ID: 984844696

View in Genome Browser
Species Human (GRCh38)
Location 4:184099506-184099528
Sequence CCGCAGATGCCCCTGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984844688_984844696 19 Left 984844688 4:184099464-184099486 CCTGACACACAATAGGTGTTCAA 0: 1
1: 10
2: 88
3: 721
4: 2610
Right 984844696 4:184099506-184099528 CCGCAGATGCCCCTGGCCATGGG No data
984844687_984844696 20 Left 984844687 4:184099463-184099485 CCCTGACACACAATAGGTGTTCA 0: 1
1: 2
2: 9
3: 84
4: 395
Right 984844696 4:184099506-184099528 CCGCAGATGCCCCTGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984844696 Original CRISPR CCGCAGATGCCCCTGGCCAT GGG Intronic
No off target data available for this crispr