ID: 984847641

View in Genome Browser
Species Human (GRCh38)
Location 4:184121181-184121203
Sequence TAGAATAGGGAAAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 949
Summary {0: 1, 1: 1, 2: 5, 3: 73, 4: 869}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984847641_984847651 24 Left 984847641 4:184121181-184121203 CCCTCCTCCTTTTCCCTATTCTA 0: 1
1: 1
2: 5
3: 73
4: 869
Right 984847651 4:184121228-184121250 CATTTCACAAGGATATGTCTGGG 0: 1
1: 0
2: 4
3: 27
4: 275
984847641_984847652 25 Left 984847641 4:184121181-184121203 CCCTCCTCCTTTTCCCTATTCTA 0: 1
1: 1
2: 5
3: 73
4: 869
Right 984847652 4:184121229-184121251 ATTTCACAAGGATATGTCTGGGG 0: 1
1: 0
2: 0
3: 20
4: 299
984847641_984847649 13 Left 984847641 4:184121181-184121203 CCCTCCTCCTTTTCCCTATTCTA 0: 1
1: 1
2: 5
3: 73
4: 869
Right 984847649 4:184121217-184121239 TTCAAAGGTAGCATTTCACAAGG 0: 1
1: 0
2: 1
3: 10
4: 236
984847641_984847650 23 Left 984847641 4:184121181-184121203 CCCTCCTCCTTTTCCCTATTCTA 0: 1
1: 1
2: 5
3: 73
4: 869
Right 984847650 4:184121227-184121249 GCATTTCACAAGGATATGTCTGG No data
984847641_984847647 -2 Left 984847641 4:184121181-184121203 CCCTCCTCCTTTTCCCTATTCTA 0: 1
1: 1
2: 5
3: 73
4: 869
Right 984847647 4:184121202-184121224 TAGAAGTTGTCCAAATTCAAAGG 0: 1
1: 0
2: 0
3: 15
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984847641 Original CRISPR TAGAATAGGGAAAAGGAGGA GGG (reversed) Intronic
900348406 1:2222950-2222972 TAAAATACAGAAAGGGAGGAAGG - Intergenic
901076198 1:6556165-6556187 TAGAAGAGGGAAAAAGCGGCTGG - Intronic
901248565 1:7754109-7754131 TCGAAGAGGAAAAGGGAGGAAGG - Intronic
902266931 1:15274161-15274183 TGCAATAGGCAAAAGGCGGAAGG - Intronic
902280277 1:15369346-15369368 TAGGGTAGAGAAGAGGAGGATGG - Intronic
902687136 1:18085591-18085613 TAGAATAGGGAAAAAGTGATGGG - Intergenic
902794305 1:18791118-18791140 GAGAAATGGGAAGAGGAGGATGG - Intergenic
903008710 1:20315439-20315461 TACAGGAGGGAAAAGGAGGTGGG + Intronic
903195923 1:21688187-21688209 TAGAATTGGGCAAATGAGGCTGG + Intronic
903753503 1:25645011-25645033 TAGTAAAGGGAAAAGCAGGCTGG - Intronic
903774905 1:25786774-25786796 GACAAAAGTGAAAAGGAGGATGG - Intergenic
903845383 1:26276820-26276842 AAGAATATGGGAAAGCAGGATGG - Intronic
904955885 1:34283511-34283533 TAAAATAAGGAAAATAAGGAAGG - Intergenic
904994321 1:34619123-34619145 GAGGAGAGGGAAAGGGAGGATGG + Intergenic
905317726 1:37094239-37094261 TAGTCTAGGCTAAAGGAGGAGGG + Intergenic
905415710 1:37802531-37802553 TACAAGAGGGAAGGGGAGGAAGG + Intergenic
905551653 1:38846073-38846095 TAAAATAGGTTAAAGGAAGATGG - Exonic
905560967 1:38927058-38927080 GAGAGGAGGGAAAAGGGGGAAGG + Intronic
906165309 1:43681638-43681660 CAGACTAGGGAAAAAAAGGATGG - Intronic
906686161 1:47764745-47764767 CAGAACAGGGAACAGGAGGCAGG + Exonic
906998930 1:50829698-50829720 TGGAATAGGAAAAAAGAGAAGGG - Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907273829 1:53306010-53306032 TAGAATAGAGAAGGGGAGGAGGG - Intronic
907758779 1:57337496-57337518 TTAAATAGGGAAACTGAGGAAGG - Intronic
907787359 1:57625723-57625745 TAGAGGAGGGAAAGGGAGGAGGG + Intronic
908607720 1:65818399-65818421 GACAATAGGAAGAAGGAGGATGG - Intronic
908621525 1:65986582-65986604 CAGAATAAGACAAAGGAGGAGGG - Intronic
908767231 1:67565092-67565114 TGGATGGGGGAAAAGGAGGAAGG - Intergenic
909027850 1:70503846-70503868 TAGAACAGGAAAAAAGATGAAGG - Intergenic
909094619 1:71271545-71271567 TAGGGTAGGGAAATGGGGGAGGG - Intergenic
909260400 1:73481510-73481532 TACAATAGGGAAATGGAACAGGG + Intergenic
909332252 1:74427589-74427611 TAAAATTGAGAAAGGGAGGAAGG - Intronic
909455146 1:75841728-75841750 TAGATTTGGGGAAAGGAAGAAGG + Intronic
909525089 1:76613693-76613715 AAGAAGAGAGAAAAGGAAGAGGG - Intronic
909588192 1:77314658-77314680 TCAAATAGCTAAAAGGAGGATGG - Intronic
911576570 1:99585382-99585404 TAGAATAGGGAAGAGGATTCTGG - Intergenic
911882432 1:103257868-103257890 TAGAATAGGGAAAAGTAATAAGG - Intergenic
912207547 1:107525016-107525038 GAGAAAAGGAAAAAAGAGGAAGG - Intergenic
912499405 1:110112208-110112230 GAGACTAGGGAAAGGGAGGGAGG - Intergenic
913096387 1:115521083-115521105 TAGAATAAGGAAAATGAGTAAGG - Intergenic
913313388 1:117527589-117527611 CAGAATAGGGTAAGGGAAGATGG + Exonic
913441547 1:118903644-118903666 TAGAAGATGGAAAAGGACTAAGG + Intronic
913703045 1:121392294-121392316 AAGAAAAGTAAAAAGGAGGAGGG - Exonic
914885483 1:151581062-151581084 TAGAATGGGGCCAGGGAGGAGGG + Intronic
914956773 1:152169657-152169679 GAGAAGAGGGAAGGGGAGGATGG + Intergenic
915171584 1:153981942-153981964 GAGAAAAGGGAAAAGCAGAAAGG - Exonic
915911204 1:159916753-159916775 TAGAAAAGGGGAAAGGGGCAAGG + Intergenic
916208046 1:162334412-162334434 TAGAAAGGGGAATAGGAAGAGGG + Intronic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916821700 1:168404986-168405008 TAGTTTGGGGAAAAGGAAGAAGG - Intergenic
916862474 1:168820994-168821016 AAGAAAAGGGCAAAGAAGGAAGG + Intergenic
916929053 1:169555536-169555558 TAAAAGGGGGAAAAGGAGGAGGG + Intronic
917031355 1:170695797-170695819 GAGAAAAGAGAAAAGAAGGATGG - Intronic
917369480 1:174275146-174275168 AAGAATGGAGAAGAGGAGGAAGG + Intronic
917691715 1:177476727-177476749 GTAAATGGGGAAAAGGAGGAGGG + Intergenic
918151130 1:181798920-181798942 AGGAAGAGGGAAAAGGAAGATGG + Exonic
918340338 1:183563358-183563380 TGGAGGAGGGAAGAGGAGGATGG - Intronic
918372281 1:183872831-183872853 AAAAATGGGGAAAAGGAGGAGGG + Intronic
918675379 1:187278249-187278271 TATAATATGGAAAAGGACGTAGG - Intergenic
919195920 1:194286269-194286291 AAGAAGAGGGGAAAGAAGGAGGG - Intergenic
919592317 1:199520227-199520249 TTGAATAGGGGAGAGAAGGATGG - Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919658761 1:200222755-200222777 TAGAATGGGAAAAAGGAATATGG - Intergenic
919664617 1:200279986-200280008 TAGAGAAGGGAAAAGAAGGGAGG + Intergenic
919846107 1:201643210-201643232 AAGAAAAGGGAAGAGAAGGAAGG - Intronic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
919954388 1:202398518-202398540 GAGAACAGGTTAAAGGAGGAAGG - Intronic
920017406 1:202924412-202924434 TACCAGAGGGATAAGGAGGAAGG - Intronic
920043690 1:203120262-203120284 AAGACTAGAGAAAAGAAGGAAGG - Intronic
920122449 1:203668881-203668903 TAGATTGGGGAGAAGGAGGTAGG + Intronic
920447328 1:206028609-206028631 TAAAAGATGGAAAAGGAGGGAGG - Intergenic
920813824 1:209312152-209312174 AAGAAAAGGGGAAAGGAAGAAGG - Intergenic
920827997 1:209440013-209440035 TAGACAAGGGAAAAGGAGTTTGG - Intergenic
920910933 1:210215683-210215705 TAGAGTAGGGAGGAGGAGGAGGG + Intergenic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
921132171 1:212229332-212229354 GAAGAAAGGGAAAAGGAGGAAGG - Intergenic
921148423 1:212380639-212380661 TAGTATAGGATAAAGGAGGGAGG - Intronic
921521385 1:216158655-216158677 TAAAAAAGGGCAAAGTAGGAAGG - Intronic
922447257 1:225707911-225707933 TGAAATAGGAAACAGGAGGAAGG + Intergenic
923183884 1:231550674-231550696 TAGAAGAGGAAAAGGAAGGAAGG - Intronic
923643954 1:235796136-235796158 TAGAATACAAAAAAAGAGGAGGG + Intronic
923834138 1:237591148-237591170 GAGAAGGGGGAAGAGGAGGAGGG - Intronic
924115819 1:240745358-240745380 TATAAGAGAGGAAAGGAGGAAGG - Intergenic
924421833 1:243917183-243917205 GAGAAAAGGGAAAAGCAAGACGG - Intergenic
924461475 1:244263398-244263420 AATAAAGGGGAAAAGGAGGAAGG + Intergenic
924586238 1:245363490-245363512 AAGAAAAGAGAAAAGGAGGCCGG - Intronic
924672171 1:246140194-246140216 TAAAACAGGTAAAAGGATGATGG + Intronic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1062818513 10:517182-517204 TGGAGAAGGGAAAAGGAGAAGGG - Intronic
1063157305 10:3391567-3391589 TAGAAGGGAGGAAAGGAGGAAGG + Intergenic
1063192487 10:3709284-3709306 AAGTAAAGGGAAAAGGAGGGTGG - Intergenic
1063606795 10:7529647-7529669 GAGGAGAGGGAAAGGGAGGAGGG + Intergenic
1063858604 10:10283571-10283593 CAGAGGAGGGGAAAGGAGGAGGG - Intergenic
1063911648 10:10836212-10836234 AAGAAAAGGAGAAAGGAGGAGGG + Intergenic
1063953599 10:11246468-11246490 AAGTAGAGGGGAAAGGAGGAGGG - Intronic
1064040789 10:11961498-11961520 CAGAAGAGGGAAGAGGAGGGAGG + Intronic
1064111605 10:12544103-12544125 AAATATGGGGAAAAGGAGGAAGG + Intronic
1064219759 10:13430857-13430879 AAGAGTAGGGAAGAGGAGCATGG - Intergenic
1064346438 10:14536984-14537006 TAGAAAATGGCAGAGGAGGAGGG + Intronic
1064580171 10:16785860-16785882 TAAATTTGGGAAAAGGAGGACGG + Intronic
1064637257 10:17381333-17381355 TATAATAGGAAAAAGGGGGTGGG + Intronic
1064659374 10:17591118-17591140 TAGAATGGAGAAGAGGAGGCTGG - Intronic
1065050373 10:21785800-21785822 AAAAAGATGGAAAAGGAGGAGGG + Intronic
1065372320 10:25000367-25000389 TAGAATAGACAAAATCAGGAAGG - Intronic
1065394035 10:25215085-25215107 TACAATAGCCAAAAGGGGGAAGG + Intronic
1065478158 10:26163564-26163586 AAGAATAGGGAAGAGTAGGCTGG + Intronic
1066121485 10:32292141-32292163 TAGAAAAGGGTAAAGAAAGAGGG - Intronic
1067807867 10:49405758-49405780 GAGGAGAGAGAAAAGGAGGAAGG - Intergenic
1068056380 10:52016869-52016891 GAGAAGAAGGAAAGGGAGGAGGG + Intronic
1068157277 10:53216967-53216989 TTGAAAAGGGACAAAGAGGAAGG - Intergenic
1068212420 10:53937823-53937845 GAGAAGAGGGAAAAAGAAGAGGG - Intronic
1068456934 10:57267763-57267785 TAGAATAGGGACATGGTAGAAGG - Intergenic
1068578402 10:58710313-58710335 TGGAATAGGGAAAAGCACCATGG - Intronic
1069359703 10:67627363-67627385 TAGAGTAGGGACAATGGGGAGGG + Intronic
1069509590 10:69031886-69031908 TTGTAGACGGAAAAGGAGGAAGG - Intergenic
1069515157 10:69071443-69071465 AGGAATTGGGAAAAGGAGCATGG + Intergenic
1070216706 10:74390957-74390979 TGGAATGGGGAAAGGGAAGAAGG - Intronic
1070307908 10:75250812-75250834 TAGACTAGGGAAAAAAAGGAGGG + Intergenic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070644451 10:78191990-78192012 TGGAAGTGGGAGAAGGAGGAAGG + Intergenic
1071794324 10:88989432-88989454 AAGAAGTGGGATAAGGAGGATGG - Intronic
1072377785 10:94835785-94835807 TAGAATTAGGAAAAGGAAAAAGG - Intronic
1072573505 10:96678744-96678766 AGGAAAAGTGAAAAGGAGGAAGG - Intronic
1072618412 10:97064465-97064487 TAGGATAGGGAGATGGAGCAGGG + Intronic
1072801180 10:98393417-98393439 GAGAATGGGGAAAAGGTGGTGGG - Intronic
1073197216 10:101702057-101702079 TACAATATGGAAAAGGGGGATGG + Intergenic
1073370193 10:102981376-102981398 TAATATAGGAAAAAAGAGGAAGG - Intronic
1073480748 10:103784777-103784799 GAGAAGGGGGAAAAGGAGAAGGG + Intronic
1074255198 10:111794995-111795017 AACAGTAGTGAAAAGGAGGAGGG + Intergenic
1076077354 10:127545062-127545084 GAGGAGAGGGAAAAGGAGGGAGG - Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076825590 10:132965766-132965788 GAGAATTGGGAACAGCAGGAAGG - Intergenic
1077528313 11:3082274-3082296 TAAAATACCCAAAAGGAGGAGGG - Intergenic
1077790721 11:5437035-5437057 TGGTATTGGGGAAAGGAGGAGGG + Intronic
1078054770 11:7999269-7999291 AAAAAAAGTGAAAAGGAGGAGGG + Exonic
1078116584 11:8458510-8458532 TAGAATCGAGACAAGAAGGAGGG + Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078145642 11:8720284-8720306 TACTGTAGGGAAAAGAAGGAAGG - Intronic
1078156640 11:8805627-8805649 TAGGCTGGGAAAAAGGAGGAGGG - Intronic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1079319617 11:19441119-19441141 TAGAAGGGGCAAAAGGAGGTGGG + Intronic
1079329266 11:19520596-19520618 TAGAGGATGGGAAAGGAGGAAGG - Intronic
1079710518 11:23678143-23678165 TAGAAAAGGGGTAAGCAGGAAGG + Intergenic
1079724568 11:23865126-23865148 CAGAAGAAGGAAAAGGAGTAGGG - Intergenic
1080073335 11:28115724-28115746 TAGACTGAGGAAGAGGAGGAGGG + Intronic
1080193741 11:29582714-29582736 TAGAAGGGGGAAGGGGAGGATGG + Intergenic
1080785908 11:35474852-35474874 ATGAATAGGGAAAAGGAAGAAGG + Intronic
1080797653 11:35580412-35580434 TAGAATATGGAGAAGGAGATGGG + Intergenic
1080981241 11:37408879-37408901 TAGAAGAGGTGACAGGAGGAAGG - Intergenic
1081067097 11:38557331-38557353 TAGAATACGGGAAGGGAGAACGG + Intergenic
1081153351 11:39659369-39659391 TAGAATAGAGATATGGAGGGTGG + Intergenic
1081238714 11:40678288-40678310 TAGATGGGGGAGAAGGAGGAGGG - Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081993183 11:47348347-47348369 TAGTGTTGGGAAAAGGAGGTAGG + Intronic
1083577170 11:63800635-63800657 AAGAAAAGGAAAAAGAAGGAAGG + Intergenic
1083625662 11:64070839-64070861 TGGAAGAGGGGAGAGGAGGAAGG + Intronic
1085147378 11:74213255-74213277 AAGGATAGGGAAGAGTAGGAAGG + Intronic
1085537664 11:77233464-77233486 AAGAATGGGGAAAAGGAAAAAGG + Intronic
1085807083 11:79646253-79646275 TACAGTAGGGGAAAGGAGGATGG - Intergenic
1086038127 11:82441604-82441626 TTGGATAGGGTAGAGGAGGAGGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086364809 11:86098137-86098159 CAGATTAGGAAAAAAGAGGAAGG + Intergenic
1087062422 11:93993252-93993274 GCGAACAGGGAAAAGGAGGGAGG - Intergenic
1087446759 11:98265413-98265435 TAGACTAAGGAAAAAGAGAAAGG + Intergenic
1087449902 11:98307547-98307569 TAAAAAAGGAAAAAGAAGGAAGG + Intergenic
1087594749 11:100238505-100238527 GAGAAGGGGGAAGAGGAGGAGGG + Intronic
1087721524 11:101671274-101671296 TGGAAGTGGAAAAAGGAGGAAGG + Intronic
1087938560 11:104064623-104064645 AAGAGAAGTGAAAAGGAGGAAGG + Intronic
1087953946 11:104260157-104260179 TAGAAAAGTCACAAGGAGGAAGG + Intergenic
1088620891 11:111682330-111682352 TGGCATAGGAAAAAGGGGGAGGG + Intronic
1089784717 11:120899742-120899764 TAGATTAGTTAAAAGGGGGAGGG - Intronic
1089905241 11:122031492-122031514 GAGAAAGGGGAAAAGGAGAAGGG + Intergenic
1089915976 11:122156753-122156775 AAGAATAAGGAAAGGAAGGAAGG + Intergenic
1090213461 11:124939536-124939558 TAGAATGGGAGGAAGGAGGAAGG + Intergenic
1090366504 11:126211306-126211328 GAGAATGGGGAGAAGGCGGAGGG - Intronic
1090519442 11:127462478-127462500 TAGGATAGAGAAGAGGTGGAAGG - Intergenic
1090807279 11:130210396-130210418 TCGAGTAGGAAAAAGGAGGAAGG - Intergenic
1090840559 11:130484212-130484234 AAGAAAAACGAAAAGGAGGAAGG + Intergenic
1090991672 11:131822749-131822771 TAGGATAGGGCAAATGAGAAAGG + Intronic
1091079880 11:132656466-132656488 TTAAAAAGGGAGAAGGAGGAAGG - Intronic
1091129863 11:133136636-133136658 GAGAATAGGGAAAAGGAGAAAGG + Intronic
1091414882 12:273237-273259 TAGAATAGGGCAATGGTGGCAGG + Intergenic
1091472070 12:737584-737606 TAGATGAGGGAAAAGGCAGAGGG + Intergenic
1092125783 12:6074137-6074159 TTTCATGGGGAAAAGGAGGAGGG - Intronic
1092439884 12:8491215-8491237 TGAAATAGGGAAAATGAGGGTGG - Intergenic
1092461683 12:8692716-8692738 TGGAGCAGGGAAAAGGAGGAGGG + Intronic
1092697471 12:11189648-11189670 TGGACTAGGTAAAAGGAGCAGGG - Intergenic
1092803914 12:12201187-12201209 TAGAATAGAGTAAAACAGGAGGG - Intronic
1093349357 12:18079021-18079043 TTGAAAAGGGTAAATGAGGAAGG - Intergenic
1093349711 12:18083136-18083158 TTGAAAAGGGTAAATGAGGAAGG + Intronic
1095380327 12:41583098-41583120 GAGAATGGGGAACAAGAGGAAGG + Intergenic
1095710969 12:45287623-45287645 GAGAATAAGGAAAAGGAGTCAGG + Intronic
1095812205 12:46383338-46383360 GGGAAGAGAGAAAAGGAGGAGGG + Intergenic
1096758748 12:53822222-53822244 AAGAAGAGGGAGGAGGAGGAGGG - Intergenic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1096926019 12:55147470-55147492 AGAAAGAGGGAAAAGGAGGAGGG + Intergenic
1097008804 12:55938110-55938132 AGGAATAAGGGAAAGGAGGATGG - Intronic
1097015071 12:55980265-55980287 GAGAAAAGGGAAAAGCAGAAAGG - Intronic
1097287129 12:57886993-57887015 GAGAACAGGGAAGAGAAGGAGGG + Intergenic
1097625430 12:61994373-61994395 TTGAAAAGGCAACAGGAGGAAGG - Intronic
1097845857 12:64364670-64364692 TAGTAAAGGGAAAAGGTGCATGG - Intronic
1098067331 12:66632485-66632507 AAGCATGGGAAAAAGGAGGATGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098914656 12:76244696-76244718 AAAAATAGGGAAAAGGAAAAAGG + Intergenic
1099310720 12:81018291-81018313 TAGAATATGGAAAAGGTGATGGG + Intronic
1099617220 12:84951339-84951361 TAGAAGAGAGGAAGGGAGGAAGG - Intergenic
1100673572 12:96842745-96842767 GAGAAGAGGAAAAAGGAGGAAGG - Intronic
1101128733 12:101666477-101666499 AAGAATAGAGAAGAGGAGAAAGG - Intronic
1101843070 12:108341832-108341854 AGGAAGAGGGAAAGGGAGGAGGG + Intergenic
1101868306 12:108540669-108540691 TTGAAGAGGAAAAAGGTGGATGG + Intronic
1102339779 12:112112507-112112529 TAGGACAGGGAAAAGGAGGGAGG + Intergenic
1102485348 12:113251700-113251722 AGGAATAGGGAAAAGGGAGAGGG + Intronic
1103066209 12:117899713-117899735 TAGAATATGGCAAAGGAGATGGG + Intronic
1103132700 12:118482781-118482803 TAGAAGAGGGGAAATGAGAAGGG + Intergenic
1103168502 12:118791878-118791900 GAAATTAGTGAAAAGGAGGATGG - Intergenic
1104091474 12:125521320-125521342 TGGAATAAGGAAAAGGAGAAGGG - Intronic
1104135030 12:125929502-125929524 TAGACTGGGGAAGAAGAGGAGGG - Intergenic
1105941216 13:25149662-25149684 TAGAAGAAAGAAAGGGAGGAAGG + Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106135034 13:26967551-26967573 TGGGATAGGGGGAAGGAGGAGGG + Intergenic
1106666863 13:31860433-31860455 CAGAAGAAAGAAAAGGAGGATGG - Intergenic
1106728597 13:32514491-32514513 TAGAATAGGGCATAGCAGCAGGG + Intronic
1107345160 13:39452423-39452445 TAGAGAAGAGAAAGGGAGGAGGG + Intronic
1107376466 13:39809984-39810006 TCGAAGAGGAAGAAGGAGGAGGG - Intergenic
1107872431 13:44759689-44759711 TGGAAGAGGGATAGGGAGGAAGG + Intergenic
1108068942 13:46607624-46607646 AAGAAGAAGGAAGAGGAGGAAGG - Intronic
1108243468 13:48491785-48491807 TAGAATAAAGTAAAGGAGCATGG - Intronic
1108394068 13:49976303-49976325 TTTAACAGGGAAATGGAGGAGGG - Intergenic
1108662422 13:52599284-52599306 AAAAAAAGGAAAAAGGAGGAAGG + Intergenic
1108883350 13:55148390-55148412 TAGAAAAGGTAAAAAGAGGGAGG + Intergenic
1109555176 13:63964681-63964703 AAACAAAGGGAAAAGGAGGAGGG + Intergenic
1109665140 13:65524796-65524818 TGGAAGAGGGAGAAGGAAGAGGG - Intergenic
1110025387 13:70531541-70531563 TAGAGAAGGGAAAAGGAAGATGG - Intergenic
1110161552 13:72384518-72384540 GGGAATAGGGAACAGGAGCAAGG - Intergenic
1110931635 13:81225689-81225711 TAGAATAGGAAAAAGGGAAATGG + Intergenic
1111454346 13:88460511-88460533 TAGCATAAGGAAAAGAAAGATGG + Intergenic
1111827955 13:93292723-93292745 TACTATAGGGAAAAGAATGATGG - Intronic
1111975205 13:94959758-94959780 GGTAATGGGGAAAAGGAGGACGG - Intergenic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1114501014 14:23168676-23168698 TGCAAGAGGGAAAATGAGGATGG + Intronic
1114532135 14:23402863-23402885 TAGAGTTGGGAAAGGGAGGGAGG + Intronic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115460511 14:33654921-33654943 TAAAATGGGAGAAAGGAGGAAGG + Intronic
1115655451 14:35439290-35439312 TTGAATGAGGAAAGGGAGGAGGG - Intergenic
1115959939 14:38824363-38824385 TAGAAGGGAGAAAGGGAGGAGGG - Intergenic
1116035203 14:39619139-39619161 TATAATAGGAAAAAGGTGGGGGG - Intergenic
1116909084 14:50438782-50438804 TAGATTGGGGAAATGGAGAAAGG - Intronic
1117773088 14:59154331-59154353 TGGAGTAGGGAAAATGAGAATGG - Intergenic
1117919132 14:60709414-60709436 TGGAAAAGGGAAGAAGAGGAAGG - Intergenic
1117927983 14:60805057-60805079 TTGAACATGGCAAAGGAGGAAGG - Intronic
1118115690 14:62774105-62774127 TAGCAAAGGGAAAAGGGGCATGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1119938719 14:78617583-78617605 TAGAATAGGGCAAATGAACAAGG - Intronic
1120149905 14:81021467-81021489 TGTAATAGGGAAAGGGAGAAAGG + Intronic
1120254613 14:82103289-82103311 TTGAATAGGGCAAAGAAGGATGG + Intergenic
1120868862 14:89319312-89319334 TAGCAGAGGGAAAAGGTGCATGG + Intronic
1120906140 14:89622855-89622877 TAGAAAGGGGAAAGGGAAGAAGG - Intergenic
1121179499 14:91918079-91918101 TAGAATAAGGTAAAGGTGGGAGG + Intronic
1122188851 14:100023756-100023778 TAAAAAAGGCAAAAGGAGGCTGG - Intronic
1122766583 14:104075997-104076019 AAGAATTTGGAAAAGGTGGAAGG + Intergenic
1124168102 15:27347399-27347421 TGGGAAAGGGAAAAGGAGTAAGG - Intronic
1124384221 15:29193110-29193132 TAAAACAGGGAAAAGAAGTAAGG + Intronic
1124893677 15:33756670-33756692 TGGGAAAGGGAAAAGGAGAAGGG + Intronic
1125418448 15:39477731-39477753 GAGAATAGGGAAGAAAAGGAAGG - Intergenic
1125440423 15:39696836-39696858 AAGAAGAGAGGAAAGGAGGAGGG + Intronic
1125610218 15:40964441-40964463 TAGAATGAGGGAATGGAGGAGGG - Intergenic
1125708934 15:41767757-41767779 AAGAATAGGGAGAGAGAGGATGG + Exonic
1125816376 15:42588515-42588537 TAGGATAGGAAAGAGAAGGAAGG + Intronic
1125858832 15:42978367-42978389 CAGAGTAGGTAAAATGAGGATGG + Intronic
1126371004 15:47947070-47947092 AAAAATAAGGAAAAGGAGAAAGG + Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127175806 15:56355111-56355133 TAGAACTGGGAATGGGAGGAAGG - Intronic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127534981 15:59881735-59881757 CAGAATCGGGCAAAGGAGAAAGG - Intergenic
1128030517 15:64475948-64475970 TAAACTAGGGAAAAGGCAGACGG + Intronic
1128243686 15:66118645-66118667 TGGAAATGGGAAAGGGAGGAAGG - Intronic
1128985800 15:72220345-72220367 TGGAACAGGGTAAAGGAGTAAGG - Intronic
1129255065 15:74329796-74329818 TAGAAGATGGGGAAGGAGGAGGG + Intronic
1129445546 15:75615342-75615364 TAGAGTTGGGAGAAGGAGTATGG - Intronic
1129698466 15:77754129-77754151 GGGAAAAGGGAAAAGGAGGAAGG + Intronic
1129773537 15:78218139-78218161 TAAAATGGGGAAAGGGTGGATGG + Intronic
1129863288 15:78880999-78881021 TAGAAAAGGGGAAAGGATAAAGG + Intronic
1130544882 15:84848535-84848557 AAGAATAGGGAAACACAGGAAGG + Intronic
1130551449 15:84892215-84892237 TAAAAAAAGAAAAAGGAGGATGG + Intronic
1130735028 15:86538903-86538925 TAGAATGGGACCAAGGAGGAAGG + Intronic
1130866892 15:87940757-87940779 TAGGATGGGGACAAAGAGGAGGG + Intronic
1131014207 15:89043710-89043732 AAGAGGAGGGAGAAGGAGGAGGG + Intergenic
1131111171 15:89766216-89766238 GAGAATGTGGAAAAGGGGGAAGG - Intronic
1131653507 15:94428979-94429001 TAGAAGAGTGAAAAGGAGAGTGG - Intronic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1131963730 15:97815560-97815582 GAGAGTAGGGAAAGGAAGGATGG + Intergenic
1132612726 16:825293-825315 TCGGAGAGGGACAAGGAGGAAGG - Intergenic
1133093343 16:3422889-3422911 TTGAATGAGGAAAAGCAGGATGG - Intronic
1133431508 16:5740976-5740998 TAAAATAGGTTAAAGGAGGCAGG + Intergenic
1133520194 16:6549297-6549319 GGGAGGAGGGAAAAGGAGGAGGG + Intronic
1133640514 16:7712545-7712567 TTGAAAAGAGAAAAGGGGGAGGG + Intronic
1134377864 16:13695169-13695191 CAGACTAAGGAAAAAGAGGAGGG + Intergenic
1134465957 16:14477788-14477810 GGGAAAAGGGAAAAGGGGGAAGG + Intronic
1135516292 16:23138449-23138471 CAGACTAGGGACATGGAGGATGG - Intronic
1136633926 16:31507483-31507505 GAGAATAGGGATAAAGGGGAGGG + Intronic
1136698700 16:32111958-32111980 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1136768904 16:32815871-32815893 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1136928572 16:34397395-34397417 GAGAGTAGGGAAGAGGAGCATGG + Intergenic
1136976002 16:35014409-35014431 GAGAGTAGGGAAGAGGAGCATGG - Intergenic
1136998762 16:35209514-35209536 TAGAAAAGAGAAAAAAAGGAAGG - Intergenic
1137012710 16:35338926-35338948 TAGAAGAGGGAAAAACAAGAAGG - Intergenic
1137455605 16:48615558-48615580 TAAAAAAGGAAACAGGAGGAAGG - Intronic
1137949758 16:52772467-52772489 TTGGGTAGGGAAAAGCAGGAAGG + Intergenic
1138058423 16:53861312-53861334 TACAGTAGGGTAAAGGAGGTTGG - Intronic
1138893819 16:61178590-61178612 TATAATATGGCAAAGGTGGAGGG - Intergenic
1139072893 16:63404371-63404393 TAGAATAAAGACTAGGAGGAGGG - Intergenic
1139101897 16:63777638-63777660 TGGAATTGGGGAAAGGGGGACGG + Intergenic
1139317620 16:66087076-66087098 GAGAATAGAGAAAAGAAGGGTGG + Intergenic
1139368901 16:66452699-66452721 GAGTGTAGAGAAAAGGAGGATGG + Intronic
1139447395 16:67006366-67006388 GTGAATAGGGAAACTGAGGAGGG - Intronic
1139484926 16:67249996-67250018 CACAACAGGGAGAAGGAGGAGGG - Intronic
1139580515 16:67870947-67870969 TAGTATTGGGAAGAGGAGGGAGG - Exonic
1139802589 16:69535620-69535642 TAGGATAGAGGGAAGGAGGAGGG + Intergenic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140357047 16:74315377-74315399 TAGAATAGGGAGGAGGGGGAAGG - Intergenic
1140376116 16:74446665-74446687 TAGAGGAGGAAGAAGGAGGAGGG - Intergenic
1140571237 16:76108536-76108558 TAGAATATGGAAAAGATGAAAGG + Intergenic
1140779598 16:78282578-78282600 TAGAACAGGGAAAATGTGGCCGG + Intronic
1140974556 16:80046413-80046435 TAGAATAGGGTAATGGACAAAGG + Intergenic
1141114431 16:81296299-81296321 AAGACTAGGGAAAAGGAAGAAGG - Intergenic
1141231929 16:82175855-82175877 TGGAGAAGGGAAATGGAGGAAGG + Intergenic
1141489884 16:84365594-84365616 TATAATAGGGAAATGTAGGCCGG - Intergenic
1141505997 16:84479157-84479179 TAAAATGGGGAAATGGAGGCAGG - Exonic
1141724045 16:85774551-85774573 AAGAATGGGGAAGGGGAGGATGG + Intronic
1141802712 16:86322131-86322153 AAGAAAAGGGAAAAGAAGGAAGG - Intergenic
1142358077 16:89613522-89613544 AAGAGGAGGGAAATGGAGGAGGG - Intronic
1203071321 16_KI270728v1_random:1077982-1078004 AAGAAAAGTAAAAAGGAGGAGGG + Intergenic
1203113788 16_KI270728v1_random:1469540-1469562 AAGGAAAGGGAAAAGGAGAAGGG - Intergenic
1142487845 17:258453-258475 TAAAAGAGGGATAAAGAGGAAGG + Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142980303 17:3667771-3667793 TAGACTAGGCAGAGGGAGGAAGG - Intronic
1143303414 17:5927716-5927738 TAGATTGGGGAAAGGAAGGAAGG + Intronic
1143512988 17:7405979-7406001 AGGGATAGGGAGAAGGAGGAGGG + Intronic
1143791748 17:9301962-9301984 CAGAATACAGAAAAGAAGGAAGG - Intronic
1144161136 17:12559340-12559362 TAGAAGAAGGAAAGAGAGGAAGG - Intergenic
1144413923 17:15027908-15027930 TAGAAGAGAGAAAAGGCTGAAGG + Intergenic
1144996088 17:19270006-19270028 AAGAATAGGGATTAAGAGGATGG + Intronic
1145692853 17:26762208-26762230 AAGAAAAGTAAAAAGGAGGAGGG - Intergenic
1145827824 17:27890620-27890642 TAGATTAGGGAAAAGGACAGTGG - Intronic
1146040580 17:29450027-29450049 AAGAAAAGGGAAAGGAAGGAAGG - Intronic
1146370768 17:32264646-32264668 TAGAGTAGGGATGGGGAGGAGGG + Intergenic
1146496630 17:33328466-33328488 TAGAAGAGGGAAGAGGAGAATGG - Intronic
1146765082 17:35512969-35512991 TAGAGGAGGGAAAGGGAGCAAGG - Intronic
1146910742 17:36646859-36646881 AAGAATAGGAGAAAGGAGGCAGG + Intergenic
1147349352 17:39827953-39827975 TGGATTAGGGAAGAGGAGGTGGG + Intronic
1147490941 17:40865488-40865510 TTGAGCATGGAAAAGGAGGAAGG + Intronic
1147861603 17:43527314-43527336 GAGAATGGGGCAAAGGAGAAAGG - Intronic
1148118443 17:45192425-45192447 AAGAAAAAAGAAAAGGAGGAAGG - Intergenic
1148346748 17:46908415-46908437 GAAAATAGGGTAAGGGAGGAAGG + Intergenic
1148390689 17:47270223-47270245 TAGAAGAGGGAAGAGGACCATGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148712344 17:49690933-49690955 TACAATAGAGAAAAAGAGGCCGG - Intergenic
1149107109 17:52982657-52982679 AAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1149785795 17:59433889-59433911 GAGGAGAGGGGAAAGGAGGAGGG - Intergenic
1150146482 17:62773764-62773786 AAGATTAGGGAGAAGGAAGACGG + Intronic
1150193498 17:63269013-63269035 TAGAGTAGGGAATAGGACAAGGG - Intronic
1150244583 17:63664821-63664843 CAGAAGTGGGAAAAAGAGGAAGG - Intronic
1150467100 17:65403117-65403139 CAGCCTAGGGAAAAGCAGGAAGG - Intergenic
1150532645 17:66000700-66000722 TAGTATTGGGAAGAGGAGGGAGG + Intronic
1150677836 17:67259937-67259959 AAGAAAAGAAAAAAGGAGGAGGG + Intergenic
1150789657 17:68193118-68193140 AAGGGTAGGGAAAAGGAGGATGG - Intergenic
1150822305 17:68445479-68445501 TGGCAAAGGGAAAAGGAGAAGGG + Intronic
1150827098 17:68486615-68486637 TAGGAGAAGGAGAAGGAGGAAGG - Intergenic
1151365721 17:73614788-73614810 TTGAAAAGGGGAAAGGAGGGAGG + Intronic
1152328044 17:79653669-79653691 AAGAATAGGCAGAAGTAGGAAGG + Intergenic
1152515414 17:80820704-80820726 CAGACTGGGGAGAAGGAGGAGGG + Intronic
1153755318 18:8276752-8276774 AAGCATAGGGAAGATGAGGATGG - Intronic
1153939454 18:9965591-9965613 TAGAACAGGTAAAAGGAACATGG + Intergenic
1154050395 18:10950715-10950737 CAGAAGAGGGAAGAGGAGGAAGG - Intronic
1154304415 18:13219421-13219443 TAGAAAAGAGAAAAAGAGAAGGG - Intronic
1155766138 18:29635397-29635419 AAGAGCAGGGAAAAGGAGCAGGG - Intergenic
1155839726 18:30630338-30630360 TACAATAGAGATACGGAGGAGGG - Intergenic
1155923438 18:31628924-31628946 TTGAAGATGGAAAAGGAGGCAGG - Intronic
1156074250 18:33254139-33254161 TAGCACAGAGAATAGGAGGACGG + Intronic
1156724485 18:40111696-40111718 AAAGATAGGAAAAAGGAGGAGGG - Intergenic
1157134033 18:45036698-45036720 TGGAATGGAGAATAGGAGGAAGG + Intronic
1157469486 18:47977902-47977924 TAAAATATGGAAAAGCAGGCCGG - Intergenic
1159052162 18:63430924-63430946 TAGAATATGGCAAAGGTGAAAGG - Intergenic
1159290182 18:66407507-66407529 TAAAACAGGTAAAAGGATGATGG - Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160278804 18:77466887-77466909 CAGAAGAAGGAAGAGGAGGAGGG - Intergenic
1160694823 19:478377-478399 TAAAATGGGGAAACGGAGGCAGG - Intergenic
1161540021 19:4844899-4844921 TAGAAAAGAGAAAGGGAGGGAGG + Intronic
1161558869 19:4959663-4959685 AAGAAAGGGGAAAAGGAGGAAGG - Intronic
1161840850 19:6679454-6679476 TACCATCCGGAAAAGGAGGATGG - Exonic
1162612369 19:11766770-11766792 TCCAAGAGGAAAAAGGAGGAAGG + Intergenic
1163024660 19:14503577-14503599 AGGAAGAGGGAAAGGGAGGAAGG - Intergenic
1163211697 19:15845594-15845616 AAGAAGAGGGAGAAGGAAGAAGG + Intergenic
1163222214 19:15929768-15929790 TTGAATAGGTAAACTGAGGAAGG + Intronic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1163827864 19:19533606-19533628 GAGAATGGGGAGGAGGAGGATGG - Intronic
1164146724 19:22517262-22517284 AAGAAAAGAGAAAAGGAAGACGG + Intronic
1164234935 19:23323582-23323604 GAAAAGAAGGAAAAGGAGGATGG - Intronic
1164250190 19:23469049-23469071 GAGAAGAAGGAAAAAGAGGATGG - Intergenic
1164292383 19:23879995-23880017 GAGAAGAAGGGAAAGGAGGAGGG + Intergenic
1164494210 19:28744568-28744590 TAAAATGGGGAAAAAAAGGAGGG - Intergenic
1164775473 19:30850222-30850244 TATAAAAAGGAAAAGAAGGAGGG + Intergenic
1165055232 19:33172088-33172110 GATTATAGGGAAGAGGAGGAGGG - Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165390774 19:35537458-35537480 AAGCAAAGGGAAAAGGAGGGAGG + Intronic
1165467846 19:35985724-35985746 TAGAAAAGGGCAATGGAGGAAGG - Intergenic
1165806874 19:38585827-38585849 GAGATTAGGGAAATGGGGGATGG + Intronic
1165991152 19:39814973-39814995 CAGAATAGAGTCAAGGAGGAAGG + Intergenic
1166398882 19:42463162-42463184 GATAATAGGGAAGAGGAGGCAGG + Intergenic
1166497789 19:43316747-43316769 TCCAAAAGGGAAACGGAGGAAGG - Intergenic
1166642425 19:44505191-44505213 TAGCAAAGGGAAAAGGTGCATGG - Intronic
1166642582 19:44506516-44506538 TAGAATATGGCAAAGGTGGCAGG + Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167867091 19:52337178-52337200 CAGAGTAGGGGAGAGGAGGAGGG + Intronic
1168299024 19:55392885-55392907 TGCATTAGGGAAAAGGAGCAAGG - Intronic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925402563 2:3586022-3586044 GAGGAGAGGAAAAAGGAGGAGGG + Intergenic
925853346 2:8105650-8105672 AAAGAGAGGGAAAAGGAGGAAGG - Intergenic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
927073110 2:19550076-19550098 TAGAGGAGGGACAAGGTGGAAGG - Intergenic
927230240 2:20815986-20816008 TTAAAAAGGGAAAAGGAGAAAGG + Intronic
928081302 2:28314963-28314985 AAGAAAAGAGAAAAGAAGGAAGG + Intronic
928405257 2:31009883-31009905 TAGAGATGGGAAAAGGAGGGTGG - Intronic
928498103 2:31855881-31855903 TGCAAGAGAGAAAAGGAGGATGG + Intergenic
929766454 2:44847928-44847950 AAGAAGGGGGAAAAGGAGAAGGG - Intergenic
929815745 2:45229967-45229989 AGGAATAGGGAAAGGAAGGAGGG - Intergenic
929891786 2:45924368-45924390 TTGAATAGGAAAATGAAGGATGG + Intronic
930250969 2:49033689-49033711 TAGTATAGGGAACAGGGGGGAGG - Intronic
930849590 2:55944585-55944607 TAGAAGAGGAAAAAGTAGAATGG - Intergenic
931102421 2:59017387-59017409 CAGAAAAGGGGAAAGGAGGGAGG + Intergenic
931735560 2:65190230-65190252 TAGATTAAAGAAAATGAGGACGG - Intergenic
931760694 2:65414261-65414283 CCAAATAGGGGAAAGGAGGAAGG + Intronic
932330094 2:70893921-70893943 AAGAAGAGGGAGATGGAGGAAGG + Intergenic
932552975 2:72790941-72790963 CAGAATGGGGAAGGGGAGGATGG + Intronic
932566744 2:72915784-72915806 GAGGGTGGGGAAAAGGAGGAGGG + Intergenic
933275881 2:80283881-80283903 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
933436633 2:82257647-82257669 GAGAATAAGGAAAAGCAGGGTGG - Intergenic
933712236 2:85334970-85334992 TAGTATAGGGAAAGTGAGAATGG + Intergenic
933877244 2:86631601-86631623 TAGAAAAGGGAAGAGGAGCTTGG - Intronic
934654250 2:96108991-96109013 CAGGATAGGGGAAGGGAGGAAGG + Intergenic
934714842 2:96537469-96537491 GAGAAAAGGGAAGAGAAGGAAGG - Intronic
935057191 2:99577839-99577861 TAGAATTGGGTGAAGGATGATGG + Intronic
935102979 2:100014515-100014537 GAGAATGGGGAAAAGGAAGAAGG + Intronic
935295783 2:101648116-101648138 TAGAATTAGGAAAATAAGGATGG - Intergenic
935403400 2:102683696-102683718 GATAATAGGGAAGAGGAGGAAGG - Intronic
935874761 2:107494606-107494628 GAGAAGAGGGAAAGGGAGGAAGG + Intergenic
936349617 2:111702869-111702891 TAGAAGAGAGATCAGGAGGAGGG - Intergenic
937161195 2:119763126-119763148 ATGAATGGGGAAAAAGAGGAGGG + Intronic
937230198 2:120393995-120394017 TAAAAAATGGAAAAGAAGGAGGG - Intergenic
937821011 2:126310921-126310943 TAGAAAGGGGAATAGGAGTATGG + Intergenic
937871987 2:126792575-126792597 TAGAGCAAGGGAAAGGAGGAAGG - Intergenic
938045981 2:128120905-128120927 TAGAAAAGGGAAAAGGACTTGGG + Intronic
938824213 2:134989132-134989154 TAGAGGAGGGCAAAGGAGAAAGG - Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939191731 2:138924536-138924558 GAGAAGAGAGAAAAGGTGGAAGG - Intergenic
939463019 2:142521781-142521803 TAGAATGCAGAAAAGGATGATGG + Intergenic
939828881 2:147048892-147048914 GAGAAACGGGAAAAGGAGAAAGG + Intergenic
939934102 2:148268242-148268264 TACAAAAGGAAAAAGAAGGAAGG - Intronic
940499672 2:154478219-154478241 TCTAATAGGGAAAAGCAGAAGGG + Intergenic
941535774 2:166721134-166721156 TGGTGTAGGAAAAAGGAGGAGGG - Intergenic
941594066 2:167453783-167453805 TCAAATATGTAAAAGGAGGAAGG + Intergenic
941747666 2:169104083-169104105 TAGCACAGCGAAAAGGAGGCTGG + Intergenic
941773289 2:169364864-169364886 CAGAAGAGGGGAAAGGAGGGAGG + Intergenic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943183936 2:184580798-184580820 CAGAATAAAGAACAGGAGGAAGG - Intergenic
943189487 2:184657824-184657846 TAGAAAGGGGAAGAGGAGAAAGG + Intronic
943340677 2:186676976-186676998 AAGAAAAGGGAAAGGGAAGAAGG + Intronic
944054262 2:195506856-195506878 TATCTTAGGAAAAAGGAGGAGGG - Intergenic
944252914 2:197595499-197595521 TAGATGAGGGAAAAGGAGTTTGG + Intronic
944389088 2:199198522-199198544 TAGAATAGTCAACAGGAGCAGGG - Intergenic
944400555 2:199320784-199320806 TTGAATGGGGAATAGGAAGAGGG - Intronic
944458934 2:199924109-199924131 TACAAAAGGGCAAAGGAGGCTGG + Intronic
944864113 2:203844288-203844310 GAGATGAGGGAAAAGGAAGAGGG + Intergenic
945136989 2:206639975-206639997 TAAAGCAGGGAAAAGGATGATGG - Intergenic
945358915 2:208871856-208871878 GATAAAAGGGAAAAGGAAGACGG + Intergenic
946478784 2:220033925-220033947 TAAAAGAGGGAAACAGAGGAAGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946866825 2:224048494-224048516 AAGAATGAGGAAAAGGAAGAGGG + Intergenic
946915081 2:224510815-224510837 TACAGAATGGAAAAGGAGGAAGG - Intronic
947091052 2:226511891-226511913 AAGAATAGAGAAAAGGAGTGAGG - Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
948034662 2:234848209-234848231 CAGGTTGGGGAAAAGGAGGAGGG + Intergenic
948580197 2:238981894-238981916 TAGGATTAGGAAAAGGAGAAAGG - Intergenic
1168776541 20:452811-452833 TAGTCTGAGGAAAAGGAGGAAGG + Intronic
1168810466 20:701435-701457 TAGAAGAGGGGATAGAAGGAAGG + Intergenic
1168863295 20:1061884-1061906 TAGAATGGGGAAAGGGAAGGAGG - Intergenic
1169404295 20:5310591-5310613 TAGGATAGGGAGAAAGAGTAAGG - Intronic
1169453970 20:5736039-5736061 AAGAAAAGGGAAGAGAAGGAAGG + Intergenic
1170000945 20:11612664-11612686 TAAAAGAGGGAAAAGAAGGAAGG - Intergenic
1170154006 20:13253150-13253172 TGGCACAGGGAAAAGCAGGAAGG + Intronic
1170181284 20:13533014-13533036 TAGACTAGGAAAAAGGGGAAGGG - Intronic
1171029365 20:21663419-21663441 TAGGGTAGGGAGAACGAGGAGGG + Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171106874 20:22442036-22442058 AAGAAATGGTAAAAGGAGGAAGG + Intergenic
1171116812 20:22531831-22531853 GAGGAGAGAGAAAAGGAGGAAGG + Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172683483 20:36735640-36735662 TTGAACAGGGGAAGGGAGGAGGG + Intronic
1173055051 20:39603942-39603964 CAGAATAGTGAAAAGGTGGATGG - Intergenic
1173352560 20:42258380-42258402 AAGAAAAGTGAAAAGGATGAGGG - Intronic
1173395963 20:42679969-42679991 TAGAACAAGGAAGAGGAGAAAGG + Intronic
1173948530 20:46971400-46971422 TAGGAATGGGAAAAAGAGGAAGG + Intronic
1174641644 20:52049694-52049716 AAAAGGAGGGAAAAGGAGGAGGG - Intergenic
1176669859 21:9723007-9723029 TATCATCGGAAAAAGGAGGAAGG - Intergenic
1176952894 21:15065865-15065887 AAGACAAGGGAAAAGGAGCAGGG + Intergenic
1176964033 21:15192125-15192147 TAGTAAAGGGAAAAGGAATAAGG + Intergenic
1177011222 21:15731774-15731796 TAGAATAGGGAGGATTAGGAAGG - Intronic
1177254251 21:18638914-18638936 GAGAAGAGAGAAAAGGAGAAGGG + Intergenic
1177343323 21:19834596-19834618 TGGAAAAGGGAAGAAGAGGAGGG - Intergenic
1177657622 21:24039660-24039682 TAGAAATAGGAAAAGGAGAATGG - Intergenic
1177685039 21:24424918-24424940 AAGAAAGGTGAAAAGGAGGAAGG - Intergenic
1178006370 21:28225223-28225245 AAGAAAAGGGAAAGGGAGGAAGG + Intergenic
1178042514 21:28655204-28655226 TAGAATAGACAAATAGAGGAGGG - Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178663582 21:34527007-34527029 TAGCATAGGGAAAATGACTAAGG - Intronic
1179322083 21:40301799-40301821 TAGACTAGGGAAACGGAGCATGG + Intronic
1179364714 21:40747315-40747337 TAGACTAAGGAAAAAGAGAAAGG + Intronic
1179462423 21:41546357-41546379 TAGAAGAAAGGAAAGGAGGAAGG + Intergenic
1180257450 21:46641905-46641927 TGGCATAGGGAAAAGCACGAAGG + Intronic
1181795006 22:25301526-25301548 TACAGTGGGGAAAAGGTGGACGG + Intergenic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1181835579 22:25605191-25605213 TACAGTGGGGAAAAGGTGGACGG + Intronic
1182006543 22:26964860-26964882 TAGATTAGGGGATAGAAGGATGG - Intergenic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949486998 3:4549529-4549551 AAGAAAAGGGGAAAGGAGGAAGG - Intronic
950181879 3:10919092-10919114 TAGAACAGGGAAAGGGAGGGAGG - Intronic
950315156 3:11995562-11995584 TAAAAAAAAGAAAAGGAGGAAGG - Intergenic
950525852 3:13522812-13522834 TACAATGGGGAAAAAGAAGAGGG - Intergenic
951296490 3:20942440-20942462 TGGAATATAGAAAAGGGGGAGGG + Intergenic
951397024 3:22181398-22181420 TAGAATATGGTAAAGGTGGCCGG + Intronic
951554432 3:23906537-23906559 TAGACTGAGGAGAAGGAGGAGGG - Intronic
951673164 3:25207577-25207599 TAGTATAGAAAAAATGAGGAGGG - Intronic
951915989 3:27801311-27801333 TAGAATAGTGAAGATGATGATGG + Intergenic
952794626 3:37227851-37227873 GAAAATAGGGAACAGGGGGAAGG + Intergenic
952846242 3:37690233-37690255 TAGAAGAGAGCAAAGGAGGAGGG + Intronic
953185994 3:40638938-40638960 TAGAATAGGGTAAAGGATTTGGG - Intergenic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953441153 3:42918636-42918658 TAGAATAAGGATAAGGATAAGGG + Intronic
955377371 3:58409306-58409328 TAAAAGAGGGAAAGGCAGGAAGG + Intronic
955979653 3:64512090-64512112 TAAAATAGGGAAAAGGAATTGGG - Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956955581 3:74335361-74335383 TAGAATAGGTACAAAAAGGAGGG + Intronic
957328501 3:78728208-78728230 GAGGAGAAGGAAAAGGAGGAAGG + Intronic
957377309 3:79375269-79375291 CAGAGTTGGGAAGAGGAGGAAGG + Intronic
957521738 3:81327264-81327286 TAACATAGGGAAAAAGAGAAAGG + Intergenic
958044133 3:88263055-88263077 GGGCACAGGGAAAAGGAGGAAGG + Intergenic
958142147 3:89574987-89575009 TAGAAATGGGATATGGAGGAGGG - Intergenic
958609490 3:96406341-96406363 TGGAAGCGGGAAAAGCAGGAGGG + Intergenic
959239776 3:103775561-103775583 GAGAAGGGGAAAAAGGAGGAAGG - Intergenic
959498989 3:107083920-107083942 GATAAGTGGGAAAAGGAGGAAGG + Intergenic
959539903 3:107525327-107525349 GAGGAGAGGGAGAAGGAGGAGGG + Intronic
959675132 3:109026219-109026241 TGCAAAAGGAAAAAGGAGGATGG + Intronic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960061512 3:113327469-113327491 AATAACAGGAAAAAGGAGGAGGG + Intronic
960198179 3:114796728-114796750 TAGGATAGTCAAAAGCAGGATGG + Intronic
960496369 3:118380345-118380367 TAGAAAAAGGAAAAGGAAGGGGG + Intergenic
960926448 3:122799246-122799268 TAAAGCAGGGTAAAGGAGGAAGG + Intronic
961676848 3:128572856-128572878 TGGCAGAGGGAAAAGGAGGGGGG - Exonic
962234093 3:133693154-133693176 GCGACTAGGGATAAGGAGGAAGG - Intergenic
962246397 3:133797923-133797945 TAGAAGAGGGAGAAGGGGAAGGG + Intronic
962445736 3:135462485-135462507 GAGAGTGGGGAAAAGTAGGATGG + Intergenic
962891094 3:139673767-139673789 TAGAAGAAAGAAAGGGAGGAAGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963090532 3:141479482-141479504 TGAAATAGAGAAATGGAGGAAGG + Intergenic
963258316 3:143168820-143168842 TAGAGCAGGGAAAAGGATAATGG - Intergenic
963677964 3:148337674-148337696 TAGTCAGGGGAAAAGGAGGATGG - Intergenic
963928745 3:150979406-150979428 TAGGAAAGTAAAAAGGAGGAAGG - Intergenic
963946079 3:151146811-151146833 GAAAAGAGAGAAAAGGAGGAGGG - Intronic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964449265 3:156794827-156794849 GAGAATAGAGAAAAAGAGCAAGG + Intergenic
965546443 3:169921169-169921191 TAAAATAGGTAAAATGAGGTTGG - Intronic
965608273 3:170518401-170518423 TAGATGAGGGACAAGGAGGGAGG - Intronic
965618900 3:170622809-170622831 TAGCATATGTAAAAGGAGGGAGG - Intronic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966244769 3:177794963-177794985 AAGAGAAGGGAAGAGGAGGAGGG - Intergenic
966514570 3:180804152-180804174 TAGAATAGTGTCAAGGAGGCAGG + Intronic
966636341 3:182138165-182138187 TAGAGGAAGGAAAAGGAGGGAGG + Intergenic
966879381 3:184341397-184341419 GAGGAGAGGGAAGAGGAGGAAGG - Intronic
966918971 3:184600253-184600275 TCCAATAGGGACAGGGAGGAGGG + Intronic
966959129 3:184915954-184915976 AGGAAGAGGGAAAGGGAGGAAGG - Intronic
967102050 3:186223572-186223594 TGGAATAGGGAAGAGAAGGGGGG - Intronic
967359444 3:188612888-188612910 CAGGATGGGGAAAAGGAGAAAGG + Intronic
967417532 3:189235382-189235404 TAGAAGAGTGAAAGGGAAGATGG + Intronic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
967836760 3:193971424-193971446 AAGCAGAGAGAAAAGGAGGAAGG + Intergenic
969039122 4:4280935-4280957 CAGAATAGGTAGCAGGAGGAAGG - Intronic
969229881 4:5822549-5822571 GAGAATAGGTAAAAGTAGAATGG - Intronic
970275789 4:14399156-14399178 TAGAAAAGGCAAAAGACGGAGGG + Intergenic
970319183 4:14858992-14859014 TATAATAGGGAAAAATAAGAGGG - Intergenic
970768081 4:19575610-19575632 TTGAAAAGGGAAAAGGGGAAGGG + Intergenic
971082829 4:23234743-23234765 TATAATAGGAAAAAGAAAGAAGG - Intergenic
971097995 4:23429787-23429809 TAGAATATGGAAAAAGTGAAGGG - Intergenic
971261557 4:25061946-25061968 CAGAATAAGGAAATGGATGAAGG - Intergenic
971443334 4:26714449-26714471 GAGATTAGTTAAAAGGAGGATGG - Intronic
971624696 4:28903827-28903849 TAGTATATGGAAAGAGAGGAAGG + Intergenic
972129333 4:35810314-35810336 AGGAAGAGGGGAAAGGAGGAGGG + Intergenic
972580300 4:40389498-40389520 TAGAAAAGTGAAATGGAAGATGG - Intergenic
972652191 4:41028908-41028930 TAGAAAAGGGAAAAGGAGGAGGG - Intronic
973276084 4:48310920-48310942 AATAATAGGGAAAAAGAGGCAGG + Intergenic
973715400 4:53670831-53670853 GAAAAAAGGGAAAGGGAGGAAGG - Intronic
974103279 4:57440581-57440603 TAAAAAAGGTAGAAGGAGGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974434631 4:61840931-61840953 TGGAATAGAGAAAAAGAGGTGGG - Intronic
974803576 4:66851290-66851312 AAGAATTGGGAAATGGAGAAGGG - Intergenic
974985353 4:69017685-69017707 AGGAATAGGGAAAAGAATGACGG - Intronic
975223050 4:71836271-71836293 TAGAAAGTGGAAAAGGAGGGAGG - Intergenic
975537387 4:75465657-75465679 AAGTATAGGGAAGAGGATGAAGG - Intergenic
976163480 4:82228575-82228597 TAAAATGGGGAAAAAGTGGATGG - Intergenic
976473320 4:85454777-85454799 GAGAAAAGGGAAAGGAAGGAGGG - Intergenic
976635127 4:87279656-87279678 AAGAAAAGGGAAAGGAAGGATGG + Intergenic
978737422 4:112099747-112099769 TTGAATTGGCAAGAGGAGGAGGG + Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978959781 4:114662723-114662745 TAGAAAAGGGAAAAAGGGAAAGG + Intronic
978967560 4:114760101-114760123 TGGAATGGGGGAAAGGATGAAGG - Intergenic
979137335 4:117126377-117126399 TAGATGAGGCAAAAGTAGGAAGG - Intergenic
979521666 4:121674328-121674350 AAGAAAAGGAAAAAGGAGAAAGG + Intronic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980318038 4:131231048-131231070 TAGGAAAGGGAAAAGGAGCTTGG + Intergenic
980941041 4:139274355-139274377 TTTAATAGGGGAAAGGAGGAGGG + Intronic
981039191 4:140206992-140207014 AAAAAGAGGGAAAAGGAGAAAGG + Intergenic
981165091 4:141548367-141548389 TAGAACAAGGAAAAAGATGAAGG + Intergenic
981203767 4:142015191-142015213 AAGAGAAGGGAAGAGGAGGAAGG - Intergenic
982130428 4:152224281-152224303 TAGAGAAGGCAAAAGGTGGAGGG + Intergenic
982172822 4:152678427-152678449 TAGAAGAGGTGGAAGGAGGATGG + Intronic
982406708 4:155028714-155028736 AAGAAGAGGAAAAAGGAAGATGG - Intergenic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
982936500 4:161484232-161484254 GAGAATAAGAAAAAGAAGGAAGG - Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
984001429 4:174251457-174251479 GAGAAAAGGGAAAAGGAGGGTGG + Intronic
984238044 4:177185416-177185438 TAGAATGGGGCAGAGGTGGAGGG - Intergenic
984847641 4:184121181-184121203 TAGAATAGGGAAAAGGAGGAGGG - Intronic
985481916 5:117970-117992 TAGAAATCAGAAAAGGAGGAGGG + Intergenic
985993661 5:3584466-3584488 GAACAAAGGGAAAAGGAGGAAGG + Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986636068 5:9823615-9823637 GAGGAGAGGGAAAGGGAGGAAGG + Intergenic
986791170 5:11162289-11162311 AGAAATAGGGAAAGGGAGGAAGG + Intronic
986878714 5:12143172-12143194 CAGAATAGGGGAAAAGGGGAAGG + Intergenic
986947780 5:13045884-13045906 TAGAATAATGAAAAGAAAGAAGG - Intergenic
987506333 5:18778013-18778035 TAAAATATGGAATAGGAGAAGGG - Intergenic
987510852 5:18836386-18836408 GAGAAGGGGGAAAAGGGGGAAGG - Intergenic
987874523 5:23663233-23663255 TAGAAGAGAGACAAGTAGGAAGG - Intergenic
988186493 5:27870926-27870948 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
988456978 5:31395302-31395324 TAGAATTGGGAGAAGGAAAAAGG - Intergenic
988776428 5:34481772-34481794 TAGGAAGGGGAAAGGGAGGAAGG - Intergenic
988970312 5:36460288-36460310 TAGACAAGGCAAAAGGGGGAAGG + Intergenic
989227465 5:39046745-39046767 AAGGATATGGAACAGGAGGAGGG - Intronic
989359395 5:40583307-40583329 TAGAATAGGGAAGGGGGGAATGG + Intergenic
989637411 5:43551018-43551040 TAGAATACAGAAACTGAGGATGG + Intronic
990132329 5:52601375-52601397 GAGTAAAGGGAAAAGAAGGAGGG + Intergenic
990334571 5:54759520-54759542 GAGAAAAGAGGAAAGGAGGAAGG - Intergenic
990743644 5:58937049-58937071 TGGAGTAGGGTACAGGAGGATGG + Intergenic
990906890 5:60813443-60813465 TAGAATAGGGAAAGGGGAAAAGG - Intronic
991510080 5:67366256-67366278 TATAAAAGAGAAAAGGATGATGG + Intergenic
991531973 5:67625243-67625265 TACAATAGCCAAAAGGTGGAAGG - Intergenic
992034968 5:72764172-72764194 GTGAGGAGGGAAAAGGAGGATGG - Intergenic
992301753 5:75389173-75389195 AAGAGAAGGGAAAAGAAGGAGGG + Intronic
992540585 5:77760379-77760401 AAGGAAAGGAAAAAGGAGGAAGG - Intronic
992680204 5:79145446-79145468 TAGCATGGGGAGAGGGAGGAGGG - Intronic
993378959 5:87183658-87183680 TAAAAGAGGGAAAGGGATGAAGG - Intergenic
993436483 5:87901861-87901883 AAGAAGAGGGAAAGGGATGAAGG + Intergenic
993457236 5:88141201-88141223 CAGACGAGGGAAAGGGAGGAAGG - Intergenic
994039491 5:95242728-95242750 TAGCCTAGGGAAAGGGATGAAGG + Intronic
994500883 5:100575968-100575990 TAGAATTTGGAAAATGAAGAGGG - Intronic
994703728 5:103172512-103172534 TAGAAGAGGAGAAAGGAAGAAGG - Intronic
995052131 5:107719115-107719137 GAGAGTAAGGAAAAGCAGGATGG + Intergenic
995126134 5:108578379-108578401 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
995412088 5:111869807-111869829 AAGAGTAGGTAAAAAGAGGAGGG + Intronic
995635385 5:114184077-114184099 AAGAATAGGGAAGAGGAAGTGGG - Intergenic
995809604 5:116089984-116090006 TAGAATAGTGAAACTGAGGCAGG + Intronic
995986873 5:118187327-118187349 TAAAATAGGGGAAAGTGGGATGG - Intergenic
996080207 5:119250770-119250792 TAGCATTGGGAAAAGGAAGAAGG + Intergenic
996587580 5:125107739-125107761 TAGAAGGAGGAGAAGGAGGAGGG - Intergenic
996950714 5:129121833-129121855 AATAATGAGGAAAAGGAGGAGGG + Intergenic
996991896 5:129644962-129644984 TGGAAGAGAGAAGAGGAGGAAGG - Intronic
997339103 5:133128601-133128623 TGGAATGGGTAAAAGGAAGATGG + Intergenic
997486325 5:134234009-134234031 CAGAAGAGGGCAAATGAGGATGG - Intergenic
997760376 5:136442162-136442184 TAGAATTAGGAAAAGGACAAAGG - Intergenic
997763145 5:136470166-136470188 TAGCAGAGGGAAAAGAAAGATGG - Intergenic
998261870 5:140637933-140637955 AAGAAAAGAGGAAAGGAGGAAGG - Intergenic
998801669 5:145875251-145875273 TAGAATAGTGAAGAGGTGGCTGG + Intergenic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999089308 5:148921372-148921394 GAGAAGGAGGAAAAGGAGGATGG + Intergenic
999257726 5:150219030-150219052 AAGAATGGGGAAGGGGAGGAAGG - Intronic
1000049278 5:157547999-157548021 TAGAACAGAGAGCAGGAGGAAGG - Intronic
1000636339 5:163647926-163647948 AAAAAAATGGAAAAGGAGGAAGG - Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000909163 5:166999935-166999957 TAAAATGAGGAAAAGGAGGTGGG + Intergenic
1001365870 5:171139318-171139340 TAGAGTAGGGAAGAGATGGATGG - Intronic
1001574751 5:172755954-172755976 TACAAGAGGGAGAGGGAGGAAGG + Intergenic
1001747896 5:174105997-174106019 TACAACTGGGAAAATGAGGAAGG + Intronic
1002552670 5:180008027-180008049 TATAGGAGGGAAAAGGAGGTGGG + Intronic
1002681325 5:180967558-180967580 GAGAATGGGGAAGAGGAGGAGGG - Intergenic
1002930561 6:1631664-1631686 TGGATTGGGGAGAAGGAGGAAGG - Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003747533 6:9019870-9019892 TAAAGTAGGGATAAGGAGCAGGG + Intergenic
1003802163 6:9682212-9682234 TAGAATTGGCCTAAGGAGGAAGG + Intronic
1004111775 6:12725446-12725468 TAGTATAGGCAATGGGAGGAAGG - Intronic
1004120363 6:12815747-12815769 TAGACTGGGGAAAAGGACAAAGG - Intronic
1004829517 6:19462384-19462406 AAGAAAAGGGAAAAAGAGCAGGG - Intergenic
1005188417 6:23189867-23189889 AAGAATATAGGAAAGGAGGATGG - Intergenic
1005589753 6:27311651-27311673 CAGAAAAGGGAAAGGGAGGTTGG - Exonic
1006304722 6:33212026-33212048 TAGAAGAGGGGAGAGGAGGGAGG + Intronic
1006342657 6:33455060-33455082 AAGAATTGGGAAGAGGAGAAGGG - Exonic
1006358168 6:33572896-33572918 TATATCAGGGAAAAGGAGTAGGG - Exonic
1006732647 6:36247664-36247686 TAGAGGAGGGTCAAGGAGGAAGG + Intronic
1007019423 6:38504429-38504451 TTTCATAGGGAAAGGGAGGAAGG - Intronic
1007217024 6:40248332-40248354 GAGAATGGGCAAAGGGAGGAAGG - Intergenic
1007325856 6:41059036-41059058 TTGCCTAGGGAAGAGGAGGAGGG + Intronic
1008241476 6:49118139-49118161 TAAAAAAGGGAAGATGAGGAAGG - Intergenic
1008450805 6:51648120-51648142 TAGAAATGGGAATAGGAGGAGGG + Intronic
1008730313 6:54474065-54474087 TAGAATATGGCAAAGGTGAAAGG + Intergenic
1008930967 6:56939446-56939468 TACAATATGCACAAGGAGGAAGG + Intronic
1009553433 6:65130155-65130177 TAGAGGAGGGAAAGAGAGGAGGG + Intronic
1009828685 6:68901027-68901049 TAGACTTGGGAAAAGAAGTAGGG - Intronic
1009863995 6:69373771-69373793 TAGTATAAAGGAAAGGAGGAAGG + Intronic
1010024239 6:71197231-71197253 TAGAAGAGGGAAAGGCAGGAGGG + Intergenic
1010076534 6:71804532-71804554 TATAAGAGAGAAAAGGAGCAAGG - Intergenic
1011457900 6:87571579-87571601 TAGAATTGGGAAAAAGAGAAGGG + Intronic
1012589569 6:100963836-100963858 TAGAATAGGGGAAAAAAAGAGGG + Intergenic
1012800505 6:103820757-103820779 AAGAAAAGGGAAGAGCAGGAAGG + Intergenic
1013033371 6:106357921-106357943 AAGAAAAGGGAAAGGGAAGAAGG - Intergenic
1013073202 6:106747788-106747810 TTTAAAAGAGAAAAGGAGGATGG + Intergenic
1013679908 6:112513651-112513673 TTGGATAGTGAAAAGGAGAATGG + Intergenic
1013766361 6:113578613-113578635 TAAAAAAGGGAAAGGAAGGAAGG - Intergenic
1014030558 6:116697418-116697440 TAGAAAAATGAAAAGGAAGAAGG + Intronic
1014167274 6:118239364-118239386 TAGGATGGGGAAAGGGAGGGAGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1015366468 6:132401824-132401846 AGGCAGAGGGAAAAGGAGGAGGG + Intergenic
1015832940 6:137389219-137389241 TGCAATAGGGATTAGGAGGAAGG + Intergenic
1016058916 6:139607950-139607972 GAGAATTGGGAAAAGGAGGAAGG - Intergenic
1016180359 6:141139129-141139151 TAGAATAGCACAAAGGGGGATGG - Intergenic
1016290618 6:142525132-142525154 TAGGAAAAGGAAAAGGAAGAAGG - Intergenic
1016472920 6:144393701-144393723 TAGAACAGGCAGAAGGAGGTGGG + Intronic
1016622290 6:146125693-146125715 CAGAATGGAGAAAAGGAGGGGGG - Intronic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1016805905 6:148211902-148211924 TAGAATAGGGAAGAGAAGCCAGG + Intergenic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1017268100 6:152474853-152474875 TGGAATAAGAAAAATGAGGAAGG + Intronic
1017681199 6:156865814-156865836 AAGAAAAGGAAAAAGGAGGAAGG - Intronic
1017702467 6:157088733-157088755 TAGAGATGGGAAAAGGAGGAGGG - Intronic
1018038064 6:159898613-159898635 AAGAAGAGGGAGGAGGAGGAAGG - Intergenic
1018164856 6:161083690-161083712 AAGAAAATGGAAAAGGCGGAAGG - Intronic
1018561072 6:165101348-165101370 TAGAGAAGGAAAAAGAAGGAAGG - Intergenic
1018738102 6:166704832-166704854 TGTAATAAGGAAAAAGAGGAAGG - Intronic
1018761380 6:166897005-166897027 TAGAATTGGGAGAAGGAAAAAGG + Intronic
1018839420 6:167507832-167507854 TAGAAGAGGGAACAGGGGAAGGG - Intergenic
1020275921 7:6624389-6624411 AAGAAAGGGGAAAAGGGGGACGG - Intergenic
1020577823 7:9956620-9956642 TAGGAGAGGAAAAAGGTGGATGG + Intergenic
1020646117 7:10816254-10816276 TAGAGTAACTAAAAGGAGGATGG + Intergenic
1020677308 7:11197456-11197478 TAGATTAAGGATAAGGATGAAGG - Intergenic
1021035737 7:15795794-15795816 TAGAAAATGGAAATGGAAGATGG + Intergenic
1021377454 7:19925354-19925376 CAGAAGAGGGAAAAAGTGGATGG + Intergenic
1021616151 7:22505100-22505122 GAGAAGAGGAAGAAGGAGGAAGG + Intronic
1022666397 7:32415629-32415651 TAATGTAGGGAAAGGGAGGAGGG - Intergenic
1022846073 7:34211165-34211187 CTGACCAGGGAAAAGGAGGAAGG - Intergenic
1022925942 7:35056316-35056338 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1023131029 7:37003377-37003399 AAGAAAAGAGAAAAGAAGGAGGG + Intronic
1023142385 7:37114332-37114354 TAGAAGTGGGGAAAGGAGGTAGG + Intronic
1023549701 7:41356746-41356768 CAGAAAAGGGAACAGCAGGATGG - Intergenic
1023762043 7:43473648-43473670 GAGAATAGGGAAGATGAGCAGGG + Intronic
1024051066 7:45623796-45623818 TCGAAGAGGGAAGGGGAGGAGGG + Intronic
1024213329 7:47226130-47226152 TAGTGTAGAGAAAAGGAGAAGGG + Intergenic
1024332831 7:48173410-48173432 TTGAATAAGTAAAAGAAGGAAGG + Intronic
1024655429 7:51447861-51447883 TAGAATAAGGATAAGGACAAAGG - Intergenic
1024862835 7:53865604-53865626 TTGGATAGGGAAAAGGCTGAAGG - Intergenic
1025104434 7:56159446-56159468 AAGCATAGGGAACAGAAGGAGGG + Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025481396 7:60988144-60988166 AAGAAAAGAAAAAAGGAGGAGGG - Intergenic
1025565851 7:62433170-62433192 GAGAATGGTAAAAAGGAGGAAGG + Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1025837918 7:65113029-65113051 GAGAATGGGAAAAGGGAGGAAGG + Intergenic
1025879351 7:65520050-65520072 GAGAATGGGAAAAGGGAGGAAGG - Intergenic
1025885150 7:65582951-65582973 GAGAATGGGAAAAGGGAGGAAGG - Intergenic
1026046587 7:66909791-66909813 GGGAATTGGGGAAAGGAGGAGGG - Intergenic
1026158947 7:67852194-67852216 TAGAATAAGGAAGATGAGGAGGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026835968 7:73639398-73639420 TATAATAGTGAAAAGCAGCATGG + Intergenic
1026944484 7:74307059-74307081 GAGAATAGTGAACAGGAAGAAGG - Intronic
1027436765 7:78172829-78172851 TAGAATGTGGAAAAGCTGGAAGG + Intronic
1027569222 7:79842321-79842343 CAGAATATGGAAGAGGAGAAAGG - Intergenic
1027624136 7:80527305-80527327 AAGAAAAGAGAAAAGAAGGAGGG + Intronic
1028266935 7:88737100-88737122 GAGAGGAGGGAAAGGGAGGAGGG + Intergenic
1028376320 7:90149235-90149257 GAGAAGAGGAAGAAGGAGGAAGG - Intergenic
1028879328 7:95861922-95861944 TTGAACAGGGAAAAAGAGAAAGG - Intronic
1029120919 7:98267703-98267725 TAGAATATGGAAAAGATGAAAGG - Intronic
1029823948 7:103171006-103171028 GAGAAGAGGAAGAAGGAGGAAGG + Intergenic
1030300728 7:107971785-107971807 TGGAATAGAGAAAAAGAGGAAGG + Intronic
1030509040 7:110460483-110460505 AAGAAGATGGAAGAGGAGGAGGG + Intergenic
1030814891 7:114023642-114023664 TAGAATATAGAAAAGGAGCTTGG - Intronic
1032425987 7:131822511-131822533 TAGAATTAGGAAAAGGAAAAAGG - Intergenic
1032817993 7:135496705-135496727 TAGGAGAGGTAAAAGGAAGATGG - Intronic
1032859276 7:135862186-135862208 TTGAATAGAGAACAGGATGAAGG - Intergenic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1033170597 7:139080315-139080337 TACAAAAGTGAAGAGGAGGAAGG - Intronic
1033201134 7:139371192-139371214 TAGCTTAGGGAAAACAAGGAGGG - Intronic
1033446104 7:141423533-141423555 TAGAATATGGAGGAGGAGGAGGG + Intronic
1033456001 7:141504103-141504125 TAGAATAGTAAAAATCAGGAGGG - Intergenic
1033561495 7:142536351-142536373 TGTAATAGGGAGAAGGAGGTGGG + Intergenic
1033650653 7:143340507-143340529 GAGAAGAGAGAAAAGAAGGAAGG - Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034422236 7:150996065-150996087 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1034422264 7:150996131-150996153 TGGGATGGGGAGAAGGAGGAGGG - Intronic
1035759864 8:2061474-2061496 TAGAGTCGGGAACAGGAGGAAGG - Intronic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1037692038 8:21190045-21190067 TAGAAAAGGCAGAATGAGGACGG + Intergenic
1038146920 8:24905664-24905686 TTGTATAGGGAAGAAGAGGAGGG - Intergenic
1038217820 8:25578680-25578702 TAGACAAGGGAAAAGGAGAAAGG + Intergenic
1038694598 8:29795148-29795170 TAGAGGAGGAAGAAGGAGGATGG - Intergenic
1038900842 8:31841994-31842016 TAGAATGGGGAGGAGGAGGAGGG - Intronic
1038905660 8:31899349-31899371 GAGAATAGGGAATAGAAGGATGG - Intronic
1039177306 8:34824453-34824475 TGGAATTTGGAAAAGGAGGATGG - Intergenic
1039262585 8:35787987-35788009 AAGAAAAAAGAAAAGGAGGAAGG + Intronic
1039436022 8:37559701-37559723 GAGGAGAAGGAAAAGGAGGAGGG + Intergenic
1040120634 8:43681200-43681222 TAGAATCTGCAAAAGGAGGTTGG + Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041334498 8:56765333-56765355 TACAATGGAGAAAAGGAGAAAGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041777776 8:61542515-61542537 GATAATAGTGCAAAGGAGGAAGG - Intronic
1041800819 8:61796218-61796240 GAAAATAGCAAAAAGGAGGAGGG - Intergenic
1042482428 8:69319314-69319336 TAGAAGAGGGAGAAGGAAAAGGG - Intergenic
1043499207 8:80836444-80836466 TAGAATATGGGGAATGAGGAGGG - Intronic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1043973900 8:86563915-86563937 TAGAAAAGGAAAGAGCAGGAGGG - Intronic
1044005400 8:86931642-86931664 TATAATAGGGACAAAGAGGAAGG - Intronic
1044194922 8:89364042-89364064 TAGAATTGGGAAAAGTAGGATGG + Intergenic
1044324444 8:90843958-90843980 TAGAATAGAGGAAAGATGGAGGG - Intronic
1044626784 8:94241868-94241890 TGGAATAAGGACAAGAAGGAAGG + Intergenic
1044801948 8:95966151-95966173 TAAGAGAGGGAGAAGGAGGAAGG + Intergenic
1044857645 8:96493394-96493416 TAGAAAAGGGAAAGTGAAGAAGG + Exonic
1045014041 8:97983299-97983321 CACAATAGGCAAAAGGTGGAAGG - Intronic
1045055113 8:98362132-98362154 TAGAAGAGAGCAAAGGAGGGTGG + Intergenic
1045734633 8:105280485-105280507 TAGATTACGGAAAACGTGGAAGG - Intronic
1045743448 8:105388317-105388339 GAGAAAAGGGAAAAGGAGATGGG + Intronic
1045818545 8:106307074-106307096 AACAATTGGGAAAAGAAGGAAGG + Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046061379 8:109143989-109144011 TGGAAAATGGAAAAGAAGGAAGG - Intergenic
1046157094 8:110306198-110306220 AAGAAGGGAGAAAAGGAGGAAGG - Intergenic
1046601761 8:116325365-116325387 GAGGAAAGGGAAAAGGAAGATGG + Intergenic
1047622911 8:126626449-126626471 TAGAAGGGAGGAAAGGAGGAAGG + Intergenic
1047699936 8:127438941-127438963 TTAAATGGGCAAAAGGAGGAAGG + Intergenic
1048250942 8:132866457-132866479 TAGAAGAAAGAAAAGAAGGAAGG + Intergenic
1048715597 8:137265232-137265254 TAGCATAGGGAAAATGGGGGTGG + Intergenic
1048718750 8:137298574-137298596 TAGAAAAGGGTAAAGGTGGAGGG - Intergenic
1049949105 9:627263-627285 TGGTTTAGGGAGAAGGAGGAGGG - Intronic
1050094932 9:2054561-2054583 TAAAATGGGGAAAAGGGGGCAGG - Intronic
1050569747 9:6925420-6925442 AGGAAAAGGGGAAAGGAGGAAGG - Intronic
1050734419 9:8747274-8747296 TAGAATTAGGAAAAGGAAAAAGG + Intronic
1051097847 9:13487019-13487041 AAAAATAAGTAAAAGGAGGAAGG + Intergenic
1051105732 9:13577893-13577915 GAGAATGGGAAAAAGGAGGAGGG + Intergenic
1051540511 9:18211320-18211342 TGGAATAGGGAAAAAATGGAGGG - Intergenic
1051548374 9:18302185-18302207 TAGAATTTGGGAAAGGAAGAGGG + Intergenic
1052099422 9:24426382-24426404 TAGAATATGAAAAAGGAGAGAGG - Intergenic
1052629808 9:31022972-31022994 TAGAGAGGGGCAAAGGAGGATGG - Intergenic
1052839589 9:33280520-33280542 TGGAAAGGGGAAAAGGAGGCTGG - Intronic
1053004605 9:34596151-34596173 TACTATAAGGAAAAAGAGGATGG - Intergenic
1053239597 9:36486134-36486156 TAGAATGGGGAAAAAGGAGAGGG - Intronic
1053618621 9:39794293-39794315 TAGATAAGGGACAAGGAGGGAGG - Intergenic
1053876796 9:42553655-42553677 TAGATAAGGGACAAGGAGGGAGG - Intergenic
1053895878 9:42741050-42741072 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1054234901 9:62548067-62548089 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1054265534 9:62913136-62913158 TAGATAAGGGACAAGGAGGGAGG + Intergenic
1055107019 9:72523611-72523633 TTGAATAGGCTGAAGGAGGAGGG + Intronic
1055332652 9:75199744-75199766 TAGAATTGAGGATAGGAGGAGGG - Intergenic
1055569188 9:77599360-77599382 TTGAATAGGGGGAAGGAGAATGG + Intronic
1055703453 9:78971815-78971837 GAGAATGGAGAAAAGAAGGAGGG + Intergenic
1055767031 9:79674409-79674431 TAGAATAGAGATAATGAGCATGG - Intronic
1055775988 9:79767632-79767654 TGGGAGAGGGAAAAGGAGGATGG - Intergenic
1056952627 9:91055772-91055794 TACAATATGAAAAAGGTGGAGGG - Intergenic
1056958262 9:91099764-91099786 TAGAAAATGAAAGAGGAGGAGGG + Intergenic
1057106266 9:92420542-92420564 TAGAAGAGAGGGAAGGAGGATGG - Intronic
1057387116 9:94614129-94614151 AAGAGGAGGGAGAAGGAGGAGGG + Intronic
1057980397 9:99655596-99655618 AATAATAGGGCAAAGGAGGGAGG + Intergenic
1058400935 9:104618333-104618355 GAAAATAGGGAAGAGGAGGAAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058646425 9:107135345-107135367 GACAAGAGGGAAAGGGAGGAAGG + Intergenic
1058953183 9:109922453-109922475 AAAAAGATGGAAAAGGAGGAAGG + Intronic
1059562626 9:115349946-115349968 TAGAGAAGGAAAAAGGAGCACGG + Intronic
1059850701 9:118335690-118335712 TTGAATGGGGAAAAGAAGAAAGG + Intergenic
1059961642 9:119570759-119570781 TAGAATTTGGACAAGGAGAATGG + Intergenic
1060085038 9:120690796-120690818 TAGGATAGGACAGAGGAGGAGGG + Intronic
1060095701 9:120787323-120787345 TAAAATATGGGAAAGGAGGTCGG - Intronic
1061481798 9:130901163-130901185 AAGTTTAGGGGAAAGGAGGAAGG + Intergenic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1062744610 9:138203433-138203455 GAGAATTAGGAAGAGGAGGAGGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1187395347 X:18914650-18914672 CAGAAGAGGGTAAAGGAGGAAGG + Intronic
1187447672 X:19373147-19373169 GAGAGGAAGGAAAAGGAGGAAGG + Intronic
1187675937 X:21716636-21716658 TGGAAGATAGAAAAGGAGGAAGG - Intronic
1187737980 X:22323816-22323838 TGGAAAGAGGAAAAGGAGGAGGG - Intergenic
1187743231 X:22379315-22379337 TATAATATGGAAAGGGAGGCGGG - Intergenic
1187794790 X:22991853-22991875 CAGAAGATAGAAAAGGAGGAGGG - Intergenic
1187933806 X:24316858-24316880 AAAAAGAGGGAAAAAGAGGAAGG - Intergenic
1188073765 X:25749781-25749803 TAGGAAAGGAAAGAGGAGGATGG - Intergenic
1188265251 X:28065743-28065765 AAGAAAAGGGAAAAGGGAGAAGG + Intergenic
1188269297 X:28118878-28118900 GGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1189305122 X:39981197-39981219 TAGAATAGGGAAGAACAGAATGG - Intergenic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189703635 X:43737533-43737555 CAGAAAAGGCAGAAGGAGGAAGG + Intronic
1189738365 X:44094297-44094319 AAGAAAAGAAAAAAGGAGGAAGG - Intergenic
1189986103 X:46554653-46554675 TAGAAAATGGAAAAGGAGTCTGG + Intergenic
1190009406 X:46771058-46771080 TAGAGCAGGGAAAAGTGGGAAGG + Intergenic
1190198035 X:48336565-48336587 TAGAAAAGAGAAAAGAAGTATGG + Intergenic
1190255960 X:48762285-48762307 TAGAGGAGGCCAAAGGAGGAAGG + Intronic
1190734315 X:53245729-53245751 TAGAATAAGCAAAAAGAGCAAGG + Intronic
1191034297 X:56008374-56008396 GAGAATAAGGAAAAGCAGGGTGG + Intergenic
1192063205 X:67852775-67852797 TAGAATAGGGAAGATGCGGTTGG + Intergenic
1192419481 X:71016472-71016494 TAGTATTGGGAAGAGGAGGGAGG + Intergenic
1192656447 X:72999816-72999838 TAGAGGAAGGAAAGGGAGGAAGG - Intergenic
1192665673 X:73083185-73083207 TAGAGGAAGGAAAGGGAGGAAGG + Intergenic
1193190456 X:78564041-78564063 TAGAGCAAGGAAAAGCAGGATGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1193568375 X:83108762-83108784 TAGAACAAGACAAAGGAGGAGGG - Intergenic
1193797808 X:85897947-85897969 TAGCACAGGGAAAAGGAAAAGGG + Intronic
1194002036 X:88442530-88442552 GAGATTAGGGGCAAGGAGGAGGG + Intergenic
1194327649 X:92540281-92540303 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1194420799 X:93670624-93670646 TGAAAAAGGGAAAGGGAGGAAGG - Intergenic
1194655490 X:96568550-96568572 TAGAAATGGAAACAGGAGGATGG + Intergenic
1194764104 X:97829300-97829322 GAGATCAGGGAGAAGGAGGAAGG - Intergenic
1194769346 X:97882140-97882162 TGGAAGAGGTAAAATGAGGATGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195427235 X:104748094-104748116 TAGAATAGAGGAGAGCAGGAAGG + Intronic
1195496874 X:105546430-105546452 TAAAATGGAGAGAAGGAGGAAGG + Intronic
1195570426 X:106393693-106393715 AAGACCAGGGAAAGGGAGGAGGG - Intergenic
1195852356 X:109296629-109296651 TAGATCAGGGAAAAGCAGAAAGG + Intergenic
1196096968 X:111810206-111810228 TAGAATATGGCAAAAGAGGCAGG - Intronic
1196206128 X:112942081-112942103 AACAAAAAGGAAAAGGAGGAAGG - Intergenic
1196530312 X:116778796-116778818 GAGAATAGAGGATAGGAGGAAGG + Intergenic
1196838695 X:119837244-119837266 TAGAATAGAGAATAGTATGATGG - Intronic
1197136427 X:123065658-123065680 TAGAATAGGGGATGGGGGGAAGG + Intergenic
1197436510 X:126434845-126434867 TAGAGGAGGGGGAAGGAGGAAGG + Intergenic
1197967111 X:132076895-132076917 CAGAACATGGAAAAGGAGGGAGG - Intergenic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1199036499 X:143056960-143056982 AAGAAAAGAGAAAAGGGGGAAGG - Intergenic
1199090354 X:143684365-143684387 TAGGAGAGGGAAAAGGAAGAAGG + Intergenic
1199680522 X:150221392-150221414 TGGAAGAGTGAAAAGGAGGCTGG - Intergenic
1199725659 X:150578016-150578038 TAGAATATGGAAAAAGTGTAGGG + Intronic
1200636360 Y:5659499-5659521 AAGAGGAGGGAAAAGCAGGAAGG - Intronic
1200753517 Y:6968496-6968518 GATAATAGGTAAAAAGAGGAAGG + Intronic
1202580237 Y:26372805-26372827 GAGAACAGGTTAAAGGAGGAAGG + Intergenic