 CAGGGAGCACTCACTGAGCACGG + Intergenic
1160625634 18:80202717-80202739 CTGGATGAAGACCCTGAGCAGGG + Exonic
1160647342 19:199652-199674 CACGCTGACCTCTCTCAGCATGG + Intergenic
1160948482 19:1654468-1654490 CACGTGGAACTCTCTGGGCACGG - Intergenic
1162015475 19:7844534-7844556 CAGAAGGACCTCTCTGGGCAGGG - Intronic
1163052446 19:14694636-14694658 TAGGAAAAACTCTCTAAGCAGGG + Intronic
1163322454 19:16582665-16582687 CAGCATGAACCCTCAGGGCAGGG + Intronic
1163492422 19:17624706-17624728 CTGGATGACCTCTCTGAGACCGG + Intronic
1167235732 19:48313653-48313675 CAGGATGATCTCTCGAAGCCAGG + Intronic
1168394688 19:56038091-56038113 CAGCCTGAAATCTCTGAGCCTGG + Exonic
1168446665 19:56423510-56423532 CAGTATGAACTCTCTGATGTTGG - Exonic
925117743 2:1394698-1394720 CAGGCAGGACTCTCTGGGCAGGG - Intronic
927103055 2:19802614-19802636 CAGCATGAGCTCTCTGTACATGG - Intergenic
928803674 2:35125425-35125447 CAGGCTAAGCTCCCTGAGCAGGG + Intergenic
932068212 2:68589272-68589294 CAGGCAGAACTCTCAGAACATGG + Intronic
935050843 2:99523802-99523824 GAGAATGAACTCTCAGAGAAGGG + Intergenic
935353858 2:102179954-102179976 CAGGAAGAACTCTCTGCAGAAGG - Intergenic
935795586 2:106637919-106637941 CAGGATGAACTATTTGTGGAAGG + Intergenic
936285725 2:111179777-111179799 CAGGATGCCCTCCCTGGGCAAGG - Intergenic
937772453 2:125736090-125736112 CAGGAGGAATTTTCTGTGCATGG - Intergenic
942444383 2:176068364-176068386 CAGCCTGCACTCTCTGGGCATGG + Intergenic
943722911 2:191223494-191223516 CAGGAAGAACTTTGTCAGCAAGG + Intergenic
947805105 2:232961080-232961102 TTGGATGAACTCTGTGAGGATGG + Intronic
948290153 2:236818541-236818563 CAGCATGAGCTCCCTGAGGAGGG - Intergenic
948942430 2:241203143-241203165 CGGGAGGACCTCTCTGAGGAGGG - Intronic
1170025741 20:11887876-11887898 CAGCATTAACTACCTGAGCAAGG + Intergenic
1173977220 20:47196062-47196084 CAGGATGAAGCGTCTGGGCAAGG + Intergenic
1175458976 20:59136629-59136651 CAGGATGAAAGCTCAGAGGAGGG - Intergenic
1176383490 21:6125672-6125694 CAGGACGCCCTGTCTGAGCAGGG - Intergenic
1176425131 21:6544044-6544066 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1179496548 21:41775479-41775501 CAGCATGAACCCTCTGAGAGAGG - Intergenic
1179700622 21:43152361-43152383 CAGGAAGAGCTCTCTGAGGTGGG + Intergenic
1179739978 21:43412566-43412588 CAGGACGCCCTGTCTGAGCAGGG + Intergenic
1181287690 22:21766197-21766219 CAGGAGGACCTCTGAGAGCAGGG - Intronic
1182923415 22:34101068-34101090 CAGGAAGACTTCTCTGAGCTGGG + Intergenic
1183100803 22:35583012-35583034 CAGGATGTTCTCTAAGAGCAGGG + Intergenic
1183165880 22:36147217-36147239 CAGGAGGAATCCTCTGTGCATGG - Intronic
1183468920 22:37995398-37995420 CAGGAGGAAGTCTCCCAGCAGGG - Intronic
1184911631 22:47539164-47539186 CAGGCTCTACTCTCTGAGTAAGG + Intergenic
949836293 3:8274108-8274130 CAGCAGGAAATCCCTGAGCAGGG - Intergenic
949944673 3:9180487-9180509 CAAGATGAACTCGGGGAGCAGGG + Intronic
950425725 3:12923861-12923883 CAGGAAGAGCACTCAGAGCAGGG - Intronic
951719823 3:25686940-25686962 GAGGGTGACCTCTCTGGGCAAGG + Intergenic
952416117 3:33092849-33092871 CAGGATGAGCTCTGTGATCTCGG + Exonic
952919264 3:38274116-38274138 CATAGTGAACTCACTGAGCATGG - Intronic
954001022 3:47557185-47557207 CAGGATAAATTATCTGAGAAAGG + Intergenic
954451935 3:50576338-50576360 CAGGAAAAACTCTGGGAGCAGGG + Intronic
957726446 3:84072917-84072939 CATAATGAGGTCTCTGAGCAAGG + Intergenic
957843704 3:85703264-85703286 CAGGATCAGCACTCTGAACAGGG + Intronic
957880294 3:86203370-86203392 CTGAATGAAAGCTCTGAGCAAGG + Intergenic
960300655 3:115999067-115999089 CAGTATTAACACTCTGAGCTGGG - Intronic
961325299 3:126105940-126105962 CAGGAAGAACTCCCTGAGGGAGG + Intronic
962149673 3:132879593-132879615 CAAGATGAACTCTTTGGGCCTGG - Intergenic
962369575 3:134810020-134810042 CAGGATGCAGTATGTGAGCAAGG - Intronic
962450989 3:135516835-135516857 TAGGATACACTCTCAGAGCAAGG + Intergenic
964043506 3:152293836-152293858 CTGGATGGCCTCTATGAGCAAGG - Intronic
967378767 3:188834416-188834438 TAGTGTGAACTCTCTGAGCCTGG + Intronic
967924743 3:194637333-194637355 CAGCATGAACCCTCAGAGCTGGG + Intergenic
968370416 3:198220162-198220184 CACGCTGACCTCTCTCAGCATGG - Intergenic
969370725 4:6729418-6729440 TAGAATGAACTTTCTGAGGAAGG + Intergenic
971529940 4:27674504-27674526 CAGACTGAACTTTTTGAGCATGG - Intergenic
975901315 4:79156518-79156540 AAGGCTGACCTCCCTGAGCAAGG - Intergenic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
978987241 4:115028288-115028310 CAGGATAAACACTCTTAACAAGG + Intronic
980831285 4:138131966-138131988 GATGATGAACTCTCTAAGCTTGG + Intergenic
984843551 4:184090887-184090909 CAGGATGAACTCTCTGAGCAGGG - Exonic
987245394 5:16043125-16043147 CAGGATGACCTTTCTGAGCTAGG - Intergenic
991710963 5:69408360-69408382 AAGGATGAGCTCTCTGAAGAGGG - Intronic
997420244 5:133760991-133761013 CGGGATGAAGTCTGTGTGCAAGG - Intergenic
997885477 5:137626104-137626126 CAGGATCATTTCTCTGACCAGGG + Intronic
998219457 5:140264687-140264709 CAGAATTAATTATCTGAGCATGG + Intronic
1003247684 6:4398235-4398257 CAGGATCAGCCCTCTGAGCTGGG - Intergenic
1004039216 6:11959358-11959380 GAGCATGAAGTCTCTGAGGAGGG - Intergenic
1004589214 6:17032254-17032276 CAGCATGAATTCGCTGGGCAGGG + Intergenic
1004589471 6:17035064-17035086 AAGGAAGACCTCTCTGAGGAGGG - Intergenic
1005789275 6:29279645-29279667 CAGCATGAACTCTCTCTGGATGG - Intergenic
1006335050 6:33416026-33416048 CAGGCCGTACTCTCCGAGCAAGG - Exonic
1007183211 6:39945724-39945746 CAGGCTGTACTATCAGAGCATGG + Intergenic
1008555055 6:52665870-52665892 CAGGAAGAAAACTCAGAGCATGG + Intergenic
1009923155 6:70088099-70088121 CGGAATGAACTCTCTGTGAAAGG - Intronic
1011739326 6:90343806-90343828 CAGAGTGCTCTCTCTGAGCATGG - Intergenic
1013601509 6:111709362-111709384 AAAGCTGGACTCTCTGAGCAAGG + Intronic
1013796606 6:113895860-113895882 CAGGATGAGCTCTGTGATCATGG - Intergenic
1014038219 6:116792697-116792719 CAGGATGATGACTCTGGGCAAGG + Exonic
1017397447 6:154018725-154018747 CAGGATAAACTTTCTCTGCATGG + Intronic
1018358089 6:163038800-163038822 CAGGAAGGGCTCTCTGAGCTGGG + Intronic
1018447386 6:163870115-163870137 CAGGGTGACCTATCTGACCATGG - Intergenic
1018697115 6:166398856-166398878 CAGGATGATCGCTGTGACCAGGG + Intergenic
1019498385 7:1352107-1352129 CAGGATGGACGCCCTGAGCCTGG - Intergenic
1021213205 7:17882248-17882270 CAGCATGAAGTCACTGAACATGG - Intronic
1022473793 7:30697662-30697684 CATGGGGAGCTCTCTGAGCAGGG - Intronic
1025784524 7:64632517-64632539 CATGATGACCTCTGTGAGCAGGG - Intergenic
1027229114 7:76261928-76261950 CAGGAGGACCTCTGTGAGCTGGG + Intronic
1029259723 7:99293583-99293605 CAGGAGAGACTCTCTGAGAAGGG - Intergenic
1029445891 7:100612680-100612702 CAAGATGAGCTCCCGGAGCAGGG - Exonic
1029513809 7:101013367-101013389 CAGCATGAACTTTCTCAGGAAGG - Intronic
1031869091 7:127073011-127073033 CAGGAAAAACTCTCAGAGGAGGG + Intronic
1032488542 7:132306480-132306502 CAGTATGATCTCTCTCAGGAGGG + Intronic
1033089372 7:138371101-138371123 GAGGATGACCTCACTGAGCTGGG - Intergenic
1033358214 7:140618138-140618160 CAGGGTCACCTCTCTGATCAAGG + Intronic
1033730765 7:144176756-144176778 CAGGATGAATTCTGTGACCCAGG - Intergenic
1034291913 7:149939531-149939553 GAGGAAGAACTCCCTGAGAACGG - Intergenic
1034814170 7:154157378-154157400 GAGGAGGAACTCCCTGAGAATGG + Intronic
1037274876 8:17167163-17167185 CAGTTTGAGCCCTCTGAGCAGGG + Intronic
1038508311 8:28105712-28105734 CAGAATGAACTCTGTGGGCTGGG - Intronic
1040841217 8:51786882-51786904 CAGGCTGAACTCTCCTATCAGGG + Intronic
1041814080 8:61947560-61947582 CAGGATGAACTCTTAGACAAGGG - Intergenic
1045903548 8:107314296-107314318 CAAGATGAACTATCTGAAAAGGG - Intronic
1047322567 8:123801777-123801799 CATGATTAAATCTCTGGGCAAGG + Intronic
1049152142 8:141041831-141041853 CAGGATCACACCTCTGAGCAAGG + Intergenic
1049590964 8:143462320-143462342 CAGGAGGCACTCTGTGACCATGG + Intronic
1051145932 9:14027271-14027293 GAGGATGGACACTCTGAGCACGG - Intergenic
1051222874 9:14868959-14868981 CAGCATGAACTCTCTGAGTTGGG - Exonic
1052564046 9:30123774-30123796 CTGGATGGACTCACTGAGAATGG + Intergenic
1055392574 9:75838933-75838955 CTGGTTGAACTCTATCAGCATGG + Intergenic
1058700196 9:107593839-107593861 CAGGAGAAAGTCTCTGAGAATGG + Intergenic
1058863440 9:109139930-109139952 CAGAATGAATTCTCAGTGCAAGG + Intronic
1059255025 9:112922090-112922112 CAGGATGGGATCTCTGAGAAAGG + Intergenic
1059983115 9:119794946-119794968 CAAGATGATCTCTCTGGGGAAGG + Intergenic
1060344176 9:122802374-122802396 CAGGAAGAAGTCTCAGACCAGGG + Intronic
1060404342 9:123365866-123365888 CAGGATGGACACCCAGAGCAGGG - Intronic
1062130746 9:134891808-134891830 CAGGAGGAACTGACCGAGCATGG + Intergenic
1185461237 X:333621-333643 CAGGAGGAGCTCCCTGTGCAGGG - Intergenic
1186108520 X:6230806-6230828 AAGGAAGAACTTTCTGAGTAGGG + Intergenic
1187632841 X:21194142-21194164 CAAGATGACTTCTCTCAGCATGG + Intergenic
1191026004 X:55914036-55914058 TAGGAATAACTCTCTGAGCTGGG + Intergenic
1191710123 X:64140637-64140659 CAGGAAGGCCTCTCTGAGAAAGG - Intergenic
1196215927 X:113051225-113051247 CTGGATGTCATCTCTGAGCATGG + Intergenic
1197971684 X:132120969-132120991 CAGGATGATCTTTCTGACCTGGG + Intronic
1199879539 X:151962331-151962353 CAGGATGAGATCTCTGCCCATGG + Intronic
1201142653 Y:11041503-11041525 TAGGATGAAGTCACTGACCACGG - Intergenic