ID: 984850628

View in Genome Browser
Species Human (GRCh38)
Location 4:184149536-184149558
Sequence TCTGAAGGCCTGCCCTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 583
Summary {0: 1, 1: 1, 2: 8, 3: 69, 4: 504}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984850622_984850628 22 Left 984850622 4:184149491-184149513 CCAGGTGGAAATGTGTCTTTCTC 0: 1
1: 0
2: 0
3: 20
4: 218
Right 984850628 4:184149536-184149558 TCTGAAGGCCTGCCCTGGGCAGG 0: 1
1: 1
2: 8
3: 69
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984850628 Original CRISPR TCTGAAGGCCTGCCCTGGGC AGG Intronic
900299358 1:1969277-1969299 TGGGAAGGCCTGGGCTGGGCAGG - Intronic
900400577 1:2471316-2471338 TGTGGAGGCCTGGGCTGGGCAGG + Intronic
900495326 1:2973487-2973509 GCTGAACCACTGCCCTGGGCCGG - Intergenic
900506786 1:3033277-3033299 TCTGAAGGCCTTCCCTTGATTGG - Intergenic
900565435 1:3329640-3329662 TGTGAAGGCTCGCCCTGGGCTGG - Intronic
900586424 1:3434589-3434611 GCTGCAGGCCTGCCCGAGGCTGG + Exonic
900892911 1:5462493-5462515 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
900919913 1:5663470-5663492 TCTGCTGCCCTGCCCTGGCCGGG + Intergenic
900934708 1:5758071-5758093 TCCGAGGGGCAGCCCTGGGCAGG - Intergenic
901448075 1:9320073-9320095 CCTGGCGGCCTGCCCTGAGCAGG - Intronic
901465575 1:9418883-9418905 GCTGAGGCCCTGCCCTGGCCTGG + Intergenic
901669820 1:10849693-10849715 GCTGAAGGGCTGCCCTGGAGTGG + Intergenic
902902802 1:19531634-19531656 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
903174410 1:21572262-21572284 TCTGAAGGCTTGACTGGGGCTGG + Intronic
903276475 1:22225088-22225110 TCTGAAGGCTTGACTGGGGCCGG - Intergenic
903344459 1:22675533-22675555 TCTGAGGGCCTGCTGTGTGCAGG - Intergenic
903496826 1:23774409-23774431 TATGAAGGCTTGGCCAGGGCTGG - Intergenic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
903960033 1:27051218-27051240 CCTGAAGGCCTGACTGGGGCTGG + Intergenic
904009781 1:27383022-27383044 CCTGGAGGCCTGCACTTGGCCGG + Intronic
904354793 1:29931946-29931968 CCTCATGGCCTGCCCTAGGCTGG + Intergenic
904999843 1:34659557-34659579 TATGAGGGATTGCCCTGGGCAGG - Intergenic
905264358 1:36740683-36740705 TCTGAGGGCCTGGGCTGGACAGG - Intergenic
905810465 1:40909008-40909030 TCTGATGGTCAGCCCTGTGCTGG + Intergenic
905923041 1:41731733-41731755 TCTGAAGGCCTGATTGGGGCTGG - Intronic
906254590 1:44338358-44338380 TCTGAAGGCCTGACCGGGGCTGG + Intronic
906698058 1:47838026-47838048 GCTGGACACCTGCCCTGGGCAGG + Intronic
906698060 1:47838034-47838056 TGTGCCGGCCTGCCCAGGGCAGG - Intronic
907458930 1:54593831-54593853 TCTGGAGGCCTGGCCTGGGCTGG + Intronic
907557713 1:55359168-55359190 CCTGAAGGCCTGTCCTATGCAGG + Intergenic
907952107 1:59193685-59193707 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
908324764 1:63012969-63012991 TATGAAGCACTTCCCTGGGCCGG - Intergenic
908413417 1:63889026-63889048 TCTAAAGGCCTGACCAGGGCTGG + Intronic
909121200 1:71606343-71606365 TCTGAAGGCTTGACTGGGGCTGG - Intronic
909642245 1:77882141-77882163 TCTGAAGGCCTGATTGGGGCTGG + Intergenic
910291658 1:85605804-85605826 CCTGCAGCCCTGCCCAGGGCTGG - Intergenic
910464147 1:87478460-87478482 ACTGCAGGCCTGCCCTCTGCAGG - Intergenic
910960252 1:92754559-92754581 TCTGAAGGCTTGACTGGGGCTGG + Intronic
911094058 1:94041426-94041448 TCACCAGGCCTGCCCTGGGTTGG + Intronic
912091409 1:106080976-106080998 TCTGAGGACCTGTCCAGGGCTGG + Intergenic
915752910 1:158228605-158228627 TCTCCAGACCTGCCCAGGGCTGG + Intergenic
916690190 1:167182805-167182827 TCTGAAGGCTTGTCTAGGGCTGG + Intergenic
916738683 1:167630091-167630113 TCTTGAGTCCTGCCCTGGGAGGG + Exonic
917527517 1:175802171-175802193 TCTTAGGGCCTGTCCTGAGCGGG - Intergenic
917980034 1:180263450-180263472 TCTGCAGGGCTGGGCTGGGCCGG + Intronic
918393059 1:184086563-184086585 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
919729793 1:200906226-200906248 TCTGAAGGCCTGGCCGGGTGTGG + Intronic
919808824 1:201396745-201396767 ACTTAAGGCCTGCCCTGCTCAGG - Intronic
919887048 1:201942203-201942225 GCTGAAGGCCTGCTGTGTGCTGG + Intronic
920057179 1:203201321-203201343 TGCGGTGGCCTGCCCTGGGCTGG + Intergenic
920740798 1:208579533-208579555 TGAGAAGGCCTGCCCTGGCCTGG - Intergenic
921007104 1:211104705-211104727 TCTGAAGGCCTGGAGTGGGCAGG - Intronic
921014294 1:211173719-211173741 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
921178409 1:212612865-212612887 TCAGAGAGCCAGCCCTGGGCTGG + Intronic
921297084 1:213714539-213714561 CCTGATGGCCAGCTCTGGGCTGG + Intergenic
922043403 1:221919232-221919254 TGGGAAGGCCTGCCGTGGCCTGG + Intergenic
922882407 1:228990731-228990753 TCTGGAAGCCTGCCCTGTGCAGG + Intergenic
923022022 1:230172350-230172372 TCTGAAGGTTTGCCTAGGGCTGG - Intronic
924201764 1:241667685-241667707 TCTGAAGGCCTGTTCTGAGCTGG - Intronic
924944899 1:248839334-248839356 TCTTAAGAACTGCCCAGGGCCGG + Intronic
1065490488 10:26277312-26277334 TCTGCGGGCGGGCCCTGGGCTGG - Intronic
1065641025 10:27782972-27782994 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1067223650 10:44361716-44361738 TCTGAATCCCTGGCCTGGCCTGG - Intergenic
1067386358 10:45820632-45820654 TCTGAAGGAATGCACTGGGAAGG - Intergenic
1067483149 10:46619122-46619144 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1067611605 10:47722522-47722544 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1068601480 10:58961426-58961448 TCTGAAGGCCTGACTGGGGATGG - Intergenic
1068632200 10:59309532-59309554 TGTGAAGGCCTGCGCTGGAAAGG - Intronic
1069778299 10:70939432-70939454 TCCCAAGTCCTGCCCTGGCCTGG - Intergenic
1070645988 10:78202925-78202947 TCTGAGGCCCTGCTCTGAGCTGG - Intergenic
1070816748 10:79329111-79329133 TCTTACTCCCTGCCCTGGGCAGG - Intergenic
1071486743 10:86107359-86107381 TCTGAAGGGCGTCCCTTGGCAGG + Intronic
1071627024 10:87182763-87182785 TCTGAAGGCTTGACTGGGGCTGG + Intronic
1072042100 10:91617290-91617312 TCTGAAAGCTTGACTTGGGCTGG + Intergenic
1072619482 10:97070110-97070132 TCTGAAGGCTTGGCTGGGGCTGG - Intronic
1073440877 10:103552041-103552063 TCTGAGTGCCTGCTCCGGGCAGG + Intronic
1073674288 10:105627738-105627760 TCTGAAGGCTTGACTAGGGCTGG + Intergenic
1073805049 10:107088400-107088422 TCTGAAGGCAGGCCCTGGGGGGG + Intronic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074803629 10:117026778-117026800 TCTCTGGGCCTGCCCAGGGCTGG + Intronic
1074945622 10:118278162-118278184 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1075016734 10:118915180-118915202 TCTGTGTGCCTGCCCTGGGCAGG - Intergenic
1075979890 10:126729011-126729033 TCTGAAGGCTTACCTGGGGCTGG - Intergenic
1076088094 10:127653519-127653541 TCTGACGGCCTGACCAGGGCTGG - Intergenic
1076119148 10:127921935-127921957 TCTGAAGCCCTGTGCTGGGCAGG + Intronic
1076656795 10:132029658-132029680 GCTGAAGGCCTGGCTTTGGCTGG + Intergenic
1077021569 11:419399-419421 ACTGACGGCAGGCCCTGGGCTGG - Intronic
1077392334 11:2305761-2305783 ACTGGATGCCTGCACTGGGCTGG + Intronic
1078476223 11:11632682-11632704 CCCGAAATCCTGCCCTGGGCTGG + Intergenic
1078723814 11:13909566-13909588 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1079071662 11:17352540-17352562 ATTGAAGGCCTGCCCTGTGCAGG + Intronic
1079135797 11:17775434-17775456 TCTGAGGGCTTGTCCTGGGAGGG + Intronic
1080022885 11:27581922-27581944 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1081760771 11:45575222-45575244 TCTGAAGGGCTCCCCTAGCCAGG + Intergenic
1083614249 11:64018544-64018566 TGAGAGGCCCTGCCCTGGGCTGG - Intronic
1083629346 11:64087784-64087806 GCTGGACGCCTGCCCAGGGCTGG + Intronic
1084213777 11:67635815-67635837 TCTGGAGGCAGGCTCTGGGCGGG - Intronic
1084360287 11:68664707-68664729 TTTGAACTCCTGCCCTGGGTTGG + Intergenic
1084712424 11:70852328-70852350 TCTGAAGGGCTTCTCTGGGATGG - Intronic
1085022334 11:73217662-73217684 TCTAATGGCCTTCCCTGGTCGGG - Intergenic
1085324024 11:75593010-75593032 ACTGAAGCACTGCCCTGGGAAGG + Intronic
1085729890 11:78988305-78988327 TCTGAAGACCTGACCAGGGCTGG - Intronic
1086347927 11:85916636-85916658 TCTGAAGGCTTGATCGGGGCAGG + Intronic
1086747707 11:90451096-90451118 CCTGAAGGCCTGTCCTTGACAGG + Intergenic
1086858034 11:91890281-91890303 TCTGAAGACTTGACTTGGGCTGG - Intergenic
1087065568 11:94024884-94024906 TTTGAATGCCTGCCCTGTACTGG - Intronic
1088181893 11:107121932-107121954 TTTCTAGACCTGCCCTGGGCCGG + Intergenic
1088250872 11:107859812-107859834 TCGGAAGGCGTGGCCAGGGCAGG - Intronic
1088961259 11:114667766-114667788 TCTGAAGGCCTGACTGGGGCTGG - Intergenic
1089327398 11:117666678-117666700 TCTGAAGGGCTGGCCCCGGCAGG + Intronic
1089513601 11:119017377-119017399 CCTGAAGGGCTGCCCTGGCCAGG + Exonic
1089638095 11:119829547-119829569 TCTGCAGGCCTGCGTTGGGCAGG + Intergenic
1089642336 11:119856075-119856097 TCTGAAGGCCTGATAGGGGCTGG + Intergenic
1090082338 11:123622404-123622426 GTTGGAGGCCTGCCCTAGGCGGG + Intronic
1091370895 11:135056867-135056889 TCTGCCGTCCTCCCCTGGGCTGG + Intergenic
1091796663 12:3301174-3301196 ACAGAAGACCTGCCCTGGGGAGG + Intergenic
1092016186 12:5160937-5160959 ACTGAATGGCTTCCCTGGGCTGG - Intergenic
1092114394 12:5988624-5988646 GCTTAAGGCCTGCCCAAGGCAGG + Intronic
1093083771 12:14843638-14843660 TGTGAACGCCCGTCCTGGGCAGG - Intronic
1094529247 12:31257947-31257969 TCTGAAGGCTTAGCCAGGGCTGG + Intergenic
1096653641 12:53075017-53075039 TCTGAAGAACTACCTTGGGCTGG - Intronic
1097347402 12:58509157-58509179 TCTGAAGGCCTGACTGAGGCTGG + Intergenic
1100825309 12:98469393-98469415 TCTGAAGGCTTGACCAGGGCTGG - Intergenic
1101527555 12:105545434-105545456 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1101717185 12:107320942-107320964 TTTGAAGGCCTGACTTGGGTAGG + Intronic
1102057204 12:109905516-109905538 GGTGAAGGCCTGAACTGGGCTGG + Intronic
1102881483 12:116488375-116488397 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1103216389 12:119204842-119204864 TCTGAAGGCTAGACCAGGGCTGG + Intronic
1103573082 12:121857682-121857704 GCTGGAGGCCTGCCCTTGTCAGG + Intronic
1103741311 12:123093638-123093660 TCTGGGGGCCAGCCCTGGGAGGG + Intronic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1104076015 12:125390759-125390781 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1104564041 12:129864239-129864261 TCTCAAGGCCTGACAGGGGCTGG - Intronic
1106340044 13:28819592-28819614 CCTGGAGGCCTGCCCTGGAACGG + Intergenic
1107373624 13:39778737-39778759 TCTGAAGGCTTGACTGGGGCAGG + Intronic
1107889904 13:44905213-44905235 GCTGGAGTCCTGCCCTGAGCTGG - Intergenic
1110408466 13:75177175-75177197 TCTGAAGGCCTGACCAGGGCTGG - Intergenic
1110499626 13:76211852-76211874 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1111450504 13:88408861-88408883 TCTGCAGAACTGCCCTGAGCTGG - Intergenic
1111993372 13:95138840-95138862 TGTGAGGGCCTGCCCAGGCCAGG - Intronic
1112083491 13:96002985-96003007 TCTGAAAGCCTGCTCTGCCCTGG - Intronic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1113937086 13:114000190-114000212 TCTGCTGGGGTGCCCTGGGCCGG + Intronic
1113937469 13:114001983-114002005 CCTCAAGCCTTGCCCTGGGCAGG + Intronic
1115105281 14:29753619-29753641 TATGATGGCTTGCTCTGGGCTGG - Intronic
1116139654 14:40975105-40975127 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1116413281 14:44650166-44650188 TTCGTGGGCCTGCCCTGGGCTGG + Intergenic
1116801070 14:49443647-49443669 TCTGACGGCATCCCCTGGCCAGG + Intergenic
1119549383 14:75497272-75497294 GCTGAAGGCCTCCTCTGGGCAGG - Intergenic
1119873975 14:78041082-78041104 TCTGAAGGCCTGACCAGGGCTGG - Intergenic
1119923951 14:78473737-78473759 TCTGAAGGCTTGACTGGGGCCGG + Intronic
1121188437 14:91999068-91999090 TCTGAGTGCCTACCTTGGGCAGG + Intronic
1121436157 14:93921531-93921553 GCTGACAGCCTGCCGTGGGCTGG + Intronic
1121656540 14:95600943-95600965 TCTGAAGGCTTGACGGGGGCTGG + Intergenic
1121782419 14:96630443-96630465 TCTGAAGGCCTGAGCGGGGCCGG + Intergenic
1122045601 14:99021039-99021061 TCTGATGGGCTGCCCTGAGTGGG + Intergenic
1122090458 14:99335114-99335136 GCTGCAGCCCTGCCCTGGGAAGG - Intergenic
1122100891 14:99408899-99408921 TCTGCAGGCCCACCCTGGGAGGG - Intronic
1122243418 14:100383971-100383993 TCTGTGGGGCTGCCCTGGGTGGG + Intronic
1123130424 14:105981359-105981381 TCAGCAGGCCGTCCCTGGGCCGG - Intergenic
1124617719 15:31254542-31254564 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1124792597 15:32743624-32743646 TCTAAAGGCTTGCCTGGGGCTGG + Exonic
1124825356 15:33088944-33088966 TCTGAGGGCTTTCCCTGGGACGG - Exonic
1125473996 15:40032020-40032042 TCTAAAGGTTTGCCCTTGGCTGG - Intronic
1125676979 15:41507350-41507372 TCTGGAGGGGTGTCCTGGGCAGG - Intronic
1125853205 15:42923816-42923838 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1126119217 15:45236430-45236452 TAAGAAGCCCTGCCCTAGGCAGG - Intergenic
1126778293 15:52118129-52118151 TCTGAAGGCTTTCCCTAGGGTGG + Exonic
1127463007 15:59217066-59217088 TCTGAAGGCTTGCCTAGGGTTGG - Intronic
1127838465 15:62809739-62809761 TCAGAGGGCCTGCTGTGGGCAGG + Intronic
1128220048 15:65962700-65962722 ACTGAAGGCCTACTCTGTGCAGG + Intronic
1128231129 15:66036157-66036179 TCTGAAGGACAGACCTGGGGTGG - Intronic
1129262952 15:74379048-74379070 TTCAAAGGCCTGCCCTGGGGTGG + Intergenic
1130068454 15:80626635-80626657 ACTGAAATCCTGCCCTGTGCAGG + Intergenic
1130228136 15:82075648-82075670 TGTGAAGCTCTGCCATGGGCTGG - Intergenic
1130562331 15:84968358-84968380 TCTGAAGGCCTGACTGGGGCTGG + Intergenic
1131184368 15:90262600-90262622 TCTGGAGCCCTGCCCTGGGTCGG - Intronic
1131461709 15:92622341-92622363 TGTCCAGGCCTGACCTGGGCAGG - Intronic
1132091574 15:98951627-98951649 TCTGAAGGCTTGCCTGGGGGAGG + Intronic
1132392892 15:101451581-101451603 TCCCAAAGCCTGCCCTTGGCTGG + Intronic
1132646066 16:999850-999872 TCTGAGAGCCTGGCCTGGGAGGG + Intergenic
1132692844 16:1189259-1189281 CCTGAAGCCCTGCCAGGGGCTGG - Intronic
1132742345 16:1421097-1421119 CCTGCCCGCCTGCCCTGGGCTGG + Intergenic
1133774415 16:8886021-8886043 ACTGAAGGGCTGCCCTGGAGGGG - Intergenic
1134060417 16:11196337-11196359 TCTGAAGGTTTGGCCGGGGCTGG - Intergenic
1135075209 16:19387327-19387349 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1135143881 16:19944722-19944744 TCTAAAGTCCTGCCCCAGGCCGG - Intergenic
1136128090 16:28199858-28199880 TTAAAAGGCCTTCCCTGGGCCGG + Intronic
1136268674 16:29135538-29135560 TTTGAAGGCCTGACTGGGGCTGG - Intergenic
1136270802 16:29147100-29147122 TCTGAAGTCCTGACCGGGGCTGG - Intergenic
1136285129 16:29236342-29236364 TCTTCAGGCCTGTCATGGGCTGG - Intergenic
1136546769 16:30958819-30958841 TGAGAAGGCCTGCGCAGGGCAGG - Exonic
1136775370 16:32868878-32868900 TGTGAAGGCCTGGCTGGGGCAGG + Intergenic
1136895246 16:33992634-33992656 TGTGAAGGCCTGGCTGGGGCAGG - Intergenic
1137667564 16:50260668-50260690 TCTGAAGGCTTGACTGGGGCTGG + Intronic
1137877026 16:52006754-52006776 TCTGAAGGCAAGGCCAGGGCAGG + Intronic
1138133208 16:54499808-54499830 TCTGAAGTCCTGCACCGTGCTGG + Intergenic
1139312780 16:66041305-66041327 GCTGAACGCTTGCCCTGGGCAGG + Intergenic
1139396172 16:66640915-66640937 TCTGAAGGCTTGCCTGGGGCTGG - Intronic
1141315957 16:82962637-82962659 TCTGAACCCCTGGCCAGGGCAGG + Intronic
1141569551 16:84925909-84925931 TCTGCGGGCCTGGCCTGTGCTGG + Intergenic
1141698132 16:85630034-85630056 TCAGAAGGCCAGCCTGGGGCTGG + Intronic
1142071983 16:88095905-88095927 TTTGAAGGCCTGACTGGGGCTGG - Intronic
1142074383 16:88108880-88108902 TCTGAAGTCCCGACCGGGGCTGG - Intronic
1142090192 16:88205966-88205988 TCTTCAGGCCTGTCATGGGCTGG - Intergenic
1142134366 16:88444835-88444857 TTTCCAGGCCTGCCCTGGCCTGG + Intergenic
1203077787 16_KI270728v1_random:1130987-1131009 TGTGAAGGCCTGGCTGGGGCAGG + Intergenic
1142474811 17:182461-182483 TCTGAAGGACCCCCCGGGGCAGG + Intergenic
1143024456 17:3933337-3933359 CCAGAAGGTCTGCACTGGGCAGG - Intronic
1143374875 17:6461586-6461608 TCAGGTGGCCTGCACTGGGCAGG - Intronic
1143423433 17:6814093-6814115 TCTGAAGGCTTGACCCGGGTGGG - Intronic
1143682696 17:8489190-8489212 TTCGAAGGCCTGACCAGGGCTGG - Intronic
1143858361 17:9869553-9869575 TCTGAAGGCTTGGCTGGGGCTGG + Intronic
1144037493 17:11380786-11380808 TCTGAAGGCTTGACTAGGGCTGG + Intronic
1144062460 17:11596099-11596121 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1144344749 17:14339768-14339790 TCTGGAGGCCAGCCTGGGGCTGG + Intronic
1144473529 17:15564612-15564634 ACTGAAAACCTGCCATGGGCAGG - Intergenic
1144704914 17:17362064-17362086 TCTGAGGGCCTGGCGTGGGGAGG + Intergenic
1144830929 17:18130939-18130961 TCCAAAGGCCTGTCCTAGGCAGG + Intronic
1144922993 17:18780199-18780221 ACTGAAAACCTGCCATGGGCAGG + Intergenic
1145907096 17:28522234-28522256 GCTGAGGGTCTGCTCTGGGCTGG - Intronic
1146563154 17:33888966-33888988 TCTTAAGGCCAGGCCTGGGGAGG - Intronic
1146596926 17:34177400-34177422 TCTGAAGGCCTGTCCAGCCCTGG + Intergenic
1146930790 17:36776502-36776524 TCTGAAGACATGACGTGGGCAGG + Intergenic
1146945065 17:36867949-36867971 TCTGAAGGCCTGACCAGGGCTGG - Intergenic
1147429164 17:40361308-40361330 TCTGAAGCCCTGCCCCTGTCAGG - Intronic
1148152392 17:45404452-45404474 TCTGGAGGGCTGGCCTGGGCTGG + Exonic
1148650239 17:49245091-49245113 TCTCAAGGCCTGACCAGGGCTGG - Intergenic
1150327737 17:64270111-64270133 TCAGAAGAGATGCCCTGGGCTGG + Intergenic
1150327973 17:64272048-64272070 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1150849909 17:68694736-68694758 CCTGTAGACCTGTCCTGGGCAGG - Intergenic
1151578307 17:74963716-74963738 TCTGTGGGCCTGGCCAGGGCTGG - Intronic
1151721826 17:75861264-75861286 TCTGAAGAGCGGGCCTGGGCCGG + Intergenic
1151733239 17:75923213-75923235 TCTGAGGGCCTGCATTTGGCGGG - Exonic
1151913653 17:77101658-77101680 TCTGTGGGTCTGGCCTGGGCTGG + Intronic
1151930448 17:77228654-77228676 ACTGGAGGCCTGGCCTGGGCGGG - Intergenic
1152101846 17:78306067-78306089 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1152133781 17:78492378-78492400 ACTGCAGGCCTGCCCCGAGCAGG - Intronic
1152178156 17:78801269-78801291 TCAGAAGTACTGCCCTGGCCGGG - Intronic
1152365488 17:79853972-79853994 TCTAAATGCCTCCTCTGGGCTGG - Intergenic
1152392300 17:80010100-80010122 CCCCAAGGCCTGACCTGGGCAGG - Intronic
1152626028 17:81388382-81388404 GCTGCAGGCCCTCCCTGGGCTGG - Intergenic
1153839860 18:8996986-8997008 TCTGAAGGCTTGACAGGGGCAGG - Intergenic
1154198526 18:12283280-12283302 TCTGAAGGCCTTCAATGGACTGG - Intergenic
1154236578 18:12611500-12611522 TCTGAAGGCTTGACCTGAGCTGG - Intronic
1155210033 18:23592706-23592728 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1155309381 18:24509267-24509289 CTTGCAGGGCTGCCCTGGGCAGG - Intergenic
1156701044 18:39825284-39825306 TCTTAAGCCCTGCCCTTGCCTGG + Intergenic
1157573173 18:48726473-48726495 TCTGAAGGCATGACTGGGGCTGG + Intronic
1158447733 18:57535821-57535843 TCTGAGGGCCTGCTCTGCACAGG + Intergenic
1160517862 18:79488423-79488445 TCTGAGGGACAGCCCTGGGGAGG - Intronic
1160740408 19:682972-682994 TCTGCAGGCCTGGCCGGGGCAGG - Exonic
1160745901 19:710474-710496 TCTGACAGCCAGGCCTGGGCAGG + Intronic
1160823737 19:1069738-1069760 CTTGGAGGCCTGGCCTGGGCGGG + Intronic
1161152191 19:2715518-2715540 TCTGAAGGCCTGATCGGGGAAGG - Exonic
1161161675 19:2765157-2765179 GCTCAGGGCCTGCCCAGGGCAGG - Intronic
1161653998 19:5502245-5502267 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1161950502 19:7465081-7465103 TCTGACCCCCTGACCTGGGCAGG - Intronic
1162203990 19:9041919-9041941 TCTGAAGGCTTGATGTGGGCTGG + Intergenic
1163689298 19:18730115-18730137 TCTGATGGCTTACCCTGGGAAGG + Intronic
1163860977 19:19742694-19742716 GCTGAGGGCCTGTGCTGGGCCGG - Intergenic
1164201248 19:23020652-23020674 TCACAAGGCCTCCCGTGGGCAGG + Intergenic
1164244949 19:23420708-23420730 TCAGATGGCCTGGCCTGGCCTGG + Intergenic
1165262840 19:34635755-34635777 GGAGAAGGCCTGACCTGGGCAGG + Intronic
1165299094 19:34956794-34956816 TCTGAAGGCCAGTGCTGTGCTGG - Exonic
1165733612 19:38162270-38162292 GCTGAGAGCCTGGCCTGGGCAGG - Exonic
1166231495 19:41427668-41427690 GCTGAAGGCTGGGCCTGGGCTGG + Intronic
1166789665 19:45391366-45391388 GCTGAAGGAATGCCCGGGGCAGG + Intronic
1166796658 19:45430185-45430207 TCCCAAGGCCTGTCCTGTGCTGG - Intronic
925184150 2:1835834-1835856 GCTGGAGCCCTGCCATGGGCTGG - Intronic
925425325 2:3744460-3744482 TGTGAAGGACTGCCCTGGGAGGG + Intronic
926574768 2:14567757-14567779 TCTGAAGGGCTGACCCTGGCAGG - Intergenic
928279386 2:29930712-29930734 TCTGAAGGCTTGCCTGGGGCTGG - Intergenic
932102980 2:68917781-68917803 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
932790742 2:74652835-74652857 ACTGAAGGCTTGCCTGGGGCTGG - Intergenic
933419637 2:82029307-82029329 TAAGAAGCCCTGCCCTAGGCAGG + Intergenic
933769902 2:85736854-85736876 TCAGAAGGCTTGCCTGGGGCTGG - Intergenic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
934652615 2:96101035-96101057 TCAGAAGGTCTGTCCTGGGGTGG - Intergenic
934974112 2:98788349-98788371 TCTGAAGGCTTGACAGGGGCTGG + Intergenic
935975148 2:108570809-108570831 TCTGCAGTCCTGCCCTGGAGGGG + Intronic
936992478 2:118380818-118380840 CCTGATGGCCTATCCTGGGCAGG + Intergenic
936992797 2:118383876-118383898 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
939028261 2:137040006-137040028 TCTGAAAGCCTGGCCTGAGCAGG - Intronic
940048621 2:149437197-149437219 TCTGAAAGTCTGCCCTGTACAGG + Intronic
940693947 2:156955924-156955946 TCTGAAGGGCAGGCCTGGACAGG + Intergenic
940879235 2:158929813-158929835 TCTGAAGGTTTGCCTAGGGCTGG + Intergenic
941625407 2:167825658-167825680 TCTGAACAACTGCCCTGGGTGGG - Intergenic
942069267 2:172300818-172300840 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
942169293 2:173274207-173274229 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
942444044 2:176066727-176066749 TCTGAGAGCCTGCCCCGGGAAGG - Intergenic
943724462 2:191238608-191238630 CCTGAAGGTTTACCCTGGGCAGG - Intergenic
945397392 2:209336766-209336788 TCAGAAGGCAAGGCCTGGGCTGG - Intergenic
946111705 2:217425368-217425390 TCTGAAGGTCTGACTGGGGCTGG + Intronic
946184913 2:217975210-217975232 TCTCAAGGCCTGACTGGGGCTGG - Intronic
946186263 2:217982236-217982258 TCTGAAAGCCTGACTGGGGCTGG - Intronic
946898959 2:224354415-224354437 TCTGCAGACCTCCTCTGGGCCGG - Intergenic
946924743 2:224615659-224615681 TGTGAAGGCCTGCCCAGGGAGGG - Intergenic
947082842 2:226418516-226418538 GCAGGAGTCCTGCCCTGGGCAGG + Intergenic
948302080 2:236915027-236915049 GCTGCAGTCCTGCCCTGGGTAGG - Intergenic
948384885 2:237575173-237575195 TCTGCAGGGCTGTGCTGGGCTGG - Intronic
948439650 2:237978540-237978562 TCTGGAGGCCTCCCCATGGCCGG - Intronic
948632062 2:239308685-239308707 GCTGAACCCCTGCACTGGGCTGG - Intronic
948984190 2:241509812-241509834 ACTGAGCGCCTGCCGTGGGCTGG - Intergenic
1168769206 20:403821-403843 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1168813654 20:722211-722233 TCTGAAGGCTTGCCTGGGGCTGG - Intergenic
1168840393 20:906339-906361 TCTGAAGGCTTGACCTGGGCTGG - Intronic
1169001726 20:2172833-2172855 TCTGAAGACCCTGCCTGGGCAGG - Intronic
1169215138 20:3789193-3789215 CCTGAAGGACAGCTCTGGGCAGG - Intronic
1169347532 20:4840329-4840351 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1169349220 20:4854696-4854718 TCTGAAGCCCCTCCTTGGGCCGG - Exonic
1169442134 20:5641390-5641412 TCTGAAGGCTTGCCTGGGGCTGG + Intergenic
1170034472 20:11975608-11975630 TCTGAAGGTTTGACTTGGGCTGG + Intergenic
1170586245 20:17736286-17736308 TCTGAAGGCTGGACCAGGGCTGG + Intergenic
1170638915 20:18134484-18134506 TCTGAAGGCCAGCCAATGGCAGG + Intergenic
1171424235 20:25039622-25039644 TGGGGAGGCATGCCCTGGGCAGG - Intronic
1172035402 20:32007215-32007237 TATCAATGCCTGCCATGGGCAGG - Intergenic
1172116573 20:32576738-32576760 GCTGCAGGCCTGGCCTGGGCGGG - Intronic
1172240119 20:33407630-33407652 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1172383540 20:34516501-34516523 ACTGAAGGCCTGGCGTGGGGTGG - Intronic
1172634908 20:36403818-36403840 TCTGAAGGCTTGACTTGGGCTGG + Intronic
1173162741 20:40664381-40664403 CCTGATGGCCTGGCCTGGCCTGG + Intergenic
1173293604 20:41735628-41735650 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1173868566 20:46328369-46328391 CCTGCCGGCCCGCCCTGGGCTGG + Intergenic
1174678551 20:52381655-52381677 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1175154747 20:56962913-56962935 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1175401037 20:58699997-58700019 TCTGAGGGCTTGCCTGGGGCTGG + Intronic
1175892150 20:62320685-62320707 GGTGAAGGCCTGCACTGGCCCGG + Intronic
1175901440 20:62361412-62361434 TCTGCAGGCCTGGCCCGGGCTGG - Intronic
1175952229 20:62589544-62589566 TTTGAGGGCCTGGCCTGGGGAGG + Intergenic
1176038919 20:63054269-63054291 TCTGAAAGCAAGCTCTGGGCAGG + Intergenic
1176047993 20:63102625-63102647 TCGGAAGCCCCGCCCTGGGGAGG - Intergenic
1176086211 20:63296712-63296734 TCTGAAGGCCAGCTGTGAGCAGG - Intronic
1176220665 20:63968018-63968040 CCTGGAGCCCTGCCCTTGGCAGG + Intronic
1177132994 21:17279856-17279878 TCTCTGGACCTGCCCTGGGCTGG + Intergenic
1178981816 21:37270687-37270709 TCTGAAGGCCTGTTGTCGGCTGG + Intergenic
1179026033 21:37679169-37679191 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1179539588 21:42075487-42075509 ACTGAAGGCCTGCTGTGGCCAGG - Intronic
1180046705 21:45309743-45309765 TCTGCATCCCTGCCCTGGCCAGG + Intergenic
1180089828 21:45528217-45528239 TCTGGATGCCAGCGCTGGGCAGG + Intronic
1180091117 21:45534288-45534310 TCTGCAGGGGTTCCCTGGGCTGG - Intronic
1180393077 22:12303034-12303056 TCTGAAGCCATGGCCTGAGCTGG - Intergenic
1181040043 22:20187823-20187845 TCCAAACACCTGCCCTGGGCAGG - Intergenic
1181054995 22:20256664-20256686 CCTGCAGGCCTGGCCTGGGAGGG - Intronic
1181945793 22:26516593-26516615 TCTGAAGGCTTGACCAGGGCTGG + Intergenic
1181952519 22:26564657-26564679 CCTGAAGCCTTGCCTTGGGCCGG + Intronic
1182093807 22:27613227-27613249 TGTAAAGCTCTGCCCTGGGCAGG + Intergenic
1182278033 22:29202592-29202614 TCCCATGGCCTGCCCTGGGAGGG + Intergenic
1182283433 22:29231104-29231126 TCTCCGGGGCTGCCCTGGGCAGG - Exonic
1182352224 22:29705405-29705427 TCTGAATGCCTGCTCTGGCCAGG + Intergenic
1182431716 22:30302696-30302718 TCTGGAGGCCTCAGCTGGGCAGG + Intronic
1182995646 22:34809560-34809582 TCCCCAGGCCTGCCCTTGGCAGG + Intergenic
1182995735 22:34810242-34810264 TCCCCAGGCCTGCCCTTGGCAGG + Intergenic
1183378775 22:37480328-37480350 TCTGAAGGGGGGACCTGGGCAGG - Intronic
1183679997 22:39322616-39322638 ACTGGAGGCCTGCTCTGTGCCGG + Intergenic
1183706401 22:39477289-39477311 TCTGCAGGCCTCGGCTGGGCCGG + Intronic
1183706992 22:39480339-39480361 GCTTAGGGCCTTCCCTGGGCTGG - Intronic
1184219786 22:43092401-43092423 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1184387561 22:44185063-44185085 GCTGAGAGCCTGCCCTGTGCTGG + Intronic
1184389174 22:44192997-44193019 TCTGAAGGCTTGGCTGGGGCTGG + Intronic
1184406870 22:44305391-44305413 GCTGAGGGCCAGCCCTGGCCAGG - Intronic
1184473848 22:44710360-44710382 TGTGAGGCCCTGCCCTGGGAGGG + Intronic
1185088625 22:48753877-48753899 TCTGAAGGCCAGCACTGAACGGG - Intronic
1185102997 22:48851607-48851629 CCTGAAACCCTCCCCTGGGCTGG - Intergenic
1185124290 22:48997772-48997794 CCTAAAGACCTGCCTTGGGCCGG + Intergenic
1185127387 22:49018705-49018727 TCCGCAGGGCAGCCCTGGGCCGG - Intergenic
1185408766 22:50672242-50672264 CCTGCAAGCCTGCCCTCGGCTGG - Intergenic
950657382 3:14444987-14445009 TCCCCAGGCCTGCCCAGGGCAGG - Intronic
950767750 3:15286108-15286130 TCTGATAGCCTGCTCTGGCCAGG - Intronic
950799840 3:15541535-15541557 TCTGGAGGACAGCACTGGGCTGG - Intergenic
952827471 3:37536315-37536337 CTGGAAGGCCTGCCCAGGGCTGG - Intronic
953130336 3:40132107-40132129 TCTGAATGCCTTCCCAGAGCTGG + Intronic
953530495 3:43735909-43735931 TCTGAAGGCGTGACCAGGCCTGG - Intergenic
953785106 3:45905629-45905651 TGGGAAGGCCTGGCTTGGGCAGG - Intronic
954397905 3:50302756-50302778 GCGGAAGGTCTGCCCTGGGTTGG + Exonic
954454922 3:50592651-50592673 TCTGAAGGGCTGGGCTGGCCTGG - Intergenic
954688274 3:52382398-52382420 TCTGTAGGCCCGCCTTGAGCAGG - Exonic
954836609 3:53474814-53474836 CCTGTAGGGCTGCCCTGGCCAGG + Intergenic
954915081 3:54142036-54142058 CCTGAAGACCTGCTCTGGTCTGG + Intronic
955325592 3:58007620-58007642 TGTGAAAGCCTGCAATGGGCTGG - Intergenic
956486584 3:69729350-69729372 TCTGAAGGCCTGACTAGGGCTGG + Intergenic
956699221 3:71944107-71944129 TCTGAAGGCCTAATCAGGGCTGG + Intergenic
956717296 3:72089498-72089520 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
959108801 3:102097138-102097160 GATGAATGCCTTCCCTGGGCTGG + Intergenic
961210504 3:125121422-125121444 TGTGATGGGCTGCCCTGGTCAGG + Intronic
961220479 3:125195269-125195291 TCAGAATGCCTGGGCTGGGCAGG - Intronic
961605010 3:128087114-128087136 TTTGGAGGCCGCCCCTGGGCAGG - Intronic
961712160 3:128836029-128836051 CCTGAAGGTCAGCCCTGGGCAGG - Intergenic
964154848 3:153572792-153572814 TCTGATGACCTGCTCTGGGCAGG - Intergenic
965382147 3:168003081-168003103 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
965669917 3:171136658-171136680 TCTGAACACCTGCCATGGTCAGG + Intronic
966692078 3:182752283-182752305 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
968285365 3:197505479-197505501 TCTGAGGGGCAGCCCTGTGCCGG - Intergenic
968884142 4:3318277-3318299 TCTGATGGCTGGTCCTGGGCAGG + Intronic
968884744 4:3321751-3321773 TCTGAGGCCCAGGCCTGGGCAGG + Intronic
969061729 4:4440963-4440985 TCTGAAGGGCTGACCAGGGCTGG + Intronic
969353429 4:6611327-6611349 TCCCAAGGCCCGCCCTGGCCTGG - Intronic
969457817 4:7310168-7310190 TCTGGAGTCCTGCCCTGGCTGGG + Intronic
971233329 4:24818601-24818623 TCTGAAGGCTTGACTAGGGCTGG + Intronic
971396860 4:26236472-26236494 TCTGAAAGCCTGACTGGGGCTGG + Intronic
973222897 4:47749494-47749516 TCTGAAGGCTTGACCTGGGAAGG - Intronic
975296497 4:72740486-72740508 TCTGAAGGCTTGAATTGGGCTGG - Intergenic
975566021 4:75754987-75755009 TCTGAAGGCTTGACTGGGGCTGG + Intronic
976983982 4:91269157-91269179 ATTGAAGGCATGCCTTGGGCAGG + Intronic
977317357 4:95467100-95467122 TCTGAAAGCTTGACCAGGGCTGG - Intronic
978770101 4:112447115-112447137 TCTGAAGGCTTCCCCAGGACTGG + Intergenic
979225153 4:118276397-118276419 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
980067027 4:128201015-128201037 TCTGAAGACTTGGCCTGGGCTGG + Intronic
981005793 4:139873750-139873772 TCTGAAGGCTTGACTGGGGCTGG - Intronic
982546054 4:156734479-156734501 TCTGTAAGAGTGCCCTGGGCCGG - Intergenic
982546384 4:156738212-156738234 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
982858309 4:160414101-160414123 TCTGAAGACCTGCTCTCTGCAGG - Intergenic
982938570 4:161518887-161518909 TCTGAAGGCTTGTCCTGTGCTGG + Intronic
983521290 4:168711738-168711760 TTTGAAGGGCTGCCCTGCTCAGG - Exonic
983979590 4:173977823-173977845 TCTGAAGGCTTGGCTGGGGCTGG - Intergenic
984557028 4:181226630-181226652 TCTTAAGTCCTGCTCTGGTCAGG + Intergenic
984764576 4:183389967-183389989 TCAGAATGCCTGCCCCGGGTTGG - Intergenic
984850628 4:184149536-184149558 TCTGAAGGCCTGCCCTGGGCAGG + Intronic
985034022 4:185820488-185820510 TCTGAAGGCCAGCCCTGCCCTGG - Intronic
985823708 5:2178196-2178218 TCTGAAGGCCTTCAAAGGGCTGG - Intergenic
985958473 5:3281961-3281983 ACTGTCGGCCTGTCCTGGGCAGG - Intergenic
986304772 5:6506990-6507012 TCTGCTGGCCTGGGCTGGGCTGG - Intergenic
986763357 5:10900029-10900051 TTTGAAGGCCTACTCTGTGCCGG + Intergenic
987111377 5:14690472-14690494 TCTGAAGGCTTGACTGGGGCTGG + Intronic
987444727 5:18003721-18003743 TCTGAATGCTTGCCTAGGGCTGG + Intergenic
988947551 5:36221290-36221312 TCTGAAGGCTTGACTTGGGCTGG - Intronic
988973782 5:36495246-36495268 TCTCAAAGGCAGCCCTGGGCTGG - Intergenic
989534464 5:42548094-42548116 ACTGAAGGCCAGGCCTAGGCTGG - Intronic
991045192 5:62215062-62215084 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
992070507 5:73144389-73144411 TCTGAAGGCATGACTGGGGCTGG + Intergenic
992088329 5:73297667-73297689 TCTGAACACCTACCCCGGGCTGG - Intergenic
992357307 5:75999455-75999477 TCTCAGGGTCTGCCATGGGCAGG + Intergenic
992468576 5:77031008-77031030 TTCGAAGGCCTCGCCTGGGCTGG - Intronic
995555404 5:113323148-113323170 TCTGAAGGCCTGACCAAGGCTGG - Intronic
995805900 5:116052020-116052042 CCTGAAGGGCTGCCCTGGCCAGG + Intronic
997696670 5:135866504-135866526 TCAGAAGGGCTGAGCTGGGCTGG - Intronic
998014457 5:138721207-138721229 TCTGAAGGCTTGACTGGGGCTGG + Intronic
998038501 5:138936268-138936290 TCTGAAGGCTTGACCTGGCGAGG + Intergenic
998567742 5:143231227-143231249 GCTGCATGCCAGCCCTGGGCTGG - Intergenic
999254907 5:150204813-150204835 TCTGAATGCCTGCACAGGGGAGG - Exonic
1000196213 5:158960905-158960927 TCTGAAGGCTCGACCGGGGCTGG - Intronic
1000218976 5:159193296-159193318 TCAGAGGACCTACCCTGGGCAGG + Intronic
1001562241 5:172677344-172677366 TCTGAAGGCCTGTTCTATGCAGG + Intronic
1002069662 5:176671829-176671851 TGGGAAGTCCTTCCCTGGGCTGG - Intergenic
1002122879 5:177019338-177019360 TGTAAAGCACTGCCCTGGGCTGG + Intronic
1002284130 5:178151046-178151068 TTTTAAGTGCTGCCCTGGGCTGG + Intronic
1002594176 5:180311596-180311618 ACTGTATGCCTGCCCTGTGCTGG + Intronic
1003008006 6:2399335-2399357 TCTGAAGGCCTGACTGGGGCTGG + Intergenic
1003137080 6:3441846-3441868 TCAGAACATCTGCCCTGGGCTGG - Intronic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1003593495 6:7455249-7455271 TCTGAAAGCCTGGCTAGGGCTGG - Intergenic
1005139606 6:22613232-22613254 CCTGGAGGGATGCCCTGGGCAGG - Intergenic
1006847814 6:37075020-37075042 TCTGTAGGCCTTTCATGGGCTGG - Intergenic
1007031485 6:38631698-38631720 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1007767640 6:44170380-44170402 TCTGAAGGCTCGCCTGGGGCTGG + Intronic
1008223039 6:48877414-48877436 TAAGAAGCCCTGCCCTAGGCAGG + Intergenic
1008913430 6:56761198-56761220 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1011797023 6:90967572-90967594 TCTGAAGGCTTGACAGGGGCTGG + Intergenic
1012064896 6:94537642-94537664 TCTGAAGCCATGACCTGAGCTGG + Intergenic
1015191551 6:130477266-130477288 TCTGATGGGCTGCCCTTGGTGGG - Intergenic
1017084095 6:150697557-150697579 GCTGAGGGCCGGCCCTGGGAGGG + Intronic
1017484419 6:154889723-154889745 GCTGCAGGTCTGCCCTGGGGAGG + Intronic
1017718994 6:157232147-157232169 TCTGAGGGCCTGGCCAGAGCTGG + Intergenic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1019401364 7:855904-855926 TCTGTCTGCCTGCCCTGGGCCGG + Intronic
1019550211 7:1598474-1598496 TCTGCAGGACTGGCCAGGGCAGG + Intergenic
1019556758 7:1635579-1635601 TCTGAAGGCTTGACTGGGGCAGG + Intergenic
1019664780 7:2246378-2246400 TCTGAGGGCCTGACGTTGGCTGG + Intronic
1019835106 7:3375748-3375770 TCTGAAGGCTTCCCTGGGGCTGG - Intronic
1020253766 7:6489869-6489891 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1020474317 7:8577938-8577960 TCTGAAGGCTTGCATAGGGCTGG - Intronic
1022484482 7:30767761-30767783 GCAAAAGGCCTGCCCTGGACAGG + Intronic
1022645843 7:32227959-32227981 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1022688228 7:32616803-32616825 TCTGAAGGCTTGCCCAGGGCTGG + Intergenic
1023877396 7:44294413-44294435 TCTGCATGCCTGTTCTGGGCTGG - Intronic
1026659569 7:72288149-72288171 TCAGAAGGCCTGACCGGGGCTGG + Intronic
1026853306 7:73737948-73737970 TCTGAAGGGCTGGCCTGGCTGGG + Intronic
1027171213 7:75874072-75874094 CCTGAAGGCCTACTCTGTGCAGG + Intronic
1027187926 7:75982782-75982804 TCTGTAGGCCTGCCCCAGCCTGG + Intronic
1027564132 7:79768523-79768545 TCTCAAGGCCTGTCGTGGGGTGG + Intergenic
1029098453 7:98107372-98107394 TCGGAGGGCCTGCCGGGGGCGGG + Intronic
1029465823 7:100723945-100723967 ACTGCAGCCTTGCCCTGGGCAGG - Intergenic
1029483410 7:100825974-100825996 TGGGCAGGACTGCCCTGGGCTGG - Intronic
1029646096 7:101857003-101857025 TCTGAAGTCCTGCCCAGCTCCGG + Intronic
1029715001 7:102320830-102320852 TCTTAAGCCCTGCACTGGGGAGG + Intronic
1030130125 7:106192857-106192879 TCTGAAGGCATAACCGGGGCTGG + Intergenic
1032435784 7:131899339-131899361 TCTGAAGGCTTGACCAGGGCTGG - Intergenic
1033077303 7:138261695-138261717 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1033432186 7:141299517-141299539 TCTGCAGGCCTCCCTTGGCCAGG + Intronic
1034125967 7:148671894-148671916 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1034214683 7:149396172-149396194 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1034253871 7:149714205-149714227 TTCGAAGGCCTGGTCTGGGCGGG - Intergenic
1034526456 7:151666631-151666653 TCTGAAGGCTTGACTGGGGCTGG + Intronic
1034629737 7:152521794-152521816 TCTGAAGGCTCGTCTTGGGCTGG + Intergenic
1034885582 7:154795928-154795950 TCTGAGGGCCAGCCCTGGGGTGG - Intronic
1035045167 7:155960936-155960958 CCTGAAGGCCAGCTCAGGGCAGG - Intergenic
1035664271 8:1369299-1369321 TCCCAAGGCCTCCCCTTGGCTGG + Intergenic
1036212343 8:6852625-6852647 GCTGCAGTCCTGCCCTGGGATGG - Intergenic
1036791241 8:11721691-11721713 TCTGGAGCCCTGCCCTGGGAAGG + Intronic
1036939490 8:13037862-13037884 TCTGAAGGCCTGATTGGGGCTGG + Intergenic
1037496636 8:19447071-19447093 TCTGCACGCCTGCCCTGTGGAGG + Intronic
1037640326 8:20736459-20736481 TCAGAAGCCCTGCGCTGGCCTGG + Intergenic
1037920232 8:22800753-22800775 TCTGCAGCCCCTCCCTGGGCAGG - Intronic
1038271728 8:26081126-26081148 TCTGGAGGCTTTCCCTGGGTTGG - Intergenic
1038574250 8:28690620-28690642 TCTGAAGGCTTGACTGGGGCTGG + Intronic
1039580221 8:38659749-38659771 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1039785968 8:40834392-40834414 TCTGAAGCCTTGGGCTGGGCTGG - Intronic
1039840115 8:41286975-41286997 CCTGGAGGCCTGCACTGGGCAGG - Intronic
1040060846 8:43101633-43101655 TCTGAAGGTCTGCCCTGTTTGGG + Intronic
1042595200 8:70439840-70439862 TCAGAGGGCCTGCCGTGTGCTGG + Intergenic
1042675393 8:71315395-71315417 TCTGTAGCTCTGCTCTGGGCAGG + Intronic
1043410777 8:79992112-79992134 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1045060028 8:98403193-98403215 TCTAAACGCCTACCCTGAGCTGG - Intronic
1045076751 8:98577650-98577672 TCTGAAGGCTTGACAAGGGCTGG - Intronic
1045712711 8:105004262-105004284 TCTGAAGGCTTGACTAGGGCTGG + Intronic
1045794359 8:106025064-106025086 TCTGATGGGCTGCCCTTGGTGGG - Intergenic
1046820681 8:118631263-118631285 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1047138337 8:122106960-122106982 TTTCTAGACCTGCCCTGGGCCGG - Intergenic
1047175899 8:122540082-122540104 TCTGAAGACTTGCCTGGGGCAGG - Intergenic
1047354742 8:124109718-124109740 ACAGAAAGCCTCCCCTGGGCAGG + Intronic
1047933051 8:129749662-129749684 TCTGAAGGGCTTCCCAGGGCAGG - Intronic
1048571711 8:135662338-135662360 TCTGAAGGCTTGGCTGGGGCTGG + Intergenic
1048601962 8:135928220-135928242 TCTGAAGGCAGACCCTGGTCTGG + Intergenic
1049432007 8:142569537-142569559 TGAGCAGGCCTGCCATGGGCAGG - Intergenic
1049565396 8:143335375-143335397 TCTGAGGGGCTGCTGTGGGCTGG - Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049690841 8:143958189-143958211 TCTGGAGGCCACCCCTGCGCAGG + Intronic
1049776433 8:144407995-144408017 TCTGAAGGCTTGACGAGGGCTGG - Intronic
1049877028 8:145030775-145030797 TAAGAAGCCCTGCCCTAGGCAGG + Intergenic
1050001885 9:1085743-1085765 TCTAAAGGCCTGCCCCAGGATGG + Intergenic
1050428764 9:5539774-5539796 CCTGAAGGCCTGGGCAGGGCAGG + Intronic
1053020001 9:34688163-34688185 TTTCAAGGCCTGCCCAGGCCTGG + Intergenic
1056670616 9:88624826-88624848 TCTGAAGGCTTGACTAGGGCTGG - Intergenic
1056925150 9:90828244-90828266 TGTGAAGGCCTGGGCGGGGCGGG - Intronic
1057516072 9:95722490-95722512 CAGGAAGGCCTGCTCTGGGCTGG + Intergenic
1057753414 9:97810295-97810317 TCTGGAGGTCCCCCCTGGGCTGG + Intergenic
1057787179 9:98096026-98096048 TCTGAAGCTCTGTCCTGGCCAGG + Intronic
1057957201 9:99420112-99420134 TCTGAAGGCTTGTCTTGGGCTGG - Intergenic
1058535877 9:105959524-105959546 TCTGAAGTGGTGCACTGGGCGGG - Intergenic
1059230977 9:112721330-112721352 TCTGAAGGCCTGCCTGGGGCTGG - Intergenic
1059547714 9:115195058-115195080 TCTGAAGGCTTGACTGGGGCTGG - Intronic
1059573246 9:115463017-115463039 TCTGAAGCCCTTCCATGGTCTGG - Intergenic
1059587608 9:115622657-115622679 TCTGAAGGCTTGACTGGGGCTGG - Intergenic
1060101964 9:120848582-120848604 TCTGCAGGGCTGTCCTGGGGTGG + Intergenic
1060367216 9:123029487-123029509 CCAGAAGGGCTGCCCTGGCCAGG + Intronic
1060494078 9:124105256-124105278 GATGAAGGCCTGACCGGGGCAGG - Intergenic
1060835345 9:126751484-126751506 TCTGGAGCTCTGCACTGGGCGGG + Intergenic
1061056757 9:128226926-128226948 TCTGAAGGACTTCCCTATGCTGG + Intronic
1061079846 9:128363438-128363460 TCTAAAGGCCTACCCTGTGCAGG + Intergenic
1061451069 9:130667188-130667210 CCTCAAGGCCAGTCCTGGGCTGG + Intronic
1061513697 9:131076284-131076306 TCAGAGGAGCTGCCCTGGGCTGG - Intronic
1062050086 9:134442702-134442724 CCAGAGGGACTGCCCTGGGCAGG - Intergenic
1062220195 9:135410921-135410943 ACTGAAAGCCTACCCAGGGCAGG + Intergenic
1062238711 9:135524742-135524764 TCTGGAGGCCTGAGCTGGGCTGG - Intronic
1062253287 9:135608857-135608879 TCAGCAGGCCTGCCACGGGCTGG + Intergenic
1062267196 9:135692593-135692615 TAGGAGGGCCTGCCGTGGGCAGG - Intergenic
1062393280 9:136342517-136342539 GCTGCCGGGCTGCCCTGGGCGGG - Intronic
1062474051 9:136718936-136718958 CCCGGAGGCCTCCCCTGGGCTGG - Intronic
1062591614 9:137277154-137277176 TGTGCTGGCCTGTCCTGGGCAGG + Intergenic
1062729701 9:138102062-138102084 GCAGCAGCCCTGCCCTGGGCTGG + Intronic
1186162992 X:6797645-6797667 TTTGAAGGCTTGACCAGGGCAGG - Intergenic
1186310519 X:8312846-8312868 TCTGAAGGCTTGGCCAGGGAAGG + Intergenic
1186838627 X:13463072-13463094 TCTGAAGGCTTGACCGGGGCTGG - Intergenic
1187550254 X:20295591-20295613 TCTGAAGGTTTGACCGGGGCTGG - Intergenic
1188771902 X:34163152-34163174 TGTGAAGGCTTGCCCTGTGGGGG + Intergenic
1189296865 X:39924661-39924683 TCTGAAGGCTTGACCAGGGCTGG - Intergenic
1189555615 X:42142242-42142264 CCTCAAGGCCTGCCCTGCCCTGG + Intergenic
1189684465 X:43549566-43549588 TCTGAAGGCTTGACGGGGGCTGG - Intergenic
1190098142 X:47499287-47499309 TCTCAAGGTTTGCCCTTGGCTGG + Intergenic
1190237299 X:48626301-48626323 TCTGAAGGCTTGACTGGGGCTGG + Intergenic
1192874300 X:75211593-75211615 TCTGGAGGTCAGCCCAGGGCTGG + Intergenic
1193055501 X:77145177-77145199 TCTGATGGGCTTCCCTGTGCAGG - Intergenic
1194476903 X:94369574-94369596 TCTCTGGACCTGCCCTGGGCCGG + Intergenic
1195738107 X:108034105-108034127 TCAGAAGGGCTGAACTGGGCAGG + Intergenic
1196495374 X:116318277-116318299 TTTGTAGACCTGCCCTGGGCTGG + Intergenic
1199974701 X:152886400-152886422 TCAGAAGGGCTGCCATGGGGAGG + Intergenic
1200104546 X:153705179-153705201 TGTGAAGGCCTGGCTGGGGCAGG - Intronic
1200873019 Y:8123753-8123775 TTAGAAGTCCTGCCCTAGGCAGG - Intergenic
1201353634 Y:13073483-13073505 TCTGAAGGCCTTCCCTTTGTGGG - Intergenic
1201863436 Y:18624465-18624487 TATGAATCCCTGCCCTAGGCAGG - Intergenic
1201869886 Y:18695913-18695935 TATGAATCCCTGCCCTAGGCAGG + Intergenic
1202113473 Y:21448509-21448531 TAAGAAGTCCTGCCCTGGGTAGG - Intergenic