ID: 984844416

View in Genome Browser
Species Human (GRCh38)
Location 4:184097820-184097842
Sequence TGCTACTGAGAGGGGTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984844408_984844416 -7 Left 984844408 4:184097804-184097826 CCCACACCTGAGTTAATGCTACT 0: 1
1: 0
2: 0
3: 8
4: 117
Right 984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 173
984844409_984844416 -8 Left 984844409 4:184097805-184097827 CCACACCTGAGTTAATGCTACTG 0: 1
1: 1
2: 13
3: 72
4: 209
Right 984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG 0: 1
1: 0
2: 2
3: 14
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984844416 Original CRISPR TGCTACTGAGAGGGGTCCTG GGG Intronic
900103079 1:971065-971087 TCCTCCTCACAGGGGTCCTGCGG + Intronic
900514770 1:3076396-3076418 TGCTTCTGAGATGTGTTCTGAGG + Intronic
900522492 1:3112519-3112541 GGCCACTGAGCGGGGCCCTGGGG - Intronic
900965136 1:5952516-5952538 TGCTGCTGAGGAGGGCCCTGTGG - Intronic
901461145 1:9392610-9392632 TGCCTCTGGGAGGGGTCCTTCGG - Intergenic
901772293 1:11536595-11536617 TGCTGCTGGCAGGGGCCCTGGGG + Exonic
903131365 1:21281519-21281541 TGGTACTCAGAGGGGTCCCAAGG + Intronic
905349370 1:37334090-37334112 AGCTCCTTAGAGGTGTCCTGAGG - Intergenic
905539989 1:38752893-38752915 TGATACAGAGAGGGGAACTGGGG + Intergenic
908314931 1:62923188-62923210 TGCTACTGTGAGTAGTGCTGCGG + Intergenic
909888456 1:80972695-80972717 AGCTAGTGATAGGGGTACTGTGG + Intergenic
910608100 1:89109269-89109291 TCCTACTGAGAGGGATCCATGGG - Intronic
911660017 1:100490691-100490713 TGCAAATGAGGGGGGTCGTGTGG + Intronic
913598122 1:120396917-120396939 TCCCACAGAGAGGGATCCTGGGG + Intergenic
914089209 1:144482403-144482425 TCCCACAGAGAGGGATCCTGGGG - Intergenic
914309404 1:146451812-146451834 TCCCACAGAGAGGGATCCTGGGG + Intergenic
914592707 1:149121325-149121347 TCCCACAGAGAGGGATCCTGGGG - Intergenic
915476492 1:156155720-156155742 TGCTAATGAGAGAGGATCTGAGG + Intronic
915635290 1:157181987-157182009 TGCTCCTGAGAGGGGTCTTCGGG + Intergenic
915650510 1:157307226-157307248 TGCTCCTGAGAGGGGTCTCAGGG - Intergenic
917516880 1:175715598-175715620 AGCTCCTGAGAGGAGCCCTGTGG - Intronic
918531147 1:185524025-185524047 TGCTGCAGAGGGGGGTCCTCAGG - Intergenic
918712518 1:187748886-187748908 TGATAATGTGAGGGGTCCTTTGG - Intergenic
920227043 1:204446594-204446616 TGCTGCTGAGAGGCCTCCTGGGG + Intronic
922207999 1:223465786-223465808 TGCTTTTGGGAGGGGGCCTGGGG + Intergenic
924324976 1:242886490-242886512 GGCTACTGGCAGGGGTCATGTGG - Intergenic
1063705917 10:8430690-8430712 TGCTGCTGGGAGGAGACCTGGGG + Intergenic
1066522576 10:36238701-36238723 TGCCACTGAGATGTGTGCTGGGG - Intergenic
1067049429 10:43003953-43003975 TGCTACTGGGAATGGTGCTGTGG + Intergenic
1067161090 10:43825743-43825765 GGCTGCTGAGAAAGGTCCTGAGG - Intergenic
1067557995 10:47285630-47285652 GGCTTCTGAGAGGGCTCCTGAGG + Intergenic
1069801203 10:71082839-71082861 TGCTACTGTCAGGGGGACTGGGG + Intergenic
1077317184 11:1924840-1924862 GGCCCCTGAGAGGGGTTCTGAGG - Intronic
1077737196 11:4803907-4803929 TGATGCTGAGAGGGCTGCTGTGG - Exonic
1078854547 11:15196288-15196310 TACTTCTCAGAGGGGTCATGTGG - Intronic
1078860017 11:15238380-15238402 TGCTTCTGAGACAGGTCCAGTGG - Intronic
1079005602 11:16789471-16789493 TGCTACTCAGAAAGCTCCTGAGG - Intronic
1082923584 11:58522055-58522077 TGATTCTGAGAGGGGACCTTAGG - Intergenic
1083406878 11:62463661-62463683 TGGAACTGAGGGGGTTCCTGGGG + Intronic
1084121306 11:67070609-67070631 TGCCACTGAGAGGCATCCAGAGG - Intronic
1089120982 11:116134887-116134909 TCCTGCTGAGAGGCATCCTGAGG + Intergenic
1091752696 12:3032655-3032677 TGGTACTGAGTGGGGGGCTGTGG + Intronic
1093499299 12:19793743-19793765 TGCAACTAAGAGGGGCCCTCAGG + Intergenic
1094841009 12:34342710-34342732 TGCTCATGTGCGGGGTCCTGGGG + Intergenic
1096617814 12:52844214-52844236 TGGTACTGAGAGGGGAACAGAGG + Exonic
1104914571 12:132258042-132258064 TGCTGCTGAGAGGGGCCCTTGGG - Intronic
1107028829 13:35830478-35830500 AGCTACTTAGAGGGACCCTGTGG - Intronic
1115495619 14:34001522-34001544 TTCTACTGAAAGAGGTTCTGGGG + Intronic
1115789726 14:36865397-36865419 TCCTACTGAGTGGGGTACTAGGG - Intronic
1121007903 14:90502004-90502026 TGGTACTGAGGGGGGTCCTGCGG - Intergenic
1121786980 14:96669342-96669364 TGCTAATGAATGGGGTCCTGTGG - Intergenic
1122853082 14:104547200-104547222 TGTCACAGAGAGGGGTGCTGCGG - Intronic
1122993675 14:105250915-105250937 TGCCACTGGGAGGGGATCTGGGG - Exonic
1128649756 15:69401866-69401888 TTCTTCTGAGATAGGTCCTGGGG + Intronic
1132657079 16:1045877-1045899 TGCTGCAGGGAGGGGTCCGGGGG + Intergenic
1133313014 16:4863272-4863294 TGCTACTCCGAAGGGTCCTCAGG + Intronic
1133340325 16:5031815-5031837 AGCTGCTGAGTGGGGTCGTGTGG - Exonic
1134412236 16:14012631-14012653 TGCTTCTCAGAGTTGTCCTGAGG - Intergenic
1135201048 16:20437936-20437958 AGCTACTGGGGGGGGTGCTGGGG - Intronic
1136034047 16:27525239-27525261 CGGAACTGAGAGGTGTCCTGGGG - Intronic
1138507072 16:57483775-57483797 TGCTACTTTGAGAGGACCTGAGG + Intronic
1138796164 16:59971974-59971996 TGATAATGAGATGAGTCCTGGGG + Intergenic
1140715604 16:77722903-77722925 TGCCACTGTCGGGGGTCCTGGGG - Intronic
1141262943 16:82470193-82470215 TGCTACTGAGATGGGCACTTTGG + Intergenic
1142173765 16:88635641-88635663 TGCCACAGAGAGGGGCCCAGGGG - Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1144414575 17:15034185-15034207 TGCTATTAAGAGGCGTGCTGGGG - Intergenic
1144574235 17:16418817-16418839 TGCTGCTGACAGGAGCCCTGTGG - Intronic
1147904314 17:43813059-43813081 GGCTACTGAGAGGGGTGCTGTGG - Intronic
1148898694 17:50857999-50858021 TGTTAATGAGAGGGGTCTAGTGG - Intergenic
1151185869 17:72363555-72363577 TCCTACTGAGAAGGGTGTTGGGG - Intergenic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1151513925 17:74580097-74580119 TGCTCTTGAGCGGGGACCTGTGG + Exonic
1151868541 17:76820894-76820916 TGCTGCCGAGAGGGGCCTTGGGG + Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1152755779 17:82086456-82086478 TCCTGCTGTGAGGGGTCCCGGGG + Exonic
1157200269 18:45653711-45653733 TCCTGCTGACTGGGGTCCTGGGG - Intronic
1157701823 18:49765977-49765999 TGTTACTGAGAGCGATCCTTTGG + Intergenic
1159979525 18:74760579-74760601 TGCTACTGACAGTTGCCCTGAGG + Intronic
1160906538 19:1454054-1454076 TGCAGCTGGGAGGGGTCATGTGG + Intronic
1161963295 19:7534597-7534619 TGCTTATGAGAGCGGGCCTGGGG - Intronic
1162341147 19:10092143-10092165 TGCTAATGTGAGGGTTGCTGGGG - Exonic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165291777 19:34891423-34891445 TGCTACTGGCAGAGGACCTGGGG + Intergenic
1168186684 19:54704770-54704792 AGTGACTGATAGGGGTCCTGGGG - Intergenic
924990927 2:312504-312526 CTCCACTGAGAGGGGGCCTGTGG + Intergenic
925356637 2:3246691-3246713 GGCTACAGGGAGGAGTCCTGTGG - Intronic
927152457 2:20203860-20203882 TGCCACCGAGAGGGCTGCTGAGG - Exonic
928096937 2:28410467-28410489 AGCTTCTGAGAGGCTTCCTGTGG - Intronic
929782521 2:44966162-44966184 CCCTGCTAAGAGGGGTCCTGGGG + Intergenic
934759837 2:96848423-96848445 GGCTGCTGAGAGGGGTCACGGGG - Exonic
935353145 2:102172488-102172510 TGTTACTGACAGTGGTCTTGGGG + Intronic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937913024 2:127085396-127085418 TGCTGCTGTGTGGGGCCCTGAGG - Intronic
940986464 2:160056819-160056841 TACTGCTGAGAAGGGCCCTGTGG - Intronic
941189540 2:162362247-162362269 TGCTAGAGAAAGGGGTTCTGTGG - Intronic
941508596 2:166377133-166377155 TGCTTCTGAGATTTGTCCTGGGG + Intergenic
945027756 2:205635250-205635272 TGCTAGTCAGAGGGGTCATGTGG + Intergenic
946024454 2:216663675-216663697 TGCTAATCAGAGGGGTCCCTGGG + Intronic
946038407 2:216763133-216763155 TGCTAATTAGAGGGGTCTTGTGG + Intergenic
946320722 2:218952827-218952849 TGCTACTCAGACTGTTCCTGGGG - Intergenic
946332837 2:219019816-219019838 TGCTCCTGATGAGGGTCCTGGGG - Intronic
946643575 2:221809977-221809999 TTCTACTGAGAGGAGGACTGAGG + Intergenic
946709005 2:222487450-222487472 TCCAAATGAGAGGGGCCCTGTGG - Intronic
947437510 2:230085229-230085251 GGCCACTGAGATGGGGCCTGGGG - Intergenic
948409045 2:237744925-237744947 TGGTGCAGAGAGGGGTCCAGAGG - Intronic
948673832 2:239585336-239585358 TGCTTCTGTGGGGGGTTCTGAGG - Exonic
1169317321 20:4603350-4603372 TGTTGCTGAGATGGCTCCTGAGG - Intergenic
1170326335 20:15158027-15158049 TGCTAATGGGAGGGGTGGTGGGG - Intronic
1170669192 20:18414932-18414954 TGCTTCTGAGAGGAGAACTGTGG + Intronic
1171389248 20:24790606-24790628 TGGTTCTCAGAGGGGTTCTGGGG - Intergenic
1171389269 20:24790700-24790722 TGGTTCTCAGAGGGGTTCTGAGG - Intergenic
1171437478 20:25134590-25134612 TGCTCCTGAGAGGGGTTTCGGGG - Intergenic
1171975748 20:31593708-31593730 TGCTTCTGTGAGGGGGCCTCTGG + Intergenic
1172838334 20:37887161-37887183 TGCTGTTGAGAGGGCTCCTGAGG - Intergenic
1175124362 20:56740454-56740476 TGGTACTAAGAGGGGGCCTTTGG - Intergenic
1180617823 22:17140105-17140127 GACTACTGAGACGGGCCCTGAGG + Intronic
1184565393 22:45288846-45288868 TGATCCAGGGAGGGGTCCTGGGG + Intronic
1185363345 22:50422669-50422691 GGCTCCTGAGAGGGGACCAGGGG + Intronic
951930916 3:27966276-27966298 TGAAACTGAGGAGGGTCCTGGGG + Intergenic
952784705 3:37141748-37141770 TGCTACTGAGACTGTACCTGTGG - Intronic
952992226 3:38841620-38841642 TGCTACCAAGAGGTATCCTGGGG - Intergenic
953150467 3:40319825-40319847 TGCTAGTGTGAGGGGTGCAGGGG - Intergenic
954361771 3:50126000-50126022 TGCCAATGAGGGGGGTGCTGTGG + Intergenic
954450353 3:50568139-50568161 TTCTACTCAGACGGGTCCTCTGG + Intronic
954859341 3:53674691-53674713 TGCTACAGAGAAGGGAGCTGGGG + Intronic
954868633 3:53750382-53750404 TGCTACTGATAGAGGACCCGGGG - Intronic
960936174 3:122904235-122904257 AGCCACTGAAAGGGATCCTGAGG + Intergenic
961315297 3:126031414-126031436 TGCCACTGAGCGGGGCCTTGAGG - Intronic
961379048 3:126485480-126485502 GGCTACTCAGAGAGGTCCTCGGG + Intronic
962941755 3:140130970-140130992 TGTTATTGAAAGGGGTCCAGGGG - Intronic
963513922 3:146284067-146284089 TCCTACTCAGAGGCCTCCTGTGG + Intergenic
963569878 3:146980128-146980150 TGCTGCTGACAGGAGTACTGTGG + Intergenic
968392681 4:205788-205810 TGCCAGGGAGTGGGGTCCTGGGG - Intergenic
968812093 4:2804690-2804712 TCCTTCTGAGAGTGGGCCTGGGG + Intronic
969457592 4:7308951-7308973 TCCTACTGAGAAGAGTTCTGGGG + Intronic
973328169 4:48885099-48885121 AGCTACTGAGAGGGAGGCTGAGG - Exonic
973658154 4:53072764-53072786 TGCTACAGAGAAGGGTCCCAGGG - Intronic
974826822 4:67141916-67141938 TGCTACTTAGAGAGGTTGTGGGG + Intergenic
980114965 4:128670498-128670520 TGCTACAGAGAGATGGCCTGGGG - Intergenic
984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG + Intronic
984951876 4:185014135-185014157 CGGCAGTGAGAGGGGTCCTGGGG - Intergenic
986160810 5:5226697-5226719 TGCTACTGAGGGTGCTGCTGAGG + Intronic
986576904 5:9221994-9222016 TGCTAGTGAGAATCGTCCTGTGG - Intronic
988683211 5:33503190-33503212 TGCCACAGAGAGGAGACCTGGGG + Intergenic
988866958 5:35345672-35345694 TGCTTCTGAGTGGGGGCCTTAGG + Intergenic
998186460 5:139983351-139983373 TGCGTCTGAGAGTGGTCCTCAGG + Intronic
998365088 5:141625221-141625243 TGCAGAGGAGAGGGGTCCTGAGG - Exonic
999324252 5:150633429-150633451 TGCCAGTGAGAGGGGTCTTGTGG + Intronic
999672004 5:153966245-153966267 TTCTACTGTGGGGGCTCCTGTGG - Intergenic
1001858323 5:175031991-175032013 GGCCACTGAGAAGGCTCCTGTGG - Intergenic
1002418686 5:179134516-179134538 TGTCACTGAGAGGGCTCCTGAGG - Intronic
1002511800 5:179725136-179725158 AGCTACTTGGAGGGGTGCTGAGG - Intronic
1003336238 6:5175580-5175602 TACTAAGGAGAGGGGGCCTGTGG + Intronic
1004482213 6:16031766-16031788 TGCAGCAGAGAGGGGGCCTGAGG - Intergenic
1015635256 6:135268338-135268360 TGCTCCTCAGCAGGGTCCTGAGG + Intergenic
1015837714 6:137439707-137439729 AGCTTCTGAGAGGGCACCTGGGG - Intergenic
1019768048 7:2865707-2865729 TGATATTGAGGGGGCTCCTGGGG - Intergenic
1022134436 7:27434254-27434276 GGCTACTGAGAGAGATGCTGTGG + Intergenic
1023764309 7:43496595-43496617 TTCTTCTGGGTGGGGTCCTGAGG - Intronic
1023966440 7:44965347-44965369 TGCATCTGAGCGGGGTCTTGAGG - Intronic
1026671976 7:72398708-72398730 TGCTCCTCTTAGGGGTCCTGGGG + Intronic
1030002019 7:105074656-105074678 TGCAACTGAGAGTGGTGATGAGG + Exonic
1034376227 7:150647139-150647161 TGCTTCTGAGGGGGGGCCTCAGG - Intergenic
1034383941 7:150722392-150722414 GGCTATGGTGAGGGGTCCTGAGG + Exonic
1035677791 8:1467400-1467422 AGCTCCTGGGAGGTGTCCTGAGG - Intergenic
1035859079 8:3008756-3008778 TGCTACTGAAAGGAGTTATGCGG + Intronic
1038147645 8:24913525-24913547 TGGGACTGAAAGGGGACCTGGGG + Exonic
1039305045 8:36252196-36252218 TGCTGCTCAGAGGGATTCTGGGG - Intergenic
1040995396 8:53396001-53396023 TGCAAATGAGAGGCCTCCTGGGG + Intergenic
1045480047 8:102584485-102584507 TGCTTCTGAAAGAGTTCCTGTGG + Intergenic
1049830974 8:144700520-144700542 TGCTCCTGAGAAGGGTCCTCGGG + Intergenic
1051974786 9:22936202-22936224 GGCTACTCAGTGGGGACCTGGGG + Intergenic
1057048805 9:91906426-91906448 TGCCACTAAGAAGGGTGCTGTGG - Intronic
1057598458 9:96436799-96436821 GGCTACTGAGAGGTGACTTGGGG - Intergenic
1059365586 9:113784280-113784302 TGGTTCTGAGAGGGGTACTGGGG + Intergenic
1059692449 9:116698762-116698784 TGCTAAACAGCGGGGTCCTGAGG + Exonic
1060243074 9:121921464-121921486 TGTTACTTAGAGGAATCCTGTGG - Intronic
1060722826 9:125989876-125989898 TGATACTCAGAGGGGTCCCTGGG + Intergenic
1061838240 9:133343005-133343027 GGTGGCTGAGAGGGGTCCTGGGG - Intronic
1062272907 9:135717961-135717983 GGATGCTGACAGGGGTCCTGAGG + Intronic
1062452302 9:136620835-136620857 TCCTCCTGAGAGGGGACCTCAGG + Intergenic
1062524440 9:136972575-136972597 TGTGACTGCCAGGGGTCCTGGGG + Intergenic
1188106837 X:26156495-26156517 GGCTGCATAGAGGGGTCCTGGGG + Intergenic
1189212835 X:39299316-39299338 TGCTACTGTGTGGGGTGTTGGGG - Intergenic
1189333499 X:40156584-40156606 GGCTGCTGAAAGGGGGCCTGGGG - Intronic
1193112285 X:77742357-77742379 TGCTACTTAAAGTGGTTCTGTGG - Intronic
1198915236 X:141663408-141663430 TCCTTCTGGGAGGAGTCCTGGGG + Intronic
1201131792 Y:10958045-10958067 TGTTACTGAGAGAGATCCTGTGG - Intergenic
1201222507 Y:11785481-11785503 GGCTAGTGGCAGGGGTCCTGTGG - Intergenic