ID: 984848085

View in Genome Browser
Species Human (GRCh38)
Location 4:184124995-184125017
Sequence CTAGTTGAGTAAATATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 352}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984848083_984848085 -8 Left 984848083 4:184124980-184125002 CCACCTTGGTTTCTGCTAGTTGA 0: 1
1: 0
2: 2
3: 5
4: 137
Right 984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG 0: 1
1: 0
2: 2
3: 36
4: 352
984848077_984848085 28 Left 984848077 4:184124944-184124966 CCATATTAGGGAACATAGAACAG 0: 1
1: 0
2: 1
3: 4
4: 139
Right 984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG 0: 1
1: 0
2: 2
3: 36
4: 352
984848082_984848085 -7 Left 984848082 4:184124979-184125001 CCCACCTTGGTTTCTGCTAGTTG 0: 1
1: 0
2: 2
3: 12
4: 140
Right 984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG 0: 1
1: 0
2: 2
3: 36
4: 352

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984848085 Original CRISPR CTAGTTGAGTAAATATTTAT TGG Intronic
900634373 1:3654828-3654850 CTGGTTTAGTATTTATTTATAGG + Intronic
903731690 1:25501240-25501262 CTAGATGGTTAAATATTTAGAGG + Intergenic
905779265 1:40693013-40693035 TTTGTTGAGTAAATATTGTTAGG + Intronic
906683284 1:47745571-47745593 TTTGTTTAGTCAATATTTATTGG + Intergenic
906741091 1:48186138-48186160 ATAGTGGAGTACATATTGATTGG - Intergenic
907412708 1:54293799-54293821 CTGGCTCAGTAAATATTTTTTGG + Intronic
907990866 1:59581305-59581327 CTAGTTGAGAACATTTCTATTGG + Intronic
909475981 1:76081429-76081451 CCAATTTAGTAAATATTTATAGG + Intronic
909586223 1:77291660-77291682 CTAATTCAACAAATATTTATTGG + Intronic
910038238 1:82814748-82814770 TTGATTCAGTAAATATTTATTGG - Intergenic
910239775 1:85074011-85074033 CTAACTCAATAAATATTTATTGG - Intronic
911079131 1:93910458-93910480 GATGTTGAGTAAATATTTGTTGG + Intergenic
911349686 1:96737917-96737939 GCTGTTGATTAAATATTTATGGG + Intronic
911466558 1:98261636-98261658 CTAATGGAAGAAATATTTATAGG - Intergenic
911542848 1:99179279-99179301 TTAATTTTGTAAATATTTATGGG + Intergenic
912579603 1:110708239-110708261 TTAATTCAGAAAATATTTATTGG + Intergenic
913181485 1:116326538-116326560 GAAGCTTAGTAAATATTTATGGG - Intergenic
915336154 1:155143338-155143360 CTAGTTCAACAAATATTTTTCGG - Intergenic
915599051 1:156910848-156910870 CACCTTGAGTAAATATTTACTGG + Intronic
916215903 1:162394181-162394203 CTATTTGTGTTAAAATTTATGGG + Intergenic
916626669 1:166565499-166565521 TTAATTTAATAAATATTTATTGG - Intergenic
917349927 1:174066348-174066370 ATAGTAGTGTATATATTTATGGG - Intergenic
917545159 1:175958751-175958773 TTAGTTGGGTAAGTTTTTATAGG - Intronic
917550827 1:176026842-176026864 CTATTTTAGTAAATATTCAAGGG + Intronic
917603841 1:176604861-176604883 TTAGTAGAGTAAAAATTTACAGG + Intronic
918577121 1:186075699-186075721 CTGGTTAAATAAATATTTTTTGG - Intronic
919783805 1:201243140-201243162 CTAGTTGGGAAAAAATTAATTGG + Intergenic
920273541 1:204786131-204786153 CTAGTTGGGTATATATTCAAAGG - Intergenic
920999622 1:211030450-211030472 TTAGTTGAGTATATTTGTATGGG - Intronic
921029978 1:211327910-211327932 TTAATTCTGTAAATATTTATTGG + Intronic
921711122 1:218374338-218374360 CTCATTTAATAAATATTTATTGG - Intronic
922112208 1:222571491-222571513 TTAGTTCAGTAAATTTTTAGTGG - Intronic
922283829 1:224151067-224151089 GTAGTTCAGTAAGTTTTTATTGG + Intronic
922885288 1:229015578-229015600 TTATTTGAGTAAAAATTGATAGG + Intergenic
922970447 1:229731999-229732021 TTTCTTGAATAAATATTTATTGG - Intergenic
923125477 1:231030774-231030796 CTAGTAATGTAAATATTGATAGG - Intronic
923990466 1:239431135-239431157 CTTGTTTATGAAATATTTATAGG + Intronic
924621179 1:245662304-245662326 TTAGGTGTGTAAATATATATAGG - Intronic
1065035716 10:21636867-21636889 GTAGTTGTGTATACATTTATAGG + Intronic
1065770886 10:29077334-29077356 CTAATTCAGCAAGTATTTATTGG - Intergenic
1065804499 10:29382311-29382333 CTCTATGAGTAAATATTTGTTGG - Intergenic
1066987214 10:42478158-42478180 AGAGTTTAGAAAATATTTATTGG + Intergenic
1068370758 10:56110237-56110259 TCAGTTGACTACATATTTATAGG - Intergenic
1068564443 10:58557135-58557157 TTCGTTGAGTAAATAATTCTAGG + Intronic
1068679600 10:59805377-59805399 CTAGTAGGGAAAGTATTTATTGG + Intronic
1068808060 10:61223062-61223084 CAAGTACAGTAAATATTTTTTGG - Intergenic
1068830783 10:61492206-61492228 CTAATTAGGTAAATGTTTATTGG - Intergenic
1068941144 10:62682656-62682678 TTAGATAAATAAATATTTATTGG - Intergenic
1068988966 10:63131960-63131982 CTAGTTGATTGACTAATTATGGG - Intergenic
1069783354 10:70970686-70970708 CTAGTTCTGTAGGTATTTATGGG - Intergenic
1070535330 10:77372919-77372941 CTAGGTAATTAAATATTTCTTGG - Intronic
1071234354 10:83627430-83627452 CTTGTTGAGTAAAAAATTATTGG + Intergenic
1071241595 10:83712199-83712221 CAAGTTAATTAAATATTAATTGG - Intergenic
1071668353 10:87582806-87582828 TTTGTTCAGTAAATATTTATAGG - Intergenic
1072226160 10:93371671-93371693 CTATTATAGTAAATATTCATAGG + Intronic
1072324255 10:94281251-94281273 CTAGTGGACTAACTACTTATAGG - Intronic
1072988510 10:100166024-100166046 CTTATTGAAAAAATATTTATAGG - Intronic
1073877794 10:107945833-107945855 CTAATTGACTAAACATTTAGTGG + Intergenic
1073963499 10:108961267-108961289 TCAGTTTAGTAAGTATTTATTGG + Intergenic
1074094955 10:110304105-110304127 CCAGTCGCTTAAATATTTATCGG + Intronic
1075380066 10:122011801-122011823 TTAATTGAACAAATATTTATTGG + Intronic
1075868940 10:125753891-125753913 TTAGTAGAGAAAATTTTTATAGG - Intronic
1077830212 11:5860021-5860043 ATGGTTAAGTAAACATTTATTGG - Intronic
1078192324 11:9101534-9101556 CATTTTAAGTAAATATTTATTGG - Intronic
1079987437 11:27213778-27213800 CGTATTTAGTAAATATTTATTGG + Intergenic
1082569267 11:54717913-54717935 TAAGTTCACTAAATATTTATTGG + Intergenic
1085887117 11:80533883-80533905 TTAGTGAAGCAAATATTTATTGG + Intergenic
1085897841 11:80661276-80661298 ATAATTGAGTTAATATTTCTGGG + Intergenic
1087544146 11:99562712-99562734 GTAATTGATTAAATATTTATTGG + Intronic
1087765211 11:102144237-102144259 ATAGTTGAGAAAATATTACTGGG - Intronic
1087908050 11:103722479-103722501 CTAGTTGGATTAATATTTAAAGG - Intergenic
1087961163 11:104351364-104351386 GTAATTCAGTAAATATATATTGG - Intergenic
1088363403 11:109014818-109014840 CTAGATGACTAAATATTCATTGG - Intergenic
1088679119 11:112224064-112224086 CTCTTTCACTAAATATTTATTGG - Intronic
1090314718 11:125775826-125775848 TTGGTTGAGTAAATATCTAAAGG + Intergenic
1090642640 11:128742335-128742357 TTAATTTAGCAAATATTTATTGG - Intronic
1091012711 11:132020498-132020520 CTATTTGAGTTAATGTTTAGTGG + Intronic
1091109877 11:132955983-132956005 TTAATTGAATAAATATTGATTGG - Intronic
1092065341 12:5585592-5585614 TTATTTCAGTAAATATTTACTGG - Intronic
1092754997 12:11755065-11755087 TGTGTTTAGTAAATATTTATTGG + Intronic
1093331728 12:17851627-17851649 ATAGTAGTGTATATATTTATAGG + Intergenic
1093378837 12:18465372-18465394 TTTATTTAGTAAATATTTATAGG + Intronic
1094251329 12:28365819-28365841 ATATTTGAGTAAACATTTACAGG - Intronic
1096273765 12:50188343-50188365 ATACTTTAGTAAATGTTTATAGG - Intronic
1097307564 12:58086379-58086401 ATAGTTCAGTAAATATTTGTTGG - Intergenic
1097557181 12:61153735-61153757 CTTTTTGAGTCAATATTTACTGG - Intergenic
1097827915 12:64193548-64193570 CTTGTAGATTGAATATTTATTGG - Exonic
1097867685 12:64572642-64572664 TTAATTTAGTAAATATTTATTGG - Intergenic
1097913667 12:64997450-64997472 CTTATTCAATAAATATTTATTGG - Intergenic
1098681110 12:73355971-73355993 CTAGCTGAATAACTATTTACTGG - Intergenic
1099935375 12:89118897-89118919 TTACATGAGTTAATATTTATAGG - Intergenic
1100750273 12:97691106-97691128 ATATTTGACTAAATATTTTTTGG + Intergenic
1100877400 12:98976286-98976308 CAATTTCAGTAAATATTTCTGGG - Intronic
1101676557 12:106922173-106922195 ATAGTGGTGTATATATTTATAGG + Intergenic
1101689090 12:107058421-107058443 CAAGTTGAGAAAATAGTTACAGG + Intronic
1103145166 12:118589345-118589367 CTCATTGAGCAAATATTTATTGG + Intergenic
1104073801 12:125371719-125371741 CTTGTGCAGTAAATAATTATAGG + Intronic
1105390283 13:19970662-19970684 TTCATTCAGTAAATATTTATTGG + Intronic
1106145888 13:27049389-27049411 TTCATTGAATAAATATTTATTGG - Intergenic
1107816265 13:44247262-44247284 TTGGTTCAATAAATATTTATTGG - Intergenic
1108301719 13:49084061-49084083 CTAGTTGATATACTATTTATAGG - Intronic
1111156209 13:84329856-84329878 CAAGTGGATTAAATATTTGTAGG - Intergenic
1111170586 13:84521776-84521798 CTAGTTGAGGTAATAATAATTGG - Intergenic
1112699270 13:101986481-101986503 ATGTTTGATTAAATATTTATAGG + Intronic
1113244738 13:108382494-108382516 CTATTTTAGTAAATTTTTTTTGG + Intergenic
1113496416 13:110733357-110733379 CTATTTGAGGAAATACTTAGAGG - Intergenic
1113646567 13:112001289-112001311 TTAATACAGTAAATATTTATAGG - Intergenic
1114587663 14:23828976-23828998 CTCAATGAATAAATATTTATTGG - Intergenic
1114796937 14:25726796-25726818 TTAGTTGAGTCAATATTCAGGGG - Intergenic
1115201099 14:30855329-30855351 CTAGATGTGAAAATATTTACAGG + Intergenic
1115999004 14:39223259-39223281 TTAGTGGAGTACATTTTTATTGG + Intergenic
1117037031 14:51740555-51740577 CTGCTTGAGTCAACATTTATTGG - Intergenic
1117327659 14:54684222-54684244 CTAACTCGGTAAATATTTATTGG - Intronic
1117559684 14:56924090-56924112 GTAGCTGAGTCCATATTTATTGG + Intergenic
1117604693 14:57415899-57415921 CTAGTTAAGTCAATATTTGGTGG - Exonic
1120242758 14:81968650-81968672 ATATTTAAGTAAATATATATAGG + Intergenic
1120361588 14:83510974-83510996 GAAGTTCAATAAATATTTATAGG - Intergenic
1120563183 14:86021884-86021906 TTAATTCAGAAAATATTTATTGG - Intergenic
1121969905 14:98346392-98346414 TAAATTGAGTAAATGTTTATTGG + Intergenic
1122537468 14:102475713-102475735 CTTGTTGGGTAAATGTTAATTGG - Intronic
1123737316 15:23198177-23198199 GTCTTTGAGTAAATTTTTATTGG + Intergenic
1124288533 15:28426841-28426863 GTCTTTGAGTAAATTTTTATTGG + Intergenic
1124294693 15:28490473-28490495 GTCTTTGAGTAAATTTTTATTGG - Intergenic
1124469960 15:29975545-29975567 CAAGTTCAACAAATATTTATTGG - Intergenic
1125142146 15:36421014-36421036 GTAATTGGGTAGATATTTATTGG + Intergenic
1126397721 15:48236621-48236643 CTAATTGAGTAAATAAATAAAGG + Intronic
1126457797 15:48883176-48883198 ATATTTGAGTAAATAATAATAGG + Intronic
1130794941 15:87197786-87197808 CTTGTTGAGTAAAGATTAAATGG + Intergenic
1131351121 15:91700812-91700834 TAATTTTAGTAAATATTTATTGG - Intergenic
1134826899 16:17292031-17292053 CTAGCTGGCTAATTATTTATGGG - Intronic
1134852009 16:17487133-17487155 CCAGTTGAATAGATATTTCTTGG - Intergenic
1134881690 16:17750363-17750385 ATAGTAGTGTATATATTTATGGG - Intergenic
1135874174 16:26182154-26182176 CCAGTTCAGCAGATATTTATTGG + Intergenic
1135977210 16:27116440-27116462 ATAGTAGTGTATATATTTATGGG + Intergenic
1138050924 16:53776549-53776571 CCAGTACAGTAAATATTGATAGG - Intronic
1138961009 16:62029212-62029234 CTATTGTAGTAACTATTTATTGG + Intronic
1140192693 16:72831561-72831583 TTAGTAGAGTAAACATGTATAGG + Intronic
1140301053 16:73757529-73757551 TTAATTCAGTAAATATTTATTGG + Intergenic
1142947806 17:3448290-3448312 CTATTTGTGTAAACATTTGTTGG + Intronic
1145873044 17:28291988-28292010 TTAGGTCAGTAAATATTTGTTGG + Intergenic
1146801219 17:35824701-35824723 CTTCTTAAGTAAATAATTATTGG + Intronic
1147466310 17:40613763-40613785 GGAGCTCAGTAAATATTTATTGG + Intergenic
1149126105 17:53235453-53235475 CTCTGTGAGAAAATATTTATTGG - Intergenic
1149185849 17:53996813-53996835 CTTGTTTAACAAATATTTATTGG - Intergenic
1150940693 17:69690414-69690436 TCAGTTGAGCAAATATTGATGGG + Intergenic
1153280624 18:3411246-3411268 CTGGTTGAGTAAATGTTTTCAGG + Intergenic
1153280833 18:3412326-3412348 CTGGTTGAGTAAATGTTTTCAGG - Intronic
1153684443 18:7531324-7531346 GGAGTTTAGTAAATATCTATTGG + Intergenic
1153807644 18:8723257-8723279 GTGGTGGAGGAAATATTTATTGG + Intronic
1155637583 18:27973994-27974016 CTAGTTGAAAATGTATTTATTGG - Intronic
1156150119 18:34231534-34231556 CTGTTTGAGAGAATATTTATGGG + Intergenic
1156186039 18:34664800-34664822 CTAATAGGGTAAATATTGATAGG + Intronic
1157800268 18:50614696-50614718 CTAGATGTGTATATATTTAAAGG + Intronic
1158019235 18:52821677-52821699 CTAGCTGAGTACTTCTTTATTGG + Intronic
1159633457 18:70777623-70777645 CTAGCCTAATAAATATTTATTGG + Intergenic
1166900794 19:46060741-46060763 GTATTTGTGTAAATATGTATTGG - Intronic
925602460 2:5622953-5622975 CTACTTTAGAAAATGTTTATTGG - Intergenic
927346353 2:22047254-22047276 TCAATTAAGTAAATATTTATGGG - Intergenic
927593390 2:24376089-24376111 CTACCTGAGTAAATTTTTTTAGG - Intergenic
928117332 2:28555682-28555704 TTAGTTCAGCAAATATTTATTGG - Intronic
928993458 2:37260716-37260738 GTAATTGACTAAAAATTTATGGG - Intronic
930330574 2:49978204-49978226 CTAGCTGAGGAAATATATAAAGG + Intronic
930464205 2:51724663-51724685 TTATTTCATTAAATATTTATTGG + Intergenic
930580003 2:53199413-53199435 CTTGGTAAATAAATATTTATGGG - Intergenic
930984915 2:57573707-57573729 ATATTTGAGAAAATATTTAAAGG - Intergenic
931226041 2:60333161-60333183 CTAGGTAAGAAAATATTTATTGG - Intergenic
931813183 2:65874618-65874640 CAAGTTGATTAAATACTTCTAGG - Intergenic
933000457 2:76915897-76915919 CTTTGTGAGGAAATATTTATTGG + Intronic
933476759 2:82801643-82801665 ATAGATAAATAAATATTTATTGG + Intergenic
933912828 2:86959042-86959064 CTAATTTTGTTAATATTTATTGG + Intronic
934010167 2:87810848-87810870 CTAATTTTGTTAATATTTATTGG - Intronic
935773734 2:106451564-106451586 CTAATTTTGTTAATATTTATTGG - Intronic
935906330 2:107844349-107844371 CTAATTTTGTTAATATTTATTGG + Intronic
935992793 2:108736864-108736886 CTAATTTTGTTAATATTTATTGG + Intronic
936064786 2:109322510-109322532 CTATTTGTGAAATTATTTATAGG - Intronic
936128108 2:109809507-109809529 CTAATTTTGTTAATATTTATTGG + Intronic
936216589 2:110561978-110562000 CTAATTTTGTTAATATTTATTGG - Intronic
936425728 2:112416559-112416581 CTAATTTTGTTAATATTTATTGG - Intronic
936651623 2:114433892-114433914 CTAGATAAGTAAATATTTTTTGG - Intergenic
936688624 2:114859024-114859046 CTAGTTGAGAAATAAATTATTGG + Intronic
936763521 2:115816068-115816090 TTAATTCAGTAACTATTTATTGG + Intronic
936829131 2:116620167-116620189 TTAGTTGAATATATATATATGGG - Intergenic
937011840 2:118569894-118569916 TTACTTGAGGAAATATTTTTGGG - Intergenic
937655844 2:124375017-124375039 ATAGTTGAATAAATAATTAAAGG + Intronic
938649839 2:133371586-133371608 AGAGTTGAAGAAATATTTATAGG - Intronic
939064413 2:137465342-137465364 CTAGTAGATTAGATATTTTTAGG - Intronic
939277574 2:140019396-140019418 TTGGTTGAGTAAACTTTTATAGG - Intergenic
939469414 2:142600633-142600655 TTTATTGAATAAATATTTATTGG + Intergenic
940463097 2:153992962-153992984 CTATTAAAGTAAATATTTGTAGG - Intronic
940733927 2:157427766-157427788 CTCATTTGGTAAATATTTATTGG + Intronic
941433325 2:165437195-165437217 CTAGTTGAGAAGCTATTTAAAGG - Intergenic
943369039 2:186992925-186992947 ATGGTTAAGTAAATATATATAGG + Intergenic
946379525 2:219335857-219335879 CTACTTGAGAATATATTGATAGG - Intergenic
946490445 2:220144308-220144330 CTCGTTCACCAAATATTTATTGG - Intergenic
946561592 2:220920186-220920208 CTAGTAATATAAATATTTATTGG + Intergenic
1170456250 20:16536572-16536594 ATATTTGTGTACATATTTATGGG - Intronic
1173091568 20:39976961-39976983 CTTGTTCAGAAAATATTTGTTGG - Intergenic
1173344643 20:42187678-42187700 CCAGCTGAGTAGATATTGATGGG + Intronic
1177305979 21:19316835-19316857 AATATTGAGTAAATATTTATAGG + Intergenic
1179512580 21:41883687-41883709 CTAGTTGCCTATGTATTTATAGG - Intergenic
1180647816 22:17354177-17354199 ACTGTTTAGTAAATATTTATGGG + Intergenic
1181431020 22:22881895-22881917 CTTGATCAGTAAATATTTATTGG + Intronic
1181657466 22:24315413-24315435 TTTGCTCAGTAAATATTTATTGG + Intronic
1182972724 22:34592994-34593016 CTAATTCAATAGATATTTATTGG + Intergenic
949823215 3:8137756-8137778 CTCATTCAGTAGATATTTATGGG - Intergenic
950753171 3:15147129-15147151 CAAGTTGATTAAATATTAATTGG + Intergenic
951157213 3:19370346-19370368 CTGGTTGAGTAAATAGTTGAAGG + Intronic
951720950 3:25697522-25697544 CTCGTTTAGTAACTATTTTTGGG + Intergenic
952366559 3:32679978-32680000 CTGTTTGAGTAACTATTTAATGG + Intergenic
953903405 3:46856239-46856261 ATAGTTGAGCAAAGATTTAAAGG - Intergenic
953953865 3:47215181-47215203 CTGGTTAAGGAAATATTTATAGG + Intergenic
955198849 3:56831118-56831140 CTTCATCAGTAAATATTTATTGG - Intronic
956377859 3:68634931-68634953 GTGGCTTAGTAAATATTTATTGG + Intergenic
956960053 3:74389133-74389155 GTATATGAGTAGATATTTATAGG + Intronic
957024720 3:75168318-75168340 TTAGGTAAGCAAATATTTATAGG + Intergenic
957246002 3:77717114-77717136 ATAGTTCAGGTAATATTTATAGG - Intergenic
957602526 3:82356470-82356492 TTAGTTTAGCAAATATTTATTGG + Intergenic
957688382 3:83534840-83534862 CTAGTAGTGTAAGAATTTATAGG + Intergenic
957808186 3:85179930-85179952 CGTGCTTAGTAAATATTTATGGG - Intronic
958977655 3:100685144-100685166 ATTTTTGAGTAAATATTTAGTGG + Intronic
960061638 3:113328996-113329018 TTAATTTAGCAAATATTTATTGG - Intronic
962529157 3:136262921-136262943 CTAGTTGAATACATCTTTATGGG + Intronic
963591350 3:147263690-147263712 CTCATTAAATAAATATTTATTGG + Intergenic
964169943 3:153758162-153758184 CTATTTAAGTAGATATTAATAGG + Intergenic
964632236 3:158823940-158823962 CTAGTAGTGGAAATAGTTATGGG + Intronic
965053980 3:163690323-163690345 CTTGTTGGGGAAATATTAATGGG + Intergenic
966338121 3:178894092-178894114 CCACTTGTGTATATATTTATGGG - Intergenic
967352487 3:188529133-188529155 TTAGATGTGTTAATATTTATTGG + Intronic
967498686 3:190171870-190171892 GTAGATGTGTATATATTTATGGG - Intergenic
967712523 3:192725774-192725796 CTAGCTGACTAAGTATTTCTGGG - Intronic
970720747 4:18986062-18986084 AAAGTTCAGTAAATATTTCTGGG + Intergenic
970950353 4:21748503-21748525 CTTGTTGTGTAAATATTTTTTGG - Intronic
971572659 4:28232778-28232800 CTGGTAGAATAAATATTGATAGG - Intergenic
971985275 4:33814289-33814311 ACAGTTGAGTAAATATTTGAAGG + Intergenic
972653195 4:41039890-41039912 CTAGTTGAGGAAACAAGTATGGG - Intronic
972909117 4:43792022-43792044 CTATTTGAGCAAGTATTTTTTGG - Intergenic
974128059 4:57719722-57719744 CTTGTTGAATGAATTTTTATTGG + Intergenic
974659425 4:64866490-64866512 CTACCTGAATATATATTTATTGG - Intergenic
975273287 4:72464311-72464333 CTAGGTGAATAAATGGTTATAGG + Intronic
975788548 4:77921934-77921956 TTCGTTGAGCAAATAGTTATTGG + Intronic
976081850 4:81364520-81364542 ATTTTTGAGAAAATATTTATTGG - Intergenic
976516041 4:85967814-85967836 CTAGTTTAGTAGATCTTCATTGG + Intronic
976923105 4:90462131-90462153 CTGGTTCAGTAAATATTTACTGG + Intronic
977251766 4:94696269-94696291 CTTCTTGAGTAAATTTTGATAGG + Intergenic
978526447 4:109671969-109671991 CTATTTGAGAAAGAATTTATAGG - Intronic
979093131 4:116513156-116513178 CTATTAGAGTGAATATTTCTTGG - Intergenic
979106358 4:116693644-116693666 GTTGTTCAGTAAATATTTGTAGG + Intergenic
979324304 4:119361211-119361233 ATAGTTTACTAAATATTTATGGG + Intergenic
979612710 4:122706031-122706053 CTAGTTGATTAAATTTTATTGGG + Intergenic
980309921 4:131113449-131113471 CTAGTACAGTAAATATTTGAGGG + Intergenic
981562079 4:146058967-146058989 CTTGTTTTGTCAATATTTATAGG + Intergenic
981947458 4:150364835-150364857 CCAGCTCAATAAATATTTATTGG - Intronic
983024876 4:162723908-162723930 GTAGTTGAGTAAATTTTTATGGG - Intergenic
983242144 4:165245910-165245932 ATAGTTTACTAAATATTTATGGG + Intronic
983526353 4:168764002-168764024 TTACTGCAGTAAATATTTATAGG - Intronic
983609019 4:169621996-169622018 CAAGTTGAGAAAATATCTGTAGG - Intronic
983968295 4:173841456-173841478 CTATTATAGTAAATATTAATGGG - Intergenic
984072336 4:175130726-175130748 TTTGTTGAGTAAATGATTATGGG + Intergenic
984545765 4:181100165-181100187 CACCTTGAGTATATATTTATAGG + Intergenic
984848085 4:184124995-184125017 CTAGTTGAGTAAATATTTATTGG + Intronic
985319477 4:188693729-188693751 TTAGGGTAGTAAATATTTATGGG + Intergenic
986669547 5:10130887-10130909 CTAGATAAGGTAATATTTATAGG - Intergenic
986714372 5:10512094-10512116 GTTGTTCAGCAAATATTTATTGG - Intronic
987760514 5:22156411-22156433 CAAGTTGAGTAAGACTTTATAGG - Intronic
988067673 5:26242446-26242468 CTATTTGTGAAAATATTTCTGGG + Intergenic
988206306 5:28140286-28140308 ATATTTCAATAAATATTTATAGG + Intergenic
988335786 5:29907455-29907477 ATCATTCAGTAAATATTTATTGG - Intergenic
988373951 5:30408829-30408851 TTCAATGAGTAAATATTTATTGG - Intergenic
988687260 5:33537148-33537170 TTAGTTTGGTAACTATTTATTGG + Intronic
989953485 5:50329707-50329729 ATAGTTGAGTGAATATTTGAAGG - Intergenic
991895290 5:71389855-71389877 CAAGTTGAGTAAGACTTTATAGG - Intergenic
992248525 5:74854022-74854044 CTAGCAGTGTATATATTTATGGG + Intronic
992971755 5:82067732-82067754 CAAGTTGACTAAATATACATAGG + Intronic
993518642 5:88870162-88870184 AAATTTGAGTAAATTTTTATAGG - Intronic
994269415 5:97759538-97759560 GTAGGTGAATACATATTTATTGG + Intergenic
994880325 5:105484364-105484386 AAAGGTGAGCAAATATTTATGGG + Intergenic
997044446 5:130297233-130297255 TTTATTGAGTAAATATATATGGG - Intergenic
998268465 5:140684730-140684752 CTAATACAGTAAATATTGATAGG - Intronic
998538136 5:142953237-142953259 TTAATTCAGTGAATATTTATTGG + Intronic
998643127 5:144034609-144034631 CTAATTGAACAAATATTTACTGG + Intergenic
998717078 5:144896589-144896611 GTAGTAGGGTATATATTTATGGG - Intergenic
999372705 5:151065548-151065570 TTAATTGAGTAAGTGTTTATTGG - Intronic
999687484 5:154115990-154116012 CTCATTCAGTAAATATTTATGGG - Intronic
1000666645 5:164006033-164006055 TTAATTTACTAAATATTTATTGG + Intergenic
1000667952 5:164022255-164022277 CTTGTTGAGTAATAATTTGTTGG - Intergenic
1000731780 5:164843704-164843726 GTAGTTGAGAAAATATTCATGGG + Intergenic
1004227207 6:13796987-13797009 CTAGGTGATTTAATCTTTATGGG + Intronic
1005282878 6:24293327-24293349 CAAGTTCAGTAAATTTTTATGGG + Intronic
1005349054 6:24916484-24916506 CTCGTTTAGTCAATATTTATTGG - Intronic
1007254354 6:40518299-40518321 CTCATTGAACAAATATTTATTGG - Intronic
1007448088 6:41922080-41922102 TTGGTTTTGTAAATATTTATGGG + Intronic
1008421435 6:51304720-51304742 TGATTTGAGTCAATATTTATTGG + Intergenic
1009408352 6:63336348-63336370 CTATATGTGTACATATTTATAGG - Intergenic
1009730818 6:67603628-67603650 TTAATTCTGTAAATATTTATTGG - Intergenic
1011324921 6:86140060-86140082 ATAGTAGTGTATATATTTATGGG + Intergenic
1012018472 6:93884653-93884675 ATTGTTGATTAAATATTTATAGG - Intergenic
1012949597 6:105503785-105503807 TTCCTTTAGTAAATATTTATTGG - Intergenic
1014506249 6:122261654-122261676 TTTGTTCAGTATATATTTATGGG - Intergenic
1016266913 6:142243316-142243338 CTAGTGAAGATAATATTTATAGG - Intergenic
1016506939 6:144792622-144792644 AAAGTGGAGTAAATATTTATTGG - Intronic
1017229631 6:152059040-152059062 CTAGTTGAAAAAATATTAATTGG + Intronic
1017319911 6:153078371-153078393 CCAGTAGAGTTAATATTTTTAGG - Intronic
1017356027 6:153510276-153510298 TTAATTGACTATATATTTATGGG - Intergenic
1018864831 6:167738144-167738166 CTTGCTTGGTAAATATTTATGGG - Intergenic
1018929315 6:168229761-168229783 CTCCTTGAGTAAATTTTTAGTGG - Intergenic
1020674655 7:11167490-11167512 ATAGTTCAGAAAATATTGATTGG + Intronic
1022053072 7:26698975-26698997 ATAGTTGTGTCAATATTTGTAGG + Intronic
1023547088 7:41329660-41329682 GGACTTGAGTAAATCTTTATAGG - Intergenic
1023583923 7:41709206-41709228 CTAGGTGAGTAAATATTTCCAGG + Intergenic
1023713314 7:43017753-43017775 CTAACAGAGTAAATATTTTTGGG + Intergenic
1023880846 7:44320654-44320676 CTAGTTTAGTTACTATTTAATGG - Intronic
1024867142 7:53916351-53916373 CTTGTTGAAAAATTATTTATTGG + Intergenic
1025102236 7:56145200-56145222 TTAGTTAATCAAATATTTATAGG + Intergenic
1025536874 7:61959218-61959240 CTAATTGAGGAAATATTCAATGG + Intergenic
1025783628 7:64623761-64623783 CTAGTTGTGTTAATTTTTGTTGG - Intergenic
1026223811 7:68423326-68423348 CCAGTGCAGTAGATATTTATAGG + Intergenic
1027635757 7:80670708-80670730 CCAATAGAGTAAATATTTATAGG - Intronic
1027747526 7:82096070-82096092 GGTGTTTAGTAAATATTTATTGG - Intronic
1030496211 7:110304214-110304236 ATAGTTGAATAAATATTCACAGG + Intergenic
1030621923 7:111799355-111799377 CTAGTTGTGTCAATTTTTGTTGG - Intronic
1030757009 7:113298909-113298931 ATATTTGAGTAAAAATTTAAAGG + Intergenic
1030811344 7:113975919-113975941 ATAGTTGAGTAAAAATGTCTTGG - Intronic
1031208950 7:118797184-118797206 TTAGTTGAGTAAAGAATGATAGG - Intergenic
1031373301 7:120994350-120994372 TTCATTTAGTAAATATTTATTGG + Intronic
1032137920 7:129298347-129298369 CTAGTTAACTAAATATTTCAAGG + Intronic
1032333890 7:131006572-131006594 CTCGATCAGTAAATATTTACTGG - Intergenic
1033872718 7:145776816-145776838 CTAGTTGAGAAAGAATTTAAGGG - Intergenic
1035017116 7:155776264-155776286 CTATTTGAGCAAATAATGATAGG + Exonic
1037186958 8:16076243-16076265 GTTGTTGAGTGAAGATTTATAGG + Intergenic
1038074285 8:24052781-24052803 GTAGTTGTATATATATTTATTGG + Intergenic
1038111585 8:24505706-24505728 CTAGTTGTATTAATATTTACTGG + Intronic
1039636313 8:39170614-39170636 TTTGTTGAGTATATATATATAGG + Intronic
1039765883 8:40627120-40627142 CTAGTTGACTGAATATTGATTGG - Intronic
1041157328 8:55001905-55001927 CTAGTTGGGAAAATAATTACAGG + Intergenic
1041750694 8:61257902-61257924 CTAGTTTACAAAATATGTATTGG + Intronic
1042214314 8:66414338-66414360 ATAGTTTAGAAAACATTTATAGG - Intergenic
1042328464 8:67553696-67553718 CAAGATGAGAAAATATTTATTGG - Intronic
1042831008 8:73028520-73028542 CTAGATGAGTCAGAATTTATTGG + Intronic
1043777038 8:84282809-84282831 TCAGTTGAGTATATATGTATAGG + Intronic
1043932865 8:86110458-86110480 ATAGTTCAGTAAAGGTTTATTGG + Intronic
1044474822 8:92613708-92613730 CTAGTTAAATAAATAGCTATTGG - Intergenic
1044818678 8:96139995-96140017 GTAGTTGAGTAATTAATTGTAGG + Intergenic
1045133098 8:99179776-99179798 AGACATGAGTAAATATTTATTGG + Intronic
1045772730 8:105762869-105762891 AAAGTTGAGTAGATCTTTATTGG + Intronic
1046341801 8:112868704-112868726 TTAGTTGACTATATATTTATGGG - Intronic
1046433578 8:114159420-114159442 CTCTTTGAGAAAATATTTATGGG + Intergenic
1046978686 8:120312640-120312662 GTAGTTGAAAATATATTTATAGG - Intronic
1047259768 8:123245018-123245040 ATAGATGAGGAAATATTAATAGG + Intronic
1047836770 8:128702277-128702299 CTACTTGATCAAATATATATTGG - Intergenic
1050434849 9:5598101-5598123 CCAGTTCAGGAAATATTTGTGGG + Intergenic
1050570141 9:6929324-6929346 ATAGTTGAGTAAATAGTAAAAGG - Intronic
1051028329 9:12641828-12641850 TGAGTTTAGTAAATATTTATGGG - Intergenic
1051067565 9:13122947-13122969 ATTGCTGAGTCAATATTTATTGG + Intronic
1051180016 9:14401529-14401551 CTTGTTGAGTAACTATTTATAGG - Intergenic
1054832154 9:69637482-69637504 ATAGTGGTATAAATATTTATGGG - Intronic
1055982372 9:82016886-82016908 ATAGTTGAAAAAAAATTTATAGG - Intergenic
1057779182 9:98035877-98035899 CTCATTCAGAAAATATTTATTGG + Intergenic
1058631929 9:106998035-106998057 CCAGATAAGTAAATATTTTTAGG - Intronic
1058934585 9:109756845-109756867 TTTGATGAGTACATATTTATAGG + Intronic
1059349177 9:113652281-113652303 CTATCTGTGTAAATAATTATTGG + Intergenic
1059563077 9:115353914-115353936 TTATTTGAGTAAACATTTATTGG + Intronic
1061347403 9:130037884-130037906 GGAGTTCAATAAATATTTATTGG - Intronic
1061647503 9:132017116-132017138 GTGGTTCAGTAAATATTTAATGG - Intronic
1061686350 9:132282876-132282898 CTCTTTGAGCAAACATTTATTGG - Intronic
1186537579 X:10365695-10365717 TTAGTTCAGCAAACATTTATTGG + Intergenic
1186845304 X:13524847-13524869 CTACTTTAGGAAATGTTTATTGG + Intergenic
1186873650 X:13796383-13796405 CTAATATAGAAAATATTTATAGG + Intronic
1187014524 X:15312917-15312939 CTAGTTGCATTAATATTTAAAGG + Intronic
1188023677 X:25186340-25186362 CTCATTCAGTAAATACTTATTGG - Intergenic
1189116364 X:38347068-38347090 CTAGTTCAGAACCTATTTATTGG - Intronic
1189268298 X:39733043-39733065 CCAGTTCAGCAAATATTTACTGG - Intergenic
1189592118 X:42524573-42524595 ATAATTGAGTTAATATTTCTTGG + Intergenic
1189823260 X:44891427-44891449 ATAGTTGCGTATATATTTGTAGG + Intronic
1190394922 X:49972219-49972241 ATAATTGAGTATGTATTTATTGG + Intronic
1193116434 X:77780119-77780141 CTGGTTGTATAAACATTTATTGG - Intronic
1193227060 X:78996098-78996120 ATAGCTGAGAAAATATTTCTGGG - Intergenic
1193711509 X:84885883-84885905 TTACTTGAGCAAAAATTTATAGG - Intergenic
1194548246 X:95265106-95265128 GTACTTGAGTAAAAATTTAAAGG - Intergenic
1194690577 X:96979778-96979800 CTATGTGACTAAATAATTATGGG - Intronic
1195427505 X:104751225-104751247 TTTGTTCAGCAAATATTTATTGG + Intronic
1195900783 X:109795140-109795162 CTAATTGAATAAAAATGTATAGG + Intergenic
1197612124 X:128651586-128651608 TAAGCTGAGGAAATATTTATAGG - Intergenic
1197866664 X:131026317-131026339 CTTGTTGATTAGATATTTAGGGG + Intergenic
1197896597 X:131322078-131322100 TTAGTTGAACAAACATTTATTGG + Intronic
1198199486 X:134400840-134400862 CTAGTTGGGTAAATAAAAATTGG + Intronic
1198552145 X:137756421-137756443 ATTGTTTAATAAATATTTATGGG - Intergenic
1199004534 X:142679798-142679820 CTTGTTCAATATATATTTATGGG - Intergenic
1199213333 X:145239703-145239725 CTCATTCAATAAATATTTATTGG + Intergenic
1199666685 X:150101783-150101805 GTTGATGAGTAAATATTTGTGGG + Intergenic
1201361715 Y:13158735-13158757 TTAGTTGAGTAAATGTTGAAAGG + Intergenic
1201457598 Y:14187104-14187126 CAAGTTGAGTGAATAATTAATGG + Intergenic