ID: 984844688

View in Genome Browser
Species Human (GRCh38)
Location 4:184099464-184099486
Sequence TTGAACACCTATTGTGTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3430
Summary {0: 1, 1: 10, 2: 88, 3: 721, 4: 2610}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984844688_984844693 12 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844693 4:184099499-184099521 GTCTGGTCCGCAGATGCCCCTGG 0: 1
1: 0
2: 0
3: 8
4: 101
984844688_984844698 25 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844698 4:184099512-184099534 ATGCCCCTGGCCATGGGGCCAGG No data
984844688_984844694 18 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844694 4:184099505-184099527 TCCGCAGATGCCCCTGGCCATGG 0: 1
1: 0
2: 1
3: 16
4: 180
984844688_984844691 -10 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844691 4:184099477-184099499 AGGTGTTCAATAGGTGGCAACGG 0: 1
1: 0
2: 1
3: 11
4: 135
984844688_984844692 -5 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844692 4:184099482-184099504 TTCAATAGGTGGCAACGGTCTGG No data
984844688_984844696 19 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844696 4:184099506-184099528 CCGCAGATGCCCCTGGCCATGGG No data
984844688_984844697 20 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844697 4:184099507-184099529 CGCAGATGCCCCTGGCCATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984844688 Original CRISPR TTGAACACCTATTGTGTGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr