ID: 984844687

View in Genome Browser
Species Human (GRCh38)
Location 4:184099463-184099485
Sequence TGAACACCTATTGTGTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 491
Summary {0: 1, 1: 2, 2: 9, 3: 84, 4: 395}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984844687_984844696 20 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844696 4:184099506-184099528 CCGCAGATGCCCCTGGCCATGGG No data
984844687_984844692 -4 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844692 4:184099482-184099504 TTCAATAGGTGGCAACGGTCTGG No data
984844687_984844697 21 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844697 4:184099507-184099529 CGCAGATGCCCCTGGCCATGGGG No data
984844687_984844694 19 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844694 4:184099505-184099527 TCCGCAGATGCCCCTGGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 180
984844687_984844698 26 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844698 4:184099512-184099534 ATGCCCCTGGCCATGGGGCCAGG No data
984844687_984844693 13 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844693 4:184099499-184099521 GTCTGGTCCGCAGATGCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
984844687_984844691 -9 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844691 4:184099477-184099499 AGGTGTTCAATAGGTGGCAACGG 0: 1
1: 0
2: 1
3: 11
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984844687 Original CRISPR TGAACACCTATTGTGTGTCA GGG (reversed) Intronic
901209074 1:7514436-7514458 TGAGCACCTATGATGTGGCATGG + Intronic
901932000 1:12601894-12601916 TGAGCACCTACTGTGTGCCAGGG - Intronic
902664300 1:17926731-17926753 TGAGCACCTACTATGTGCCAAGG - Intergenic
903191714 1:21660168-21660190 TAAGCACCTACTGTGTGTCTTGG - Intronic
903563542 1:24247015-24247037 TGAATACATAGTGTGTGCCAAGG - Intergenic
903667438 1:25016683-25016705 TAAACCCCTACTGTGTGCCAGGG + Intergenic
903808103 1:26019769-26019791 TGAACCCCTATTGTGGGGCCAGG - Intergenic
904028338 1:27518996-27519018 TGAGCACCTACTATGTGCCAGGG - Intergenic
904296713 1:29524186-29524208 TGAGCACCCACTGTGTGTGAGGG + Intergenic
904409616 1:30317546-30317568 TGAGCACCTACTGTGTGCCAGGG - Intergenic
904463399 1:30693586-30693608 TGAGCACCTACTGTGCGCCAGGG - Intergenic
904993746 1:34614865-34614887 TGAACACTTATTTTATGTCACGG + Intergenic
905363885 1:37438375-37438397 TGAATACCTACTGTGTGCCAGGG - Intergenic
905820362 1:40985386-40985408 TGAACATCTATTGTGTATACTGG + Intronic
906576321 1:46893667-46893689 TGAAAAGCTTTTGTGTATCAAGG + Intergenic
906576377 1:46894197-46894219 TGAAAAGCTTTTGTGTGTCAAGG - Intergenic
906595543 1:47073390-47073412 TGAAAAGCTTTTGTGTGTCAAGG + Intronic
906595600 1:47073920-47073942 TGAAAAGCTTTTGTGTATCAAGG - Intronic
906613942 1:47222461-47222483 TGGACACCTACTATGTGCCATGG - Intronic
906825086 1:48970927-48970949 TGAGCACCTACTATGTCTCAGGG + Intronic
906951423 1:50337038-50337060 TGAACACCTATCATGTGCTAGGG - Intergenic
907181527 1:52574569-52574591 TGAGCACCTGTTATGTGCCAGGG - Intergenic
907356260 1:53877119-53877141 TGAGCACCTGCTGTGTGCCAAGG + Intronic
907522547 1:55033651-55033673 TGAACACCTATTATGTACCAGGG - Intergenic
907737363 1:57127622-57127644 TGAGCACCTACTGGGTGCCAGGG - Intronic
907904308 1:58770318-58770340 TGTAAACCTACTATGTGTCAAGG + Intergenic
908407390 1:63828729-63828751 TGAACACCTACTATGTGCCAGGG - Intronic
909340405 1:74525241-74525263 TGAGCACCTCCTGTGTGTTAGGG + Intronic
909521522 1:76573996-76574018 TGAACACCTACTATGTGCTAAGG + Intronic
910071626 1:83221315-83221337 TGAAGACCTATTATGTGCCAGGG - Intergenic
910260472 1:85289072-85289094 TGAACACCTACCATATGTCAGGG - Intergenic
912406168 1:109439674-109439696 TGAACACCTACTATGTTTCAGGG + Intergenic
912504921 1:110149997-110150019 TGAGCACCTACTGTATGCCAGGG - Intergenic
912904792 1:113692971-113692993 TGAACACCTATTATATGTTCTGG + Intergenic
912970996 1:114282727-114282749 TGAATACCTAATATTTGTCAGGG - Intergenic
913408849 1:118527827-118527849 TGGGCAATTATTGTGTGTCAAGG + Intergenic
914356360 1:146887888-146887910 TGGCCACCTATTATGTGCCAGGG - Intergenic
915319680 1:155049741-155049763 TTGGCCCCTATTGTGTGTCATGG - Intronic
916128363 1:161590879-161590901 TGAACACCTATTATGTGCTAGGG + Intronic
916138282 1:161672710-161672732 TGAACACCTATTATGTGCTAGGG + Intronic
916211829 1:162365921-162365943 TTGGCACCTATTGGGTGTCATGG + Intronic
916605434 1:166337947-166337969 TTGATACCTACTGTGTGTCAGGG - Intergenic
916829522 1:168476416-168476438 TCAACACCTAATGTGTGCCAAGG + Intergenic
917442185 1:175077867-175077889 TGAGCACCTATTATGTGCCAGGG + Intronic
917444253 1:175093445-175093467 TGAACATCCATTATGTGTCAGGG - Intronic
917502875 1:175601661-175601683 TGAGAACCTGTTGTGTGCCAGGG + Intronic
917909080 1:179622427-179622449 TGATCACCTTTTCTTTGTCAAGG - Intronic
918205406 1:182304092-182304114 TAAACACCAATTGTCTGTCCTGG + Intergenic
918305742 1:183244443-183244465 TGAGTACCTACTGTGTGCCAGGG + Exonic
919765669 1:201125732-201125754 TGGACACCTCCTATGTGTCAGGG - Intronic
920219781 1:204388365-204388387 TGAGCACTTACTGTGTGCCAGGG - Intergenic
920374798 1:205502280-205502302 TGAACACCTGCTATGTGACAAGG - Intergenic
921538971 1:216388869-216388891 AGAACACCTATTGAGAGGCAAGG - Intronic
923521716 1:234740051-234740073 TGAGCACCTACTAAGTGTCAGGG + Intergenic
1063590072 10:7387081-7387103 TGAGCACCTATTGTGGGGAAGGG + Intronic
1064122469 10:12631933-12631955 TGAGCACCTCCTGTGTGCCAGGG - Intronic
1064265536 10:13822482-13822504 TAGGCACCTACTGTGTGTCAGGG - Intronic
1065614871 10:27510242-27510264 TGAATACTTATTGTATGCCAGGG + Intronic
1065777615 10:29135831-29135853 GGAACACTTATTCTGTGCCAGGG + Intergenic
1065832366 10:29626419-29626441 TGAGCACTTACTGTGTGTCAGGG - Intronic
1067535962 10:47110212-47110234 TTAACCCCTTTTGTGTATCAAGG + Intergenic
1068306483 10:55216142-55216164 TGAGCACCTATTCTATGCCAAGG - Intronic
1068655421 10:59569955-59569977 TGAACACTTATCATGTGTTATGG - Intergenic
1068896120 10:62203700-62203722 TGAACATTTATTGAGTGTCTAGG + Intronic
1069196627 10:65559015-65559037 TGTAACCCTATTGTATGTCAAGG + Intergenic
1069574691 10:69517964-69517986 TGAGCACCTACTATGTGTCTTGG - Intergenic
1069889227 10:71642862-71642884 TGAGCACCCACTGTGTGTCATGG + Intronic
1069923284 10:71830612-71830634 TAAACACCTCTTCTTTGTCAAGG + Intronic
1070604001 10:77885796-77885818 TGAACACCTGTAGGATGTCAGGG - Intronic
1071165990 10:82807371-82807393 TGAATACCTACTTTGTGTCTGGG + Intronic
1072309741 10:94142920-94142942 TGAACATCTACTATGTGCCAAGG + Intronic
1073750877 10:106525883-106525905 TGAATATCTATCATGTGTCAGGG - Intergenic
1073915203 10:108395216-108395238 TGAACGCTAATTATGTGTCAAGG - Intergenic
1074273075 10:111974020-111974042 TGAACACCTGCTATGTGTCATGG - Intergenic
1074423802 10:113333165-113333187 TGAGCAACTATTGTGTGCCAGGG - Intergenic
1074528947 10:114283734-114283756 TGAGCATCTATTATGTGCCAGGG - Intronic
1074764158 10:116688187-116688209 TGAACACCTACTGTGTGCTTTGG - Intronic
1074953292 10:118362439-118362461 TGAACACCTAATATGTGCTAAGG - Intergenic
1075290628 10:121227525-121227547 TGAATACCTACTCTGTGTCAGGG - Intergenic
1075673015 10:124277010-124277032 TGAGCACCTACTATGTGCCAGGG - Intergenic
1076100743 10:127775794-127775816 TGAGCACCTACTGTATGCCAAGG - Intergenic
1077806074 11:5592297-5592319 TGACGAGCTATTGTGTTTCAGGG + Intronic
1078328676 11:10401166-10401188 TGAGGACCTATTATGTGTCAGGG + Intronic
1079367325 11:19820745-19820767 TGAACACCTACTATGTGACAAGG + Intronic
1079443759 11:20540689-20540711 TGAACACCTATTATGGGCCAAGG + Intergenic
1079540887 11:21573330-21573352 TGGACAGCTATGGTGTTTCACGG + Exonic
1080295701 11:30724694-30724716 TGAGCACCTATTATGTGTCATGG + Intergenic
1080332506 11:31155555-31155577 TGAATACTCATTATGTGTCAAGG + Intronic
1081025098 11:38002517-38002539 TGAATACCTACTGTGAGTTATGG + Intergenic
1081936342 11:46906519-46906541 TGAACATCTTTGGTGTGCCAAGG - Intronic
1082987503 11:59181222-59181244 TGAGCACCTACTGTGTGTCAAGG + Intronic
1083563460 11:63693109-63693131 TGAACACCTCTTATGAGCCAAGG - Intronic
1083949523 11:65946347-65946369 TGAGCACCTATTGTGTGCTCAGG - Intronic
1084321650 11:68376726-68376748 TGAACACCTACTGTGTGCCTGGG + Intronic
1084587838 11:70073507-70073529 GGAACATCTATAGTGTGCCAAGG + Intergenic
1084917073 11:72436698-72436720 TGAAGACCTACTGTGAGCCAGGG - Intergenic
1085454068 11:76656003-76656025 GGAGCACCTATCGTGTGCCAGGG + Intergenic
1085498899 11:76999328-76999350 TGAACACCTGTTGTGTGGCCAGG - Intronic
1085713262 11:78849552-78849574 AGAACACCTATTGTGTGTTGAGG - Intronic
1085725434 11:78950921-78950943 TGAGCACCTACAGTGTGCCAGGG - Intronic
1085740405 11:79073792-79073814 TGAGCACTCATTGTGTATCAGGG - Intronic
1086236229 11:84634294-84634316 TGAATACTTTATGTGTGTCAGGG - Intronic
1086324230 11:85682292-85682314 TGTGCACCTATCATGTGTCAAGG - Intronic
1086576860 11:88348335-88348357 TGAGCACCTATTATGTGCTAGGG - Intergenic
1086988161 11:93272492-93272514 TCAAGCCCTATTGTGGGTCATGG - Intergenic
1087017331 11:93566718-93566740 TGAGCACTTATTATGTGCCAGGG - Intergenic
1089135771 11:116247815-116247837 TGAACCCCTATTATGTTTAAAGG - Intergenic
1089782111 11:120880880-120880902 TGAGCACCTTCTCTGTGTCAGGG + Intronic
1090054890 11:123414395-123414417 TGAGCACTTATTGTGTGCCAGGG + Intergenic
1090397390 11:126428113-126428135 TGAGCACTTATTGTGTTCCATGG + Intronic
1092052170 12:5479743-5479765 TGAGCACCTACTATGTGCCAAGG - Intronic
1092749067 12:11701660-11701682 TGAGCAGCTACTGTGTATCAGGG + Intronic
1094095021 12:26694102-26694124 AGACCACCTATTGGATGTCAGGG - Intronic
1095357349 12:41291596-41291618 TGAGCACCTACTGTGTTTAAGGG - Intronic
1095379830 12:41577488-41577510 TGAACACATATTGTGGGTGAGGG + Intergenic
1095532694 12:43208305-43208327 TAAACATCTACTGTGTGTTAGGG - Intergenic
1098336344 12:69408819-69408841 GGAGCATCTATTGTGTGTCAGGG + Intergenic
1098702035 12:73640793-73640815 TGAACACCTATTATGTCCTAGGG - Intergenic
1100050075 12:90437465-90437487 TGAACACCAATGGTATTTCAAGG + Intergenic
1100613579 12:96213003-96213025 TGAGTACCTATTGTTTGTCAGGG + Intronic
1100814235 12:98370429-98370451 TGGACACTTATTGTGTGTCAGGG - Intergenic
1101330442 12:103753508-103753530 TGGGCATCTATTATGTGTCAGGG + Intronic
1101540707 12:105662479-105662501 TGAGTACCTATTATGTGCCAGGG + Intergenic
1101549265 12:105746831-105746853 CAAACACCTACTGTGTGCCAGGG + Intergenic
1101648348 12:106652443-106652465 TGAGCCCCTACTGTGTGCCAAGG + Intronic
1101861137 12:108483380-108483402 TGAACACTTACTATGTGTCAGGG - Intergenic
1102006568 12:109592770-109592792 TGAGCACCTACTATGTGCCAGGG + Intronic
1102422214 12:112812887-112812909 TTATCACCTACTGTGTGCCAGGG - Intronic
1102497597 12:113330219-113330241 TGAGCACCTACTATGTGCCAGGG - Intronic
1102541123 12:113619878-113619900 TGAGCACCCATTTTGTGTCAGGG + Intergenic
1103040373 12:117690229-117690251 TGAGCTCCTGTTGTGTGTCAGGG - Intronic
1103181645 12:118917421-118917443 TAAGCACTTACTGTGTGTCATGG - Intergenic
1104052035 12:125201855-125201877 TGAACACCTACTATGTGCCCTGG + Intronic
1107202834 13:37742417-37742439 TGAGCACCTTCTGTATGTCAGGG + Intronic
1107292365 13:38869445-38869467 TGAACACCTACTCTGTGCCAGGG + Intronic
1108818184 13:54315959-54315981 TGTACACCCATTGTGTGATATGG + Intergenic
1108885869 13:55180357-55180379 TGAAGACCTAATGTGTAGCATGG + Intergenic
1109300553 13:60585993-60586015 TGTACAACTATTATGTTTCAAGG + Intergenic
1109792874 13:67272639-67272661 TGAGCACCTACCATGTGTCAAGG - Intergenic
1110058240 13:71005485-71005507 TGAGCACATATTATGTATCAGGG - Intergenic
1111045048 13:82804210-82804232 TGATCATCTATTGTCTCTCAGGG - Intergenic
1111172817 13:84551201-84551223 TGATCTCCTACTATGTGTCAGGG + Intergenic
1111964230 13:94845136-94845158 TGAGCACCTACTCTGTGCCAGGG + Intergenic
1112441283 13:99426621-99426643 TGAACACATATGGTGTCTGAAGG - Intergenic
1113986342 13:114319376-114319398 AGAGCACATACTGTGTGTCAGGG + Intronic
1114572278 14:23680243-23680265 TGGTTGCCTATTGTGTGTCAGGG + Intergenic
1114849328 14:26364380-26364402 TGAATACCTGTTGTGTGCCAAGG + Intergenic
1116258511 14:42589153-42589175 TGAATACTTATTGTGTTTCCAGG + Intergenic
1116946842 14:50843485-50843507 TGAATACATACTGTGTGCCAGGG + Intergenic
1117899663 14:60518577-60518599 TGAACCCCTATTATATGTGAGGG - Intergenic
1118107402 14:62675497-62675519 TGCACAGTTATTGTGTGTCTAGG - Intergenic
1118895455 14:69941969-69941991 TGAGCACCTATTATGCTTCAGGG - Intronic
1119331921 14:73801205-73801227 TGAGTACCAACTGTGTGTCAAGG - Intergenic
1120642182 14:87028793-87028815 TGAACACCTAATGTGTGTCAGGG + Intergenic
1121096910 14:91223752-91223774 TGAATGCCTGTTGTGTGCCAAGG + Intronic
1121432770 14:93899250-93899272 TGAGCACCTACTGTGTGCCCTGG - Intergenic
1121682124 14:95802387-95802409 TGACCACCTACTGTGTACCAGGG + Intergenic
1121698663 14:95934432-95934454 TGAGCACCTATTGTGTACCAGGG - Intergenic
1121797167 14:96744707-96744729 TGAGCACCTACTGTGTACCAGGG + Intergenic
1122054220 14:99081641-99081663 TGCACAGCTATTGAGTATCAGGG - Intergenic
1122087639 14:99318586-99318608 CGCACACCTACTGTGTGCCATGG - Intergenic
1122156579 14:99753698-99753720 TGAGCACCTACTATGTGCCAGGG - Intronic
1122161331 14:99786341-99786363 TGAAAACCTATCATGTGTAATGG + Intronic
1122173538 14:99898454-99898476 AGAAGACTTATTGTGTGGCAGGG + Intronic
1122190784 14:100041584-100041606 TGAGCACCTACTGTGTGTTGGGG - Intronic
1122283343 14:100637152-100637174 TGAGCACCTACTGTGAGCCAGGG - Intergenic
1122391956 14:101395546-101395568 TGAGCACCTACTGTATGCCAGGG - Intergenic
1124383543 15:29187661-29187683 TGAGCACCTCTTCTGTGTCTGGG - Intronic
1125469563 15:39989773-39989795 TGCACACCTACTGTGTGTGCTGG + Intronic
1126347661 15:47713829-47713851 TGCAAACCTATTGTGTAGCATGG + Intronic
1127393810 15:58527738-58527760 TAAGCACCTACTATGTGTCAGGG - Intronic
1127836070 15:62792259-62792281 TGAGCCCCTATTGTGTGTCAAGG - Intronic
1128702825 15:69816529-69816551 TGAACACCTCTTATGTGGGATGG - Intergenic
1129256672 15:74337725-74337747 TGAACACCTAATGAGTCTGATGG + Intergenic
1129714490 15:77839315-77839337 TGAACACCTACTGTGTGCCAGGG + Intergenic
1131276781 15:90988789-90988811 TGAACAACTACTGTGAGTTAGGG - Intronic
1131291923 15:91114002-91114024 TGAGCACCTACTATGTGCCAGGG - Intronic
1132328549 15:100993982-100994004 TGAGCACTTATTATGTGCCAGGG - Intronic
1133737075 16:8623991-8624013 TTAACACCTACTGTGAGCCAAGG + Intronic
1133749017 16:8710224-8710246 TGAGCACCTATTTTGTGCCTAGG - Intronic
1137449522 16:48557815-48557837 TGAGCTCCTACTATGTGTCAGGG + Intronic
1137895447 16:52206759-52206781 TGAGTACCTATTATGTGCCAGGG - Intergenic
1137905806 16:52320714-52320736 TGACCACCTCATCTGTGTCAAGG - Intergenic
1138282533 16:55783076-55783098 GTAACACCTATTGTGTGGGATGG + Intergenic
1138286407 16:55813543-55813565 GTAACACCTATTGTGTGGGATGG - Intronic
1138315004 16:56062399-56062421 TGAATGCCTTTTGTGTGTCCAGG + Intergenic
1139977656 16:70827575-70827597 TGGCCACCTATTATGTGCCAGGG + Intronic
1141502272 16:84452319-84452341 TGAGGACCTACTGTGTGTCAGGG + Intronic
1144891788 17:18498476-18498498 TGAGCACCTACTGTGTGCTAGGG - Intergenic
1145140434 17:20445841-20445863 TGAGCACCTACTGTGTGCTAGGG + Intergenic
1146911515 17:36651430-36651452 TGAACACCAATTGTGCGCTAGGG - Intergenic
1147424003 17:40337053-40337075 AGAGCACCTACTGTGTGTCAGGG + Intronic
1147911533 17:43858924-43858946 TGAACACCTACTACGTGTCAGGG + Intronic
1150624692 17:66834349-66834371 TGAGCACCTATTGGGTGTCCAGG + Intergenic
1150728338 17:67669730-67669752 TGTGCACCTGTTGTGTATCATGG - Intronic
1150962669 17:69931710-69931732 TTACTGCCTATTGTGTGTCACGG + Intergenic
1151347114 17:73508935-73508957 TGAGCACCTACTATGTGCCACGG + Intronic
1151776652 17:76208515-76208537 TGAACACCTAGTTTTTGCCAGGG - Intronic
1152113106 17:78368174-78368196 TGAGCACCTGCTATGTGTCAGGG + Intergenic
1152917478 17:83048880-83048902 TGGACACCTTTTGTTTGTCACGG - Intronic
1154344845 18:13533089-13533111 TGAGCACCTACTGTGTGTCAGGG + Intronic
1155434115 18:25793187-25793209 TGAGCACCTGTTATGTGTAAGGG - Intergenic
1156178253 18:34573055-34573077 TGAGCACCTACTGTGTGCAAAGG - Intronic
1156937718 18:42730929-42730951 TGAGAACCCATTATGTGTCAAGG - Intergenic
1157396740 18:47347930-47347952 TGAGCACCTACTATGTGTCAGGG - Intergenic
1157685458 18:49639427-49639449 CGATCACCTACTGTGTGCCAAGG - Intergenic
1158294619 18:55981705-55981727 TGAACACTCTTTTTGTGTCAGGG - Intergenic
1158414020 18:57233339-57233361 TGAACACCTACTGTCTGCCAGGG - Intergenic
1159057430 18:63479733-63479755 TGAGTACCTAATTTGTGTCAGGG - Intronic
1159781523 18:72666114-72666136 TAAGCACCTATTATGTGCCAGGG + Intergenic
1160796540 19:948246-948268 TGAGCACCTCCTGTGTGTCCTGG - Intronic
1160937376 19:1603288-1603310 TGAGCACCTACTATGTGTTAGGG - Intronic
1161474627 19:4477403-4477425 TTAACACCCATGGTGTGTCTAGG + Intronic
1161704009 19:5809630-5809652 TGAGCGCCTACTGTGTGCCAGGG - Intergenic
1162342578 19:10100633-10100655 TGAGTGCCTATTGTGTGCCAGGG + Intronic
1162767546 19:12929050-12929072 TGAGAACCTAATGTGTGCCAGGG + Intronic
1163223452 19:15938029-15938051 TGAACACCTGTTAGGTGTTAAGG + Intergenic
1165788177 19:38474846-38474868 TGAAAACCCATTGTGTCTCTTGG + Intronic
1166081790 19:40448238-40448260 TGATTACCTATTGTGTGGCCAGG + Intronic
1166515902 19:43446697-43446719 TGAACACCTACTGTGTGTTAGGG - Intergenic
1167560402 19:50223473-50223495 TGAGCACCTACTGTGTGCCTGGG + Intronic
1167707931 19:51092833-51092855 TGAACACCTCCTATGTGCCAGGG - Intergenic
1168060483 19:53889473-53889495 TGAGCACCTGCTGTGTGCCAGGG - Intronic
1168140287 19:54381442-54381464 TGAGTATCTATTGTGTGCCAGGG - Intergenic
1168439930 19:56355815-56355837 TAAGCACCTATTATGGGTCAAGG + Intronic
925002065 2:411164-411186 TGAAGACCTAATGTTTATCATGG - Intergenic
925450211 2:3962772-3962794 TGAAGACTTAGTGTGCGTCAAGG + Intergenic
925705026 2:6676622-6676644 TGAATACCTAATATATGTCAGGG - Intergenic
926607570 2:14913148-14913170 TGAATGCCTTCTGTGTGTCAGGG + Intergenic
926982597 2:18587046-18587068 TAAATACGTATTGTGTGGCAGGG + Exonic
927752824 2:25685218-25685240 TGCACACCTTTGGCGTGTCACGG - Intergenic
927881140 2:26691151-26691173 TAAGCATCTGTTGTGTGTCAGGG - Intergenic
928244518 2:29615716-29615738 TGAGTACCTACTGTGTGCCATGG - Intronic
929361070 2:41091009-41091031 TGAAGATCTAATATGTGTCATGG + Intergenic
930285248 2:49420152-49420174 TGAGCATTCATTGTGTGTCAGGG - Intergenic
930681707 2:54263948-54263970 TGACCACCTTTTGTGTGTCAGGG + Intronic
930688198 2:54331176-54331198 TGAGCACATACTGTGTGTCAGGG + Intronic
931652464 2:64480863-64480885 TGAACACCTATCTTATCTCATGG + Intergenic
933841718 2:86292382-86292404 TGAGCACCTACTGTGTGCCCTGG + Intronic
934780589 2:96967322-96967344 TGATCACCTACTGTGCATCAGGG - Intronic
936628608 2:114175531-114175553 TGAACACCTACTATGTTCCAGGG + Intergenic
936877024 2:117202306-117202328 TGAACTCCTAGTATGTGTCAAGG - Intergenic
937302895 2:120854025-120854047 CAAACACCTATTGTGTATCGGGG + Intronic
937542507 2:122975828-122975850 TCTTCACCTATTATGTGTCAGGG + Intergenic
938251895 2:129821914-129821936 TGCACACCTGTGCTGTGTCAGGG + Intergenic
940984367 2:160037990-160038012 TGAACACCTACTATGTGCCAGGG - Intronic
941704328 2:168641674-168641696 TGAACACCTCTCGTGGCTCAGGG - Intronic
942666502 2:178325006-178325028 AGAAGACCTTTTCTGTGTCATGG + Intronic
942689826 2:178573537-178573559 TGAATACATATTCCGTGTCATGG - Exonic
943714265 2:191133263-191133285 TGAGCACCTAGTATGTGTCTAGG + Intronic
943715938 2:191151830-191151852 TGAACCCCTACTGTGAATCAAGG - Intergenic
943842887 2:192602692-192602714 TGAACACCCATTGTGTGATATGG + Intergenic
944175137 2:196820505-196820527 TGAATACATACTATGTGTCAGGG + Intergenic
946047402 2:216832756-216832778 TGAGGACCTACTGTGTGTTAGGG + Intergenic
946202936 2:218081563-218081585 TTAGCACCTACTGTGTGCCAAGG - Intronic
947414707 2:229882731-229882753 TAAACGCCTACTGTATGTCATGG + Intronic
947774057 2:232693906-232693928 TGAGCATTTACTGTGTGTCAGGG + Intergenic
948499790 2:238383324-238383346 TGAGCACCTACTGTGTGCCAGGG - Intronic
948698219 2:239744781-239744803 TGCACACCTGCTGTGTGTCTGGG + Intergenic
1168966621 20:1902486-1902508 TGAGCACCTACTATGTGCCAGGG + Intronic
1170562077 20:17567299-17567321 TAAACACCTACTATGTATCAGGG + Intronic
1170840504 20:19921500-19921522 TCAACAACTAATGTGTGCCAGGG + Intronic
1171373028 20:24673929-24673951 TGAGCACCTATTGTGTACAAGGG + Intergenic
1171773432 20:29345059-29345081 TGAACACCTACTGTGTATAAGGG - Intergenic
1172192390 20:33069768-33069790 TGAGGCCCTACTGTGTGTCAGGG - Intronic
1172320081 20:33989558-33989580 TGAGCACCTTCTGTGTATCAGGG + Intergenic
1173951820 20:46999395-46999417 TGAGCACCTACTGTGTGCCAGGG + Intronic
1174423030 20:50412694-50412716 TGAGCACCTACTGTGTGCCAGGG - Intergenic
1174579949 20:51564245-51564267 TGTCCACCTACTGTGTGCCAAGG + Intergenic
1175187637 20:57189788-57189810 TGAGCACCTACTGTGTGCCAGGG + Intronic
1175315766 20:58045498-58045520 TAAGCACCTACTGTGTGCCAAGG + Intergenic
1178378458 21:32088468-32088490 TGAACATCTTTTATGTGTCAGGG + Intergenic
1181040849 22:20191981-20192003 TGAGCACCTACTGTGTGCAAGGG + Intergenic
1181409099 22:22705535-22705557 TGCAACCCTATTGTGGGTCAGGG + Intergenic
1181891091 22:26064361-26064383 TGATCACCCACTATGTGTCAGGG + Intergenic
1182050622 22:27310252-27310274 TGAATACCTATTGCATGCCATGG + Intergenic
1182332553 22:29561337-29561359 TGCACACCAGGTGTGTGTCAGGG - Intronic
1182533806 22:30984465-30984487 CTATCACCTATTGTGTGACATGG - Intergenic
1183087667 22:35496575-35496597 TGAGCACCTACTATGTGCCAGGG - Intergenic
1183353338 22:37345455-37345477 GGAGCACCTACTGTGTGCCAGGG - Intergenic
1183596142 22:38813216-38813238 TAAACACCTACTCTGTGCCAGGG + Intergenic
1183677603 22:39308370-39308392 TGAGCACCTACGGTGTGCCAAGG - Intergenic
1184907148 22:47496113-47496135 TGGAGACCTATTGTATGGCATGG + Intergenic
949138541 3:602183-602205 TGAACAGCTAATATGTCTCACGG + Intergenic
949752416 3:7369766-7369788 TGAATACCTGTTCTGTGTCAGGG - Intronic
950020285 3:9782444-9782466 TGAGGGCCTACTGTGTGTCAGGG - Intronic
950125757 3:10508901-10508923 TGGACACCGATTGAGAGTCAGGG + Intronic
950314006 3:11984460-11984482 TGAGCACCTACTGTGTTCCAGGG + Intergenic
953335131 3:42088244-42088266 TGAGGACCTCCTGTGTGTCAGGG + Intronic
953553981 3:43927767-43927789 TGAACCCCTTCTGGGTGTCATGG - Intergenic
953664283 3:44914947-44914969 TGAACACCTACTGTATGCCAGGG - Exonic
954266441 3:49473517-49473539 TGAACACACATTGTCTCTCACGG - Intronic
954378589 3:50207640-50207662 TGAGCACCTACTGTGTGCCCGGG + Intronic
955411707 3:58659675-58659697 TGCACACCTACTGTGTGCCTCGG - Intronic
956029945 3:65026629-65026651 TGAGTGCCTACTGTGTGTCAAGG - Intergenic
956439315 3:69264341-69264363 TGAACACCTGCTGTGTGCCAGGG - Intronic
956497654 3:69845948-69845970 TGAGCACCTACTTTGTGGCAAGG + Intronic
956728948 3:72178917-72178939 TGAGCACCTTCTATGTGTCAGGG + Intergenic
956920599 3:73924735-73924757 TGAATATCTATTTTGTGTCAAGG + Intergenic
959598046 3:108149039-108149061 TGAATACCTTCTGTGTCTCAGGG - Intergenic
962202424 3:133412732-133412754 TGAACACCCGCTGTGTGTCGAGG - Intronic
962412914 3:135156999-135157021 CGTGCACCTATTGTGTGCCAGGG + Intronic
963051112 3:141144831-141144853 TGAATACCTATTATGTGCCTAGG + Intronic
963553431 3:146754470-146754492 TGAACACCTCACCTGTGTCATGG - Intergenic
963591281 3:147262687-147262709 TGAACATCTATTACATGTCAGGG - Intergenic
964303239 3:155312102-155312124 TGAAGCCCTATGGTTTGTCAGGG - Intergenic
964403509 3:156324532-156324554 TGAGCACCTACTTTGTGCCAAGG + Intronic
965250029 3:166331209-166331231 TGAATACCTATTATGTGCCAGGG - Intergenic
965488290 3:169305926-169305948 TTAACAACTAATGTGTGTCTAGG - Intronic
966533615 3:181007387-181007409 TCAACCCCTATTGTGTGGCCTGG - Intergenic
966556038 3:181261152-181261174 TGAACACTTTTTTTGAGTCAAGG - Intergenic
966932617 3:184685683-184685705 ATAACAGCTATTGTGTGTCGAGG - Intergenic
966947745 3:184789246-184789268 TGAACACCTGGTGTGTGCCTGGG + Intergenic
967971667 3:195003934-195003956 TGAGCACCTATTTTGCGCCAGGG - Intergenic
968489824 4:883958-883980 TGAGTCCCTGTTGTGTGTCAGGG - Intronic
969057114 4:4408942-4408964 TGAACACCTACTGTGTGCTGGGG + Intronic
969528412 4:7715937-7715959 GGAACACCTACTGTGTGTTGTGG - Intronic
969849542 4:9945374-9945396 TGAACACCTACAGTGTGTGCAGG - Intronic
969987681 4:11228338-11228360 TAAAAACCTATTTTGTGCCAGGG + Intergenic
970734512 4:19150232-19150254 GGAACACCTGTTGGGTATCATGG - Intergenic
971132882 4:23833030-23833052 TGAACATCTACTCTGTGCCAGGG + Intronic
971278260 4:25218283-25218305 CTACCACCTATTGTGTATCAGGG - Intronic
971401313 4:26278028-26278050 TGAGCACCTATTATGTGCCAAGG + Intronic
972050822 4:34731030-34731052 TGAACACATAGTATGTGTTAAGG + Intergenic
972771980 4:42205759-42205781 TGAGCACCATTTGTGTGCCAAGG + Intergenic
973780861 4:54287243-54287265 TGAGCACCTACTATGTGCCAGGG + Intronic
975194204 4:71504643-71504665 TGAAGACTTATTGTGTTTCATGG + Intronic
975782630 4:77855667-77855689 TGAACACTTACTGTGTGCCAGGG - Intergenic
978555383 4:109973782-109973804 TGAGCACCAACTGTGTGTCAGGG - Intronic
979455825 4:120924317-120924339 TGAACACCTACTATTTTTCAAGG - Intergenic
979768900 4:124497910-124497932 TGAACATCTGTTGTGTTCCAAGG - Intergenic
980086163 4:128392404-128392426 TAAGCACCAATTTTGTGTCAGGG + Intergenic
981433654 4:144692749-144692771 TGAGCACCAATAGTGTGTCAGGG + Intronic
981699062 4:147588472-147588494 TGAATACCTATTGTACGCCAAGG + Intergenic
982472993 4:155816338-155816360 TGAACCCCTACTCTGTGACAAGG - Intergenic
982488616 4:155999967-155999989 AGAACACCCAGTGTGAGTCAGGG - Intergenic
983321981 4:166206324-166206346 TGAGCAACTAATGTGTGGCAGGG - Intergenic
983599346 4:169507307-169507329 TGAACACCTGCTGTATGTCAAGG - Intronic
984844687 4:184099463-184099485 TGAACACCTATTGTGTGTCAGGG - Intronic
987259165 5:16186453-16186475 TGAATACCCATTATGTGCCAAGG - Intergenic
987640908 5:20611316-20611338 TGAAAAACTATTTTGGGTCATGG + Intergenic
988407287 5:30840140-30840162 AGAACACTTACTCTGTGTCAGGG + Intergenic
989107621 5:37878564-37878586 TGAACACTTATTGTGTGCCGGGG - Intergenic
989307919 5:39979203-39979225 TGTACTCCTATTGTGTGGCCTGG + Intergenic
990206441 5:53434422-53434444 TGAACACCTATCATGTGCCAGGG - Intergenic
990208166 5:53452602-53452624 TAAACACCTACTATGTGCCAGGG - Intergenic
990247781 5:53880562-53880584 TGAACACCTACTATGTACCAGGG - Intergenic
990344930 5:54862688-54862710 TGAATATCTATTTTGTGTCAGGG - Intergenic
991169742 5:63608218-63608240 TGCATACCTATTGTCTATCAAGG + Intergenic
992720181 5:79552934-79552956 GGAACACCTAATATGTGCCAAGG - Intergenic
995010901 5:107256144-107256166 TGAACACTTACTCTGTGCCAGGG + Intergenic
995299912 5:110567411-110567433 TGAGCACTTATTGTGTGTATTGG + Intronic
995326758 5:110898327-110898349 TGAACACCTGAAGTGTGTCTAGG - Intergenic
996292339 5:121866801-121866823 TGAACAGCTATCATGTGCCAGGG - Intergenic
997275702 5:132586482-132586504 TGAACACCTATTGCATGTTCTGG + Intronic
997452770 5:133996679-133996701 TGAATGCCTATTATGTGCCAGGG - Intronic
997821533 5:137070457-137070479 TGAACACCTACTCTATGCCAGGG - Intronic
997828061 5:137125218-137125240 TGAACACCTGCAGTGTGCCAAGG + Intronic
998389280 5:141776835-141776857 TGAGCACCTACTGTGTTTCAAGG - Intergenic
998413481 5:141928637-141928659 TGAGCACCTATTATGTGCCATGG + Intronic
998426032 5:142029400-142029422 TGAACACTTACTGTGTCTTAGGG + Intergenic
999972860 5:156882567-156882589 TGAGCACCTACTGTATGCCAAGG + Intergenic
1000448757 5:161358325-161358347 TGAACACAATTTGGGTGTCATGG + Intronic
1001334188 5:170783980-170784002 TGAACACCTAATGAGCATCAGGG + Intronic
1001543803 5:172557704-172557726 AGGATACCTAATGTGTGTCAGGG + Intergenic
1001583612 5:172817788-172817810 TGGACACCTACTCTCTGTCAAGG - Intergenic
1001871633 5:175161167-175161189 TGAACATCTAGGGTGTGTCATGG + Intergenic
1001905239 5:175466682-175466704 TGAACACATTCTGTCTGTCAGGG + Intergenic
1003968403 6:11275319-11275341 AGAGAATCTATTGTGTGTCATGG + Intronic
1004075237 6:12339102-12339124 TGAACACCTATTTTGTCCTAAGG + Intergenic
1005357741 6:25000433-25000455 TGAGCACTTACTATGTGTCAGGG - Intronic
1006167837 6:32075693-32075715 GGAGCACCTACTGTGTGCCAGGG - Intronic
1006904913 6:37526726-37526748 TGCATACCTACTGTGTGCCAGGG - Intergenic
1007255146 6:40523194-40523216 TGAGCACCTGCTGTGTGGCAAGG - Intronic
1007329284 6:41091859-41091881 TGAGCACCTACTATGTGCCAGGG + Intronic
1007495063 6:42254311-42254333 TGAACACTTACTGTGTATTAGGG - Intronic
1007653527 6:43438083-43438105 TGGACACCTTTTGGGGGTCAGGG + Intronic
1007931665 6:45697368-45697390 TAAAGACCTACTGTGTGTCAGGG - Intergenic
1008786081 6:55169897-55169919 TGAGTATCTATTGTGTGTCCAGG - Intronic
1010059481 6:71606091-71606113 TAAATATCTATTGTGAGTCAGGG + Intergenic
1010500389 6:76593044-76593066 TGGACACCTACTATGTGCCAGGG - Intergenic
1011765358 6:90613905-90613927 TGTACACCTATTCCGTATCAGGG - Intergenic
1012901930 6:105016673-105016695 TGAACACCTGCTATGTTTCAGGG + Intronic
1013362589 6:109408008-109408030 TCACCACCAGTTGTGTGTCAAGG + Intronic
1013986805 6:116203962-116203984 TGATCACCGTGTGTGTGTCAGGG - Intronic
1015458272 6:133455682-133455704 TTAACACCTCTTGTGTTTCCTGG - Intronic
1015516153 6:134084518-134084540 TGATCACCTATTGTGTGTCACGG + Intergenic
1016010308 6:139132688-139132710 TGAATACTTACTGTGGGTCAAGG + Intergenic
1016730667 6:147423990-147424012 TTAGCACCTATTATGTGTCTAGG - Intergenic
1016879830 6:148900160-148900182 ACAACACCTAATGTGTGTGAAGG - Intronic
1017654862 6:156617910-156617932 TAAACACTTACCGTGTGTCAGGG + Intergenic
1018235125 6:161716566-161716588 TGAGTACCTATTGTGTTTAAGGG + Intronic
1019408970 7:898433-898455 TGAGCGCCTGTTGTGTGTCACGG - Exonic
1022489207 7:30803831-30803853 TGTACACTTATGGTGGGTCATGG + Intronic
1022586152 7:31614440-31614462 TGAGCACCCATTATGTGTCCAGG + Intronic
1023159847 7:37286398-37286420 TGAGCACCTATTGCTTGCCAGGG - Intronic
1023374128 7:39539266-39539288 TGAACACCTATTATATGAAATGG + Intergenic
1025060971 7:55807302-55807324 TGAACACTTACTGATTGTCAGGG - Intronic
1025247946 7:57331686-57331708 TGAGCACCTACTGTGTGCCAGGG + Intergenic
1026063647 7:67049171-67049193 TGAACGCCTATTGTACATCAGGG + Intronic
1026382147 7:69810450-69810472 TAAACAACTACTGTGTGCCAAGG - Intronic
1026439235 7:70429241-70429263 TGAGCATCTATTGTGTCCCAAGG + Intronic
1027289337 7:76686268-76686290 TGAAGACCTATTATGTGCCAGGG - Intergenic
1027403941 7:77838556-77838578 TGAAAACCTACTGTATGTCCTGG + Intronic
1027514413 7:79124303-79124325 TGAACAGCTATTATGTGCCTGGG + Intronic
1027985309 7:85280416-85280438 AGAATAACTCTTGTGTGTCAAGG + Intergenic
1028214149 7:88111091-88111113 AGAAAACCTATCGTGTGTCTTGG + Intronic
1028294136 7:89106142-89106164 TTTACACCTAGTGTGTGGCATGG + Intronic
1028981795 7:96975321-96975343 TTAACACCTATGATATGTCAGGG - Intergenic
1029258502 7:99285572-99285594 GGAGCACCTACTGTGTGCCAGGG + Intergenic
1030289291 7:107856332-107856354 TGAGCACCTATTATGTGCCAAGG + Intergenic
1030580463 7:111348433-111348455 TGAACATCTACTGTGTTTTAGGG - Intronic
1031358479 7:120817896-120817918 TGAACACCTATTATGTGATGAGG - Intronic
1032670903 7:134081570-134081592 TGACCATCTATTATGTGCCAGGG - Intergenic
1034214614 7:149395592-149395614 TGAGCATCTATTGAGTGCCAAGG - Intergenic
1034596074 7:152193453-152193475 TGAACACATACTCTGTGGCAGGG + Intronic
1035292855 7:157850671-157850693 TCTACACCTTTTGTCTGTCAAGG - Intronic
1037673596 8:21036093-21036115 TGCACACCTGTTCTGTGTTAAGG - Intergenic
1037794552 8:21981070-21981092 TGAATACCTACTCTGTGCCAGGG + Intronic
1038579120 8:28731917-28731939 TGAACCCGTACTGTGTGCCAGGG + Intronic
1039523421 8:38192062-38192084 TGAAAAACTAGGGTGTGTCAAGG + Intronic
1040874151 8:52132957-52132979 TGAACACGGATTGAGTTTCAGGG - Intronic
1041411543 8:57561570-57561592 TGAGCTCCTATTGTGTTTCTGGG - Intergenic
1041756742 8:61322130-61322152 TGAGCACCTACTCTGTGCCAGGG - Intronic
1042007693 8:64200425-64200447 TGAATACCTTCTGTATGTCAGGG - Intergenic
1042208270 8:66350963-66350985 TGAGCATCTATTATGGGTCAGGG - Intergenic
1042802841 8:72739277-72739299 TGAACACCTATTATGTGCCACGG + Intronic
1043288897 8:78571070-78571092 TGAACACCTAATGTATACCAAGG - Intronic
1044246468 8:89952505-89952527 TGAGAACCTAGTGTGTATCAAGG - Intronic
1044561438 8:93616491-93616513 TGAACACCTACTAAGTGTTATGG - Intergenic
1044875678 8:96663732-96663754 TGAACAAATATTGTGTGTGTAGG + Intronic
1045108487 8:98917203-98917225 TAAGTGCCTATTGTGTGTCAAGG - Intronic
1046051749 8:109031289-109031311 TGAGCACCTGCTATGTGTCAGGG - Intergenic
1046723692 8:117651873-117651895 TGAGCACTTGTTATGTGTCAAGG + Intergenic
1047168128 8:122463370-122463392 TGATCACCTACTATGTGTTAGGG + Intergenic
1047515432 8:125550342-125550364 TGAGAACCTACTGTGTGCCAGGG - Intergenic
1047914766 8:129570662-129570684 TGAAAATCTATTGTCTGTAAGGG - Intergenic
1048439087 8:134446715-134446737 TGAATGCCTACTTTGTGTCAAGG + Intergenic
1048774326 8:137929126-137929148 TGAACTCAAATTGAGTGTCAAGG + Intergenic
1048883792 8:138892424-138892446 TGAACACCTACTCTATGCCAGGG - Intronic
1048982345 8:139709543-139709565 TGAGCACCTACTGTGTGCCGGGG - Intergenic
1050902873 9:10967640-10967662 TGAACACCCATTGTGTGATACGG + Intergenic
1051489941 9:17651048-17651070 AGAACACCTATTTTGTTTCTTGG + Intronic
1053304678 9:36975805-36975827 TGAGCACTTACTATGTGTCAGGG - Intronic
1053312819 9:37030098-37030120 CGAACACCTACTGTGTGAAAGGG - Intronic
1053737882 9:41113164-41113186 TGTACACCCATTGTGTGATATGG + Intergenic
1054690467 9:68318156-68318178 TGTACACCCATTGTGTGATATGG - Intergenic
1054735017 9:68742393-68742415 TGAGCCCTTATTATGTGTCAAGG + Intronic
1054773051 9:69100907-69100929 TGAACACATACTATGTGTCAGGG + Intergenic
1056295056 9:85184516-85184538 TGACCACCTACTGTGGGTCTAGG + Intergenic
1056409774 9:86313451-86313473 TGAGCACCTAATGTGTGATAGGG + Intronic
1056510251 9:87297837-87297859 TTAGCACCTACTATGTGTCAAGG - Intergenic
1057535801 9:95904647-95904669 TGAGCACTTACTGTGTGCCAAGG - Intronic
1059088301 9:111328728-111328750 TAAAGACCTACTGTGTGCCAAGG - Intergenic
1059476852 9:114554252-114554274 TGTACACCTAGTTGGTGTCATGG - Intergenic
1059662001 9:116410951-116410973 AGAAGACCTACTGTATGTCAGGG - Intergenic
1059770994 9:117425475-117425497 TGAACACCTCCTATGTGTCAGGG - Intergenic
1059968007 9:119635502-119635524 TAATCACCTACTATGTGTCAAGG + Intergenic
1060068268 9:120524217-120524239 TGAACACATACTATGTGCCAAGG - Intronic
1060248299 9:121965003-121965025 TGAGCACTTACTGTGTGTCAGGG - Intronic
1060579664 9:124733609-124733631 TGAGCTCCTACTGTGTGGCAAGG - Intronic
1061199925 9:129131960-129131982 TGAGCACTTACTGTGTGTCAAGG + Intronic
1061242335 9:129381907-129381929 TAAGCACCTACTGTGTGCCAGGG + Intergenic
1061506753 9:131036019-131036041 TGAACACCTACTATGTGCCCTGG - Intronic
1061627757 9:131851557-131851579 TGAGCACCTGCTGTGTGTGAGGG + Intergenic
1186551957 X:10515785-10515807 CGAACATCTATTAAGTGTCAAGG + Intronic
1187016791 X:15336687-15336709 TGAGCATCTAATATGTGTCAGGG - Intergenic
1187501167 X:19839847-19839869 TGAGCACCTACTGCATGTCATGG - Intronic
1187808102 X:23143372-23143394 TGAACACCTATTATTTACCAGGG - Intergenic
1188645557 X:32562497-32562519 TTAAAACCTATTGTGAGGCAGGG - Intronic
1188867930 X:35337534-35337556 TGAGCACCTACAGTGTGCCAGGG + Intergenic
1189022918 X:37360910-37360932 TGAACACCTTTGGTATGTAAGGG + Intronic
1189737524 X:44087017-44087039 TGAACAACTACTGTATGTCTGGG - Intergenic
1190170827 X:48110298-48110320 TGAAGCCCTACTGTGTGGCAGGG + Intergenic
1190176961 X:48158264-48158286 TGAAGCCCTACTGTGTGGCAGGG + Intergenic
1191196897 X:57733856-57733878 TGTATAACTCTTGTGTGTCAGGG - Intergenic
1193527341 X:82609766-82609788 TGAACACCTACTATCTGGCAAGG - Intergenic
1193872022 X:86810373-86810395 TGAATAAATATTTTGTGTCAAGG - Intronic
1195134075 X:101886107-101886129 TGAACTCCTACTATGTGCCAGGG + Intronic
1195560808 X:106281232-106281254 TGAACACCTCTTCTGTGGTAGGG - Intergenic
1196106117 X:111897265-111897287 GGGAGACCTATTGTGTGTCAAGG - Intronic
1196125419 X:112093537-112093559 TGGATACCTCTTGTGTGCCAAGG + Intergenic
1196307277 X:114118872-114118894 TGAAGACCGATTGGGTCTCAGGG + Intergenic
1196890347 X:120285328-120285350 TGAACACCCAATGTGTGGGAAGG + Intronic
1197633399 X:128887781-128887803 TGAACACTTACTATGTCTCAGGG + Intergenic
1197872890 X:131076114-131076136 TGAACATCTATTGTGTGCTAGGG + Intronic
1198089552 X:133314062-133314084 TGAGCACCTACTATGTGCCAGGG + Intronic
1199470046 X:148185057-148185079 TGAGCACCTACTTTGTGTCAAGG - Intergenic
1199661421 X:150054225-150054247 TGAGCACCTACTGTGTGCCCTGG + Intergenic
1200325292 X:155231501-155231523 TGAGCACTTATTATGTGTCAGGG - Intronic
1201962854 Y:19701139-19701161 TGAAGACCTTTTCTGTGTCGAGG - Intergenic