ID: 984851200

View in Genome Browser
Species Human (GRCh38)
Location 4:184154088-184154110
Sequence GAGGGTGCAGAGAGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 554
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 507}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984851200 Original CRISPR GAGGGTGCAGAGAGGGCTCT GGG (reversed) Intronic
900384352 1:2402757-2402779 TTGGCTGCAGAGAGGGCCCTGGG + Intronic
900737432 1:4308010-4308032 GTGACAGCAGAGAGGGCTCTGGG - Intergenic
900884979 1:5408676-5408698 GAGGGTGCATGGAGGGCACATGG + Intergenic
900973619 1:6004976-6004998 GAGGGTGCAGGCAGAGATCTGGG + Intronic
901105931 1:6756517-6756539 GAGGGTCCAGGGAGGGGTTTGGG + Intergenic
901167151 1:7229164-7229186 GAGGGGGCTGAGAGAGCTCTAGG + Intronic
901657910 1:10781157-10781179 GAGGGCGAGGAGGGGGCTCTGGG + Intronic
901852122 1:12022305-12022327 GAGGGTGCTGAGTGGGGTCTCGG - Exonic
903016774 1:20366637-20366659 GAGGGTGCTGGGAGCGCACTTGG - Intergenic
903069722 1:20721182-20721204 GAAGGTGCAGAGAGGGCAGGAGG - Intronic
903217774 1:21852647-21852669 GAGGAGGCAGAGAGGCCTCCGGG - Intronic
903660169 1:24972270-24972292 GAGTGAGCTCAGAGGGCTCTGGG - Intergenic
903660174 1:24972299-24972321 GAGAGAGCTCAGAGGGCTCTGGG - Intergenic
903674603 1:25055995-25056017 GAGCAGGCAGAGAGGGCTCCAGG + Intergenic
904400749 1:30254859-30254881 GAAGGAGCAGAGGGGGCTATAGG + Intergenic
904611607 1:31728929-31728951 AAGGATGCAGGGTGGGCTCTAGG - Intronic
904962039 1:34341018-34341040 GAGGGGGCAGAGAGCGGTGTGGG - Intergenic
905106134 1:35564623-35564645 GAGAGTGCAGAGTGGGCTCCTGG - Intronic
905879732 1:41455744-41455766 AGGGGTGGAGAGAGAGCTCTAGG - Intergenic
905968249 1:42117339-42117361 GAAGGGGCAGAGAGGGTTCAGGG + Intergenic
906110464 1:43318881-43318903 GCTGGTGGAGAGAGGTCTCTGGG + Intronic
906150646 1:43585559-43585581 CAGGGGGCAGGGAGAGCTCTAGG - Intronic
906276134 1:44517339-44517361 GAGGCTGGAGAGAGGGAACTGGG - Intronic
906717587 1:47981607-47981629 GAGGGTTCAGAGAGGTATATGGG - Intronic
906960784 1:50418565-50418587 CAGGGCGCAGAGAGAGCGCTGGG + Exonic
907328747 1:53657881-53657903 GAGGGTGCAGAGAAGGGGCAAGG - Intronic
907671505 1:56478069-56478091 CAGGGGTCAGAAAGGGCTCTTGG + Intergenic
910170806 1:84374806-84374828 GAGGATGCAGGGAGAGCACTGGG - Intronic
912323685 1:108738251-108738273 GAGGGTGCTGAAAGGGCAGTTGG + Intronic
912694754 1:111832877-111832899 GAGGGAGGAGAGATGGCTCCTGG - Intronic
912797018 1:112699582-112699604 GAGGGTACAGAGAGGTCACTGGG - Intronic
913076080 1:115341541-115341563 AAGGGTGCAGAGAGGGCCAGGGG + Intergenic
913531702 1:119738325-119738347 GAGGGGGCAGAGAGGCCTGGAGG - Intronic
913539085 1:119801774-119801796 CAAGGTGCAGAGAGGGTGCTAGG - Intronic
914247544 1:145897211-145897233 TAGGATGAAAAGAGGGCTCTAGG - Intronic
914717144 1:150262570-150262592 GAGGCTGCTGAGAGGCCTCAGGG + Exonic
915303272 1:154963394-154963416 GCGGGTGTTGAGAGGGGTCTGGG + Exonic
915446037 1:155975590-155975612 GAGGGAGCTGAGAGGGCTGACGG - Intronic
915486782 1:156226940-156226962 GAGGTTGCAGAGGAGGCTCCTGG + Intronic
915748179 1:158181198-158181220 GAGGGCGGAGAGAGGGAGCTGGG + Intronic
917523128 1:175764389-175764411 AAGGGTGAAAAGGGGGCTCTTGG - Intergenic
919091492 1:192983052-192983074 GAAGGGGCAGAGAGTGCCCTAGG - Intergenic
919116713 1:193288761-193288783 AATGGTGCAGAGAGTTCTCTGGG - Intergenic
919285065 1:195547103-195547125 GAGTGTGTGGACAGGGCTCTTGG - Intergenic
921148363 1:212380073-212380095 GAGAGTACACAGAGGCCTCTGGG + Intronic
922717518 1:227885137-227885159 GTGGGTGAAGAGAGGGGCCTTGG - Intergenic
923424132 1:233851740-233851762 GAGGATGAAGAAAGGGGTCTAGG - Intergenic
923767176 1:236902735-236902757 GTGGGTGTAGAGAGGGTGCTAGG - Exonic
924012088 1:239676490-239676512 CATGCTGCAGAGTGGGCTCTGGG - Intronic
924508883 1:244711979-244712001 GAGGGTGCAGAGATGCCATTAGG - Intergenic
1062808215 10:441039-441061 GAGGGTGCAGCTTGGCCTCTGGG - Intronic
1063079424 10:2751450-2751472 GAGAGGGCAGAGGAGGCTCTGGG + Intergenic
1063366366 10:5493305-5493327 GAGGTGGGAGAGAGGGTTCTGGG + Intergenic
1064095931 10:12424498-12424520 GAGGAGGCAGTGAGGGCTCAGGG - Intronic
1064365950 10:14708012-14708034 GAGGGTGGAGACAGAGCTCTGGG - Intronic
1064393050 10:14958000-14958022 GAGGGGGCATAGAGAGCTGTTGG + Intergenic
1067087542 10:43250819-43250841 GAAGGGGCAGAGAGGGCTGGAGG + Intronic
1067551359 10:47238620-47238642 GGTGGTGCAGAGTGGGCTCTGGG - Intergenic
1067696200 10:48537336-48537358 GAGGATGAGGAGAGGGCTCCAGG - Intronic
1068306269 10:55212363-55212385 GATGCTGCAGAGAGGGGTCCTGG - Intronic
1069777118 10:70933712-70933734 GAGGGAGCAGAGTGGGGCCTTGG - Intergenic
1069778153 10:70938693-70938715 GAGGGTACAGAGAGGCCACGAGG - Intergenic
1069871683 10:71536824-71536846 CAGGGTGCAGTGGGGTCTCTGGG + Intronic
1069875315 10:71559457-71559479 GAGGGTGAAGAGTGGGAGCTGGG + Intronic
1069875496 10:71560471-71560493 AAGGGTGGAGAGTGGGCTCAGGG - Intronic
1070732496 10:78841042-78841064 GGGTGAGCAGAGAGGGCTCAAGG + Intergenic
1070824812 10:79384992-79385014 AAGGGAGCAGAGAGGCCTCGTGG - Exonic
1070960006 10:80492020-80492042 GAGGGTGCCGGGCTGGCTCTGGG + Intronic
1071415251 10:85435407-85435429 GATGGTGAAGAAAGGGCTTTCGG - Intergenic
1071446276 10:85751050-85751072 GTGGGCCCAGAGGGGGCTCTGGG + Intronic
1071820644 10:89276942-89276964 GAGGGTCGAGACAGGGCTCTGGG - Intronic
1072550785 10:96475713-96475735 GAGGGTAGGGAGAGGGCTCAAGG - Intronic
1072693485 10:97586700-97586722 GAGGGTCCAGAGAAGAGTCTGGG - Intronic
1073025291 10:100482999-100483021 GAGGATTCAGACAGAGCTCTAGG - Exonic
1073053835 10:100686570-100686592 GAGGGTGCAGAGTGGGGTTCTGG + Intergenic
1073102188 10:101012137-101012159 GAGGTTGCAGAGAGGGCTTGGGG - Intronic
1073220472 10:101868119-101868141 GAGGTTGCAGATATGGATCTTGG + Intronic
1073522023 10:104141143-104141165 GAGGTTTCAGAGAGACCTCTAGG - Intronic
1073971073 10:109045861-109045883 GAGAGAGCAGAGATAGCTCTTGG + Intergenic
1074386059 10:113017551-113017573 GAGGGAGCAGAGGGCTCTCTTGG + Intronic
1074529583 10:114288128-114288150 GGGGATGCAGAGAGGCCTGTGGG - Intronic
1074818642 10:117163311-117163333 GAGGGTGCAGGTGGGGCTCCGGG + Intergenic
1075060864 10:119255864-119255886 TGGGATGCAGGGAGGGCTCTGGG + Intronic
1075091691 10:119447373-119447395 GAGGGTGCAGAGATGGGTCAAGG - Intronic
1075631051 10:124000884-124000906 GAGGAGGCAGAGAGAGCCCTGGG + Intergenic
1076164179 10:128268637-128268659 GAGGGCATAGAGAGGCCTCTGGG + Intergenic
1076230528 10:128816814-128816836 GAGGATGAAGAGAGGGAGCTGGG + Intergenic
1077024226 11:432211-432233 GAGGGTGCGGGGTGGGCTCCCGG - Intronic
1077138319 11:1012568-1012590 GATGGTGCAGAAGGGGCTCTCGG + Intergenic
1077223230 11:1426538-1426560 GAGTGTGCAGGGAAGGCCCTGGG + Intronic
1077537291 11:3130505-3130527 GGGGGCACAGAGGGGGCTCTGGG - Intronic
1077722523 11:4642840-4642862 GAGGCAGCAGAGATGGCTCCAGG + Intergenic
1077848045 11:6046567-6046589 GCAGGTGCAGAGAGGCCTCCAGG + Intergenic
1078159507 11:8828552-8828574 GAGGAAGCAGAGAGGGATCATGG - Intronic
1080660670 11:34293461-34293483 GAGGGTTGAGAGAGCTCTCTAGG - Intronic
1081278093 11:41175754-41175776 GAAGCTGCAGAGGGAGCTCTGGG - Intronic
1081997933 11:47376868-47376890 GAGCTTGCAGAGAGGGCTGGGGG + Intronic
1083161290 11:60855816-60855838 GTGGGTCTAGAGAGGGCACTAGG + Intronic
1083236385 11:61353545-61353567 AAGTTAGCAGAGAGGGCTCTGGG + Intronic
1083332723 11:61906441-61906463 GAGGGTGGGAAGCGGGCTCTGGG - Intronic
1083668200 11:64286415-64286437 CAGGGTGCAGAGAGGGAGATGGG - Intronic
1083674875 11:64319572-64319594 GAGCGGGCAGGGAGGGCCCTTGG + Intronic
1084207578 11:67604920-67604942 GATGCTGCAGAGAAGGCTCCTGG + Exonic
1084418768 11:69049726-69049748 GGGAGTGCAGAGGGGACTCTGGG - Intronic
1084512619 11:69615705-69615727 CAGGGGCCAGAGAGGCCTCTGGG + Intergenic
1084536985 11:69763033-69763055 GAGTGGCCAGAGAAGGCTCTGGG + Intergenic
1084547094 11:69819878-69819900 GACGGTCCAGAGAGGGGCCTGGG + Intergenic
1086665134 11:89471059-89471081 GAGGGTGGAGATAGGGATATGGG - Intronic
1088748321 11:112822909-112822931 GAGAGTGCAAAGGGGGCTCCAGG - Intergenic
1089201329 11:116726279-116726301 GAGGGTGGGCAGCGGGCTCTAGG - Intergenic
1089493226 11:118896380-118896402 GAGGGGACGGAGAGGGCACTCGG + Exonic
1089550957 11:119277194-119277216 GAGGTTGCAGTGAGTGATCTTGG - Intronic
1090145937 11:124322725-124322747 GGGGGCACATAGAGGGCTCTGGG - Intergenic
1090873864 11:130771617-130771639 GAGGGAGTAGGGAGGGCTGTCGG + Intergenic
1091593438 12:1858886-1858908 ATGGGAGCTGAGAGGGCTCTTGG - Intronic
1092161344 12:6317063-6317085 GAGGGAGCTCAGAGAGCTCTGGG + Intronic
1094411133 12:30169890-30169912 GAGGGTGCAGAGTGGCCGGTGGG + Intergenic
1095691486 12:45094425-45094447 GAGGGAGCAGAGAAAGCTCGTGG - Intergenic
1096212207 12:49775532-49775554 GAGGGTGGAGTGAGAGCTCTAGG - Intergenic
1097197559 12:57251878-57251900 GAGGGTGGGGAGATGTCTCTGGG - Intronic
1097629995 12:62049194-62049216 GAGGGTGGAGAAGGGGTTCTGGG - Intronic
1098890988 12:76010619-76010641 GTGGGTTCAGACATGGCTCTGGG + Intergenic
1099082865 12:78208179-78208201 GAGTGTGCAGAGAGGTCACATGG + Intronic
1099189228 12:79545667-79545689 GAGGGTGGAGTGGGGGGTCTTGG - Intergenic
1100231103 12:92608925-92608947 GAAGGGGCAGAGAGGAGTCTCGG - Intergenic
1100693257 12:97062504-97062526 GAGGGTGCAGAGATGACTATTGG - Intergenic
1101765966 12:107699656-107699678 GGTGGTGGAGAGAGGGCACTTGG - Intronic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1102419946 12:112795530-112795552 GGGGCTGCAGTGTGGGCTCTGGG + Intronic
1102490200 12:113286012-113286034 GGGTGTGCAGAGAAGGGTCTGGG - Intronic
1102778624 12:115543352-115543374 GAAGGTCCAGAGTGGGCCCTGGG + Intergenic
1103397466 12:120619125-120619147 GAGGGGGAAGAGAGGGCTGAAGG - Intergenic
1103455237 12:121060137-121060159 TAGGGTGCAGAGAGGGCTAGGGG + Intergenic
1104746150 12:131211736-131211758 GGGGGTGCAGAAAGGGCACTGGG + Intergenic
1104855114 12:131898097-131898119 GAGGGAGGAGGGAGTGCTCTCGG + Intronic
1106027237 13:25966929-25966951 GATGGTGGAGAGAGGGATCCTGG + Intronic
1106639169 13:31564931-31564953 GAGGATCCAAAGATGGCTCTGGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1108408815 13:50127909-50127931 GAGGGTGCGCAGAGGCCTCCTGG + Intronic
1108520941 13:51246588-51246610 GGCAGTGCAGAGGGGGCTCTGGG + Intronic
1113224042 13:108139913-108139935 GGGGGTGCTGAGGGGGCTCCTGG + Intergenic
1113505316 13:110812481-110812503 GAGAGCGCAGAGGGAGCTCTGGG - Intergenic
1113644145 13:111980454-111980476 GGGGAGGCAGGGAGGGCTCTGGG - Intergenic
1113889964 13:113730559-113730581 CAGGATGGAGGGAGGGCTCTGGG - Intronic
1114737980 14:25062730-25062752 GAGGGTGAGGAGAGCTCTCTGGG + Intergenic
1117109056 14:52429745-52429767 CAGGGTAGAGAGAGGGCTTTTGG + Intergenic
1117332133 14:54723483-54723505 GAGGATTCAGAGAGGCATCTTGG + Intronic
1117674054 14:58138256-58138278 GAGGCTGCACAGGTGGCTCTGGG - Exonic
1118473322 14:66094538-66094560 GAGGCTGCAGCGGAGGCTCTGGG + Intergenic
1118843328 14:69528381-69528403 GAGAGTGCCGAGGGGGCTCCAGG - Exonic
1119400776 14:74360739-74360761 TAGAGTGGAGAGAGGGTTCTGGG - Intergenic
1121104079 14:91269560-91269582 GAGGCTGCAGAGATGGTCCTGGG + Intergenic
1121108167 14:91294136-91294158 GAGGGTGCGGAGAGGGGTTCAGG + Intronic
1121311262 14:92936385-92936407 GAGGGTGCAGGGAGGGGCCTCGG + Intergenic
1121632755 14:95432959-95432981 GACGGTGCACACAGGGCCCTCGG + Intronic
1121998957 14:98630237-98630259 CAGGGTGGGGAGAGGGCTCTTGG + Intergenic
1122347837 14:101071479-101071501 TGGGGTGCGGAGGGGGCTCTGGG - Intergenic
1122409794 14:101520015-101520037 GAAGGAGCAGAGAGGCCTTTTGG + Intergenic
1122798475 14:104218132-104218154 GAGGGAGTGGAGAGTGCTCTCGG + Intergenic
1122997057 14:105270886-105270908 TGGGGTGCAGGGAGGGCTCCTGG - Intronic
1123062282 14:105599690-105599712 GTGGGGGCAGAGAGGGCCCGGGG + Intergenic
1123087024 14:105721418-105721440 GTGGGGGCAGAGAGGGCCCGGGG + Intergenic
1123404664 15:20012577-20012599 GAGGGAGCAGGGAGGGTGCTCGG + Intergenic
1123513997 15:21019224-21019246 GAGGGAGCAGGGAGGGTGCTCGG + Intergenic
1123701502 15:22917756-22917778 GAGGGTGCAGGCGGGGCTCAAGG + Intronic
1124424778 15:29554688-29554710 GAGTGCTCAGAGAGGCCTCTTGG + Intronic
1124600810 15:31131685-31131707 GAGGGGTCAGAGAGGGGTCCGGG + Intronic
1124966243 15:34435210-34435232 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1124982845 15:34581293-34581315 GTGGCTGCAGTGAGGGCTGTTGG - Intronic
1125471499 15:40008707-40008729 GAGGGTGCAGTGAGGCTTCCTGG - Intronic
1125472931 15:40022079-40022101 GAGGGGGCAGAGAAGCCTGTGGG - Intronic
1125761640 15:42100224-42100246 AAGGGAGCAGAGAGAGCCCTTGG + Intergenic
1128158877 15:65410123-65410145 GGCAGGGCAGAGAGGGCTCTGGG - Intronic
1128381286 15:67114863-67114885 GACTGTGCAGAGAGTGCTTTTGG - Intronic
1128552222 15:68605688-68605710 GAGGAGTCACAGAGGGCTCTTGG + Intronic
1129116107 15:73366316-73366338 GAGTTTGCAAAGAGGGCTCTGGG + Intronic
1129172655 15:73817528-73817550 GAGGGCCCAGAGAGGGGCCTTGG + Intergenic
1129196732 15:73972992-73973014 GACGGTGAAGAGCGGGGTCTAGG - Intergenic
1129455280 15:75673433-75673455 CAGGGTGCAGAGGGATCTCTGGG + Intergenic
1129461711 15:75703081-75703103 GAGAAGGCAGAGAGGGCCCTGGG + Intronic
1129723141 15:77888765-77888787 GAGAAGGCAGAGAGGGCCCTGGG - Intergenic
1129893933 15:79090090-79090112 GAGGGTGCAGAGAGCGCCTAGGG + Intronic
1130062274 15:80578550-80578572 GAAGCTGCAGACAGGGCTCAGGG + Intronic
1131261954 15:90892186-90892208 GATGGGGCAGGGAGGTCTCTGGG - Intronic
1131872911 15:96779473-96779495 AGGGGTGCAGAGAGGGCCATGGG + Intergenic
1132212705 15:100036206-100036228 GAGGGTGCAGAGAGGCAGCAAGG + Intronic
1134263306 16:12671501-12671523 GAGGCTGTAAAGAGAGCTCTTGG + Intronic
1135636250 16:24078208-24078230 GCGGCTGCAGACATGGCTCTGGG - Intronic
1136079388 16:27841539-27841561 GAGGGAGCAGGGGAGGCTCTCGG + Intronic
1136557093 16:31013699-31013721 GAGGGCCTAGAGACGGCTCTGGG - Intergenic
1136640766 16:31563406-31563428 GAGTGTGCAGAGAGGTCACCAGG + Intergenic
1136664199 16:31793906-31793928 GAGTGTGCAGAGAGGTCACCAGG - Intronic
1138249367 16:55490336-55490358 GATGGGGGAGAGAGGGCTCTGGG - Intronic
1139326365 16:66155519-66155541 GAGACTGCAGGGAGAGCTCTGGG - Intergenic
1139603236 16:67999505-67999527 GAGGGCACAGAGATGGCTTTGGG + Intronic
1139649641 16:68355884-68355906 GTGGGTGCAGAGAGGGCTGGGGG + Intronic
1141012465 16:80415722-80415744 GAGGGTGCAGAGAGGAGGCATGG - Intergenic
1141187131 16:81796006-81796028 GAGGGTACAGAGGCAGCTCTAGG + Intronic
1141432843 16:83979756-83979778 GGGGGTGCAGGGAGGACTCGCGG + Intronic
1141481447 16:84309338-84309360 GAGGGTGCTGGGAAGCCTCTGGG + Intronic
1141602207 16:85133754-85133776 GGGGGTGCAGAGAGGGAGGTGGG + Intergenic
1141848761 16:86629834-86629856 GATGGTGGAGAGAGGGGTATTGG + Intergenic
1142028540 16:87827160-87827182 GCGGGTGCAGACCGTGCTCTGGG + Intergenic
1142262535 16:89049655-89049677 GAGGCGGCAGGGAGGCCTCTGGG + Intergenic
1142533943 17:600408-600430 TAGGGTGGAAAGAAGGCTCTGGG - Intronic
1142595759 17:1029162-1029184 GTGGGTTCAGCCAGGGCTCTCGG - Intronic
1142744391 17:1948436-1948458 GAGGTTTCAGTGAAGGCTCTGGG + Intronic
1142808084 17:2382089-2382111 GTTGGTGCAGAGAGAGCTCTGGG + Intergenic
1142817125 17:2435431-2435453 GAGGGTGGGGAGAGAGGTCTAGG + Intronic
1143001025 17:3795114-3795136 CAGGGTGCTGAGGGGGCTCAGGG - Intronic
1143290739 17:5826018-5826040 GGGGTTGAGGAGAGGGCTCTGGG + Intronic
1143723156 17:8827931-8827953 GAGGCTGCAGACGGTGCTCTGGG - Intronic
1144099912 17:11934103-11934125 GAGGGTGCTCACAGGGCCCTGGG + Intronic
1145003378 17:19321125-19321147 GAGGCTGCAGAGTGGGGGCTGGG + Intronic
1145763737 17:27443693-27443715 GTGGGTAGAGAGAGCGCTCTGGG + Intergenic
1146489493 17:33269966-33269988 GATGGAGCAGAGAGGCATCTGGG - Intronic
1147025429 17:37578631-37578653 CAGGGTGCTGGGAGGGATCTTGG - Intronic
1147311497 17:39598529-39598551 GAGGGGGCACAGAGGGGTTTGGG + Intergenic
1147419091 17:40313202-40313224 GAGGGCTCACAAAGGGCTCTGGG - Intronic
1151472751 17:74328041-74328063 GAAGGTGCAGGCACGGCTCTGGG - Intronic
1151661144 17:75518893-75518915 GGAGGGGCAGAGAGGGCTGTGGG + Intronic
1152074530 17:78150706-78150728 GAAGGGGTAGACAGGGCTCTGGG + Intronic
1152459490 17:80433695-80433717 AGGGGGGCAGAGATGGCTCTGGG + Intronic
1152519016 17:80844719-80844741 GAGGCTGCCGAGAGCGCTCCTGG + Intronic
1152575334 17:81137508-81137530 GAGGGCACAGAGAAGGCTCCAGG - Intronic
1152643897 17:81460171-81460193 GAGGGTGAGGGGAGGGCTCTGGG - Intronic
1152779430 17:82219701-82219723 AAGGGTGCAAAGAGGGGGCTGGG + Intergenic
1152931459 17:83112178-83112200 GGGGGTGGAGAGAGGACCCTGGG - Intergenic
1155243423 18:23884887-23884909 GAGGGGGCGGGGAGGGCTGTGGG + Intronic
1155668090 18:28335785-28335807 GAGAGTACAGGGAGGGCTGTAGG - Intergenic
1156485524 18:37463335-37463357 GAGGGCCCAGCAAGGGCTCTGGG - Intronic
1157814585 18:50721578-50721600 GATTGTGCAGAGAGGTCTATGGG + Intronic
1158073473 18:53500868-53500890 GAGGGTGGAGAGAGGGGCTTGGG - Intronic
1160064442 18:75561892-75561914 GGGGGTTCAGGGAGGGCTCTTGG + Intergenic
1160089977 18:75817890-75817912 GAGGGTGCACAGCGGGCACTGGG + Intergenic
1160128441 18:76202540-76202562 TAGGGTGCAGAGATTGCTCATGG - Intergenic
1160293428 18:77616509-77616531 GTGGGTGCAGAGACAGCCCTGGG + Intergenic
1160591048 18:79944915-79944937 GGGGGTGCTGAGGGGGCTGTGGG - Intronic
1160591063 18:79944968-79944990 GGGGGTGCTGAGGGGGCTGTGGG - Intronic
1160663880 19:313835-313857 GTGGGTCCAGAGCAGGCTCTGGG + Intronic
1161062705 19:2223073-2223095 GAGGGGGCATGGGGGGCTCTGGG + Intronic
1161148665 19:2695161-2695183 GTGGGTACACAGAGGGCGCTAGG - Intronic
1161812533 19:6478939-6478961 GAGGATGCAGAGACAGCTCTGGG + Exonic
1162778851 19:12996299-12996321 GAGGGCGCAGAGGGGACACTGGG + Intronic
1162964134 19:14148141-14148163 GACGGTACAGAGAAGGGTCTTGG - Exonic
1163059049 19:14744843-14744865 GAAGGTGCAGACTGGGCTGTGGG + Intronic
1163346932 19:16749301-16749323 GAGGCTGCTGAGAAGGTTCTGGG - Exonic
1163842800 19:19621559-19621581 GAGGGACCAGAGAGGCCCCTAGG - Intergenic
1163874061 19:19851473-19851495 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163903924 19:20134428-20134450 GAGAATGTAGAGAAGGCTCTGGG + Intergenic
1163910231 19:20183101-20183123 GAGAATGCAGAGAAAGCTCTGGG - Intronic
1163932628 19:20411801-20411823 GAGAATGCAGAGAAAGCTCTGGG + Intergenic
1163936512 19:20449664-20449686 GAGAATGTAGGGAGGGCTCTGGG - Intergenic
1163970669 19:20790951-20790973 GAGAATGAAGAGAAGGCTCTGGG - Intronic
1164014922 19:21246506-21246528 GAGAGTGTAGAGAAGACTCTGGG + Intronic
1164028260 19:21373969-21373991 GAGAGTGTAGAGAAGGCTCTGGG - Intronic
1164030945 19:21403848-21403870 GAGAGTGTAGAGAAGGTTCTGGG - Intronic
1165050619 19:33139247-33139269 GAGGTTGCAGAGGTGGCTCCTGG + Intronic
1166069012 19:40376986-40377008 GGGGGTGCAGAGAGAGGTGTTGG + Intronic
1166314015 19:41978579-41978601 GAGGCTGCCGGGCGGGCTCTGGG - Intronic
1166412054 19:42561881-42561903 GAGGGGGCAGAGAGGCTTCCTGG - Intergenic
1166546312 19:43636403-43636425 GGGGGTGAATAGAGGGCACTGGG - Intronic
1166763161 19:45237054-45237076 GTGGGTGCTGAGAGGGGCCTGGG + Intronic
1167694496 19:51006828-51006850 GAGGGTGCAGAGAGGGTGTGTGG - Intronic
1168188075 19:54714049-54714071 CAGGGTCCAGAGAGGGTGCTAGG - Intergenic
1168287051 19:55340299-55340321 GAGGGTGCAGGGAGAGACCTGGG - Intronic
1168469911 19:56631292-56631314 GAGAGAGCACAGAGGCCTCTTGG - Intergenic
1168629539 19:57946453-57946475 GAGGGTTCAGAGAAGACTCCAGG - Intronic
925158480 2:1664514-1664536 GAGGTGACAGTGAGGGCTCTGGG + Intronic
927128231 2:20033475-20033497 GAGGGTGGAGAGAGGGAGGTGGG + Intronic
927159848 2:20246681-20246703 GAGGGTGCAGGAAGGTTTCTGGG + Intergenic
927520064 2:23693173-23693195 GTGGGTTCAGAGAAGGATCTAGG + Intronic
927893965 2:26769561-26769583 CAGGGGCCAGAGAGGGCTCGAGG - Intronic
929456990 2:42073030-42073052 GAGGGTGCAGAAAGGGAAGTTGG + Intergenic
930241330 2:48938385-48938407 GAGTATGCACACAGGGCTCTGGG + Intergenic
930357741 2:50343640-50343662 CAGGGCGCAGAGAGCGCTCATGG - Intronic
931258335 2:60594813-60594835 GAGGGTGGAGAGTGAGCACTTGG + Intergenic
932283558 2:70514721-70514743 GAGGGGGCAGAGAGGACTCCGGG + Intronic
932436102 2:71703348-71703370 GATGGTGGAGAGAATGCTCTTGG + Intergenic
932460584 2:71879528-71879550 GCAGCTGCAGAGATGGCTCTGGG + Intergenic
932707369 2:74037112-74037134 GAGGGTGCAGACATGGGACTGGG + Intronic
933318994 2:80748291-80748313 GAGAGTGGAGAGTGGTCTCTGGG + Intergenic
933782566 2:85812465-85812487 GAGGGGGCAGCTCGGGCTCTTGG - Intergenic
933937088 2:87215295-87215317 GAGGGGGCACAGAGGTATCTGGG - Intergenic
934983911 2:98870194-98870216 GAGTGTTGACAGAGGGCTCTGGG + Intronic
935272993 2:101451096-101451118 TGGGCTGCAGAGAAGGCTCTTGG - Intronic
935356861 2:102209451-102209473 GAGGGTGAGGAGGGGTCTCTAGG + Intronic
935707885 2:105872204-105872226 GTAGCTGCAGAGAGGGATCTGGG - Intronic
936096637 2:109535358-109535380 GAGGGAGTTGGGAGGGCTCTGGG - Intergenic
936356053 2:111750529-111750551 GAGGGGGCACAGAGGTATCTGGG + Intergenic
937950227 2:127380280-127380302 AAGTGTGCACAGAGTGCTCTAGG + Intronic
938197142 2:129338289-129338311 GAGGGTGGAGAAGGGTCTCTTGG - Intergenic
940988666 2:160075522-160075544 TAGCAGGCAGAGAGGGCTCTGGG + Intergenic
942493076 2:176509400-176509422 AAGGGGGCAAAGAGGGCTCCTGG - Intergenic
944386197 2:199167689-199167711 CAGCTTGCAGAGAGGGTTCTGGG - Intergenic
945461257 2:210111863-210111885 GAGGGGGCAGCGAGAGCTTTAGG - Intronic
946024902 2:216665783-216665805 GAGAGGGCCTAGAGGGCTCTGGG + Intergenic
947323776 2:228952304-228952326 GAGAGGGCAGAGAGGGCTTGGGG + Intronic
947565909 2:231192913-231192935 TAGGGCCCACAGAGGGCTCTAGG + Intergenic
947712870 2:232325931-232325953 AAGGGCGCAGAGTGGGCACTGGG - Intronic
947811441 2:233006699-233006721 GATGGTGCACAGAAAGCTCTTGG - Intronic
948055902 2:235009184-235009206 GAGGGCCCAGAGAGCACTCTGGG - Intronic
948112675 2:235469361-235469383 AAAGGTGCAGAGAAGGCTGTCGG + Intergenic
948467144 2:238158113-238158135 AAGGTGGCAGAGAGGCCTCTGGG - Intergenic
948567210 2:238894672-238894694 GAAGGTGGGGAGAGGGATCTGGG - Intronic
948641279 2:239377459-239377481 GAGGGTCCAGAGAGGCCCATTGG - Intronic
1168790504 20:572854-572876 GAGACAGCAGAGAGGGCTGTGGG + Intergenic
1168897227 20:1331967-1331989 GAGGATCCGGAGAGGCCTCTGGG - Intronic
1169130044 20:3161857-3161879 AAGGGTCCTGGGAGGGCTCTGGG + Intergenic
1169994419 20:11540940-11540962 GAGGGAGAAGGGAGGACTCTGGG + Intergenic
1170118103 20:12883110-12883132 GAGGGAGAAGAGAGGGCATTTGG + Intergenic
1170271913 20:14537038-14537060 GAGGGAGTAGGGAGAGCTCTAGG - Intronic
1170392736 20:15892938-15892960 TAGGGTGGAGAGAGGCCTTTTGG - Intronic
1170770363 20:19327474-19327496 GAGATTCCAGAGGGGGCTCTGGG - Intronic
1171210487 20:23312890-23312912 GAAGAGGCAGAGAGAGCTCTCGG + Intergenic
1172632178 20:36385927-36385949 GAGGGTGCAGCTAGATCTCTGGG - Intronic
1172952226 20:38729488-38729510 AAGGGTCCGGGGAGGGCTCTAGG + Intergenic
1173198768 20:40938418-40938440 TGTGGTGCAGAGAGGGATCTAGG + Intergenic
1173201576 20:40958992-40959014 GGGGGGGAAGAGAGGGATCTGGG + Intergenic
1173241359 20:41300642-41300664 GAGGGGTCAGAGAAGGCTTTTGG + Intronic
1174736708 20:52972178-52972200 GAGGGCGCACAGAGGGGCCTGGG + Intergenic
1174910337 20:54601145-54601167 AAGGGTGCAGAGTGAGCACTGGG + Intronic
1175238293 20:57527279-57527301 GAGGGAGCAGAGGGAGCTCGAGG + Intergenic
1175935707 20:62512990-62513012 GTGGGGGCAGAGAGTGCTCCAGG - Intergenic
1176128613 20:63486988-63487010 GAGGATGCAGAGGAGGGTCTGGG - Intergenic
1176152025 20:63596328-63596350 GAGGCAGAAGAGAGGGCCCTGGG - Intronic
1176383775 21:6127036-6127058 CAGGGTGCACAGTGGGCCCTGGG + Intergenic
1176427435 21:6557538-6557560 CCGGGGGCAGGGAGGGCTCTAGG - Intergenic
1178244204 21:30935963-30935985 GAGCCTGCAGAGGAGGCTCTGGG - Intergenic
1178403438 21:32306278-32306300 GAGGGAGAGGAGAGGGCTGTGGG - Intronic
1178599451 21:33983498-33983520 GAGTGTGGAGAGAGGTGTCTGGG - Intergenic
1178626423 21:34222630-34222652 GTGGCTGCAGTGAGGACTCTGGG + Intergenic
1178794026 21:35726979-35727001 GATGGTGCAGGGAGAGCTATAGG - Intronic
1179107272 21:38413350-38413372 AAGTATGCAGAGAGGGCTCTTGG - Intronic
1179160729 21:38895135-38895157 GAGGCTGCAGACTGGGCTATAGG + Intergenic
1179378689 21:40878528-40878550 GAGGTTGCAGACAGGGCTTGCGG - Intergenic
1179569936 21:42272823-42272845 GAAGGAGCAGAGAGGGGCCTGGG - Intronic
1179654670 21:42837769-42837791 GAGGGTGGGGAGGGCGCTCTGGG - Intergenic
1179702926 21:43165855-43165877 CCGGGGGCAGGGAGGGCTCTAGG - Intergenic
1179739695 21:43411202-43411224 CAGGGTGCACAGTGGGCCCTGGG - Intergenic
1179769334 21:43602855-43602877 GAGTGAGGAGAGAGGCCTCTGGG - Intronic
1180319530 22:11307704-11307726 CAGGGTGCAGAGAGGGGTGGTGG + Intergenic
1180954345 22:19734974-19734996 GAAGATTCAGGGAGGGCTCTGGG - Intergenic
1181046168 22:20215333-20215355 GAGGGTGCAGTGCTGGGTCTAGG + Intergenic
1181115721 22:20631642-20631664 GCAGGTGCAGAGAGGGCTCTGGG + Intergenic
1181136267 22:20768735-20768757 GGGGGTGCAGGGCAGGCTCTGGG + Intronic
1181173549 22:21023436-21023458 CAGGGTTCCTAGAGGGCTCTGGG + Intronic
1181433008 22:22894333-22894355 GAGGGCACAGAGAGGGCTCTGGG + Intronic
1181458122 22:23070850-23070872 GAGGGTGGACAGAGGGCGCCGGG + Intronic
1181541276 22:23574495-23574517 GAGGGCACAGAGAGGGCTCTGGG - Intronic
1181551178 22:23639856-23639878 TGGAGGGCAGAGAGGGCTCTGGG - Intergenic
1181797105 22:25318827-25318849 GAGGGCACAGAGAGGGCTCTGGG + Intergenic
1182028432 22:27138307-27138329 CAGGCTGCAGAGAGGGGCCTCGG - Intergenic
1182719060 22:32383223-32383245 GAGGGAGAAGAGAGCTCTCTGGG - Intergenic
1183352861 22:37343659-37343681 GGGAGTGCAGAGAGCGGTCTTGG + Intergenic
1183425971 22:37739591-37739613 GGAGGTGCAGAGAGAGCGCTGGG - Intronic
1183426429 22:37741868-37741890 AGGGCTGCAGAGAGGGCTCAGGG + Intronic
1183469644 22:37998591-37998613 GAGGGTGCAGAGAGGGAGTCTGG - Intronic
1184401763 22:44278644-44278666 GGGGGTACAGAGAGGGGTCAAGG + Intronic
1184409465 22:44318144-44318166 GGGCCTGCAGAGAGGACTCTCGG - Intergenic
1184462273 22:44645963-44645985 GAGGGAGCAGGCAGGGCTCTGGG - Intergenic
1184506444 22:44906626-44906648 GAGGGAGCAGACAGCGCCCTGGG + Intronic
1184909096 22:47514094-47514116 GAGGCTGCCCAGGGGGCTCTGGG - Intergenic
1185017583 22:48353656-48353678 GTGGGTGCAGGAAGGGCTCGGGG + Intergenic
1185279735 22:49964931-49964953 CAGGGGGCAGACAGGGCTCCAGG - Intergenic
949497430 3:4645736-4645758 TAGGGTGGAGAAAGGGCTCCTGG + Intronic
949913380 3:8935069-8935091 GAGGGGGCAGATAGGGCTTTTGG + Intronic
950190902 3:10975412-10975434 GAGACTGCACAAAGGGCTCTAGG + Intergenic
950249572 3:11453160-11453182 GAGGGGGCTGAGAGTTCTCTGGG + Intronic
950769728 3:15301827-15301849 TTGGGGGCAGAGATGGCTCTAGG - Intronic
950795326 3:15505923-15505945 GGGGGTGCAGGGATGGATCTAGG - Intronic
950849771 3:16051347-16051369 GAGGGTGCTGAGAGGGGTGGGGG + Intergenic
951748194 3:26002951-26002973 GAGGGTTGAGAGAGCTCTCTGGG + Intergenic
952901712 3:38115544-38115566 GTGGGGGCAAAGAGTGCTCTGGG + Intronic
953717353 3:45326808-45326830 GGGGCTTCAGAGAAGGCTCTAGG + Intergenic
954101789 3:48379123-48379145 GAGGGAGAAGAGATGGCTTTGGG + Intronic
954327095 3:49869638-49869660 GGGGGCGCAGCGAGGGCTCGAGG - Intronic
954440188 3:50517466-50517488 GGGGGTGCAGATGGGACTCTGGG + Intergenic
954808977 3:53236376-53236398 GAGGCTGCAGGGAGTGCTCCTGG - Intronic
958201732 3:90327657-90327679 GTGAGTGCATTGAGGGCTCTGGG - Intergenic
959159684 3:102708181-102708203 GAGAGTGAAGAGAGAGATCTGGG - Intergenic
959524698 3:107363597-107363619 GAGGTAGCAGAGAGAGCCCTGGG - Intergenic
960874741 3:122285217-122285239 GAGAATGCAGAGAGGTTTCTTGG + Exonic
960965152 3:123099548-123099570 GAGTCTGCAGTGAGGGCTCGTGG + Intronic
961034600 3:123633796-123633818 GAGGGTGCAGAAATGCCTCTTGG + Intronic
961415501 3:126753717-126753739 GTGGGTGAAGAGAGGGCCCACGG + Intronic
965153191 3:165009799-165009821 GAGGGTGGTGAGATGGTTCTGGG - Intronic
966820538 3:183920724-183920746 GAGGCGGCAGAGGGGGCTGTCGG + Exonic
967408025 3:189138870-189138892 AAGGGGTCAGGGAGGGCTCTAGG + Intronic
967927651 3:194663865-194663887 ACGGGTACAGAAAGGGCTCTTGG - Intronic
968073250 3:195801412-195801434 GAGGGTGCGGAGAAGGCTCTGGG - Intronic
968609250 4:1549655-1549677 GATGGGGCAGAGAGGCCTCCGGG - Intergenic
968652015 4:1763886-1763908 GAGGCTGCCCAGAGGGCTCTGGG - Intergenic
969265195 4:6059845-6059867 GGGGAGCCAGAGAGGGCTCTGGG - Intronic
969444836 4:7238916-7238938 GAGGCTGCAGCGAGGGCACAGGG - Intronic
969671030 4:8590531-8590553 GGGGATGGAGAGAGGGCTCCTGG - Intronic
969694462 4:8726729-8726751 GAGGGTGCAGAGTGGGCGGTGGG - Intergenic
971161794 4:24140921-24140943 GAGGATGCCAAGAGTGCTCTTGG + Intergenic
971280878 4:25241798-25241820 GAGGGAGCCGAGATAGCTCTTGG - Intronic
972408706 4:38770146-38770168 GAGAGTACAGGGAGGGCACTGGG - Intergenic
975321290 4:73012030-73012052 GAGGAGGCAGACAGGGTTCTGGG + Intergenic
975956488 4:79846802-79846824 GAGAGTGCATAGAGTGATCTTGG - Intergenic
976106624 4:81625832-81625854 GGGGGTGCAGGGAGTGTTCTAGG - Intronic
978146332 4:105376559-105376581 GAGGGTGCTGAGACCTCTCTGGG + Intronic
978375325 4:108069106-108069128 AAGGGGGAAGAGAGTGCTCTGGG - Intronic
978385385 4:108172145-108172167 GAGGGGGCGGAGAGGACTCGAGG - Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
981310471 4:143293344-143293366 GAGGATTCAGGTAGGGCTCTGGG - Intergenic
984851200 4:184154088-184154110 GAGGGTGCAGAGAGGGCTCTGGG - Intronic
985775816 5:1841190-1841212 GAGGGTGCAGATAAGGCACCGGG + Intergenic
986172638 5:5326657-5326679 GAGGGTTCAGAGAGGCCTCCGGG - Intergenic
986710130 5:10482624-10482646 GAGGGCAGAGAAAGGGCTCTTGG + Intergenic
988591696 5:32555274-32555296 GAGGGAGCAGGGATAGCTCTTGG - Intronic
989261740 5:39426146-39426168 GAGGGTTCAAATAGGGCTCGTGG + Intronic
990003626 5:50922177-50922199 GATGGGGCAGAGAGGCCTCCGGG + Intergenic
992049677 5:72930887-72930909 GAGAGAGCAGAGATAGCTCTTGG + Intergenic
992520317 5:77543986-77544008 GAGGCTGAAGATAGGGCCCTAGG - Intronic
992955897 5:81907711-81907733 GCAGGTGCAGAGTGGGCTCGAGG + Intergenic
996088769 5:119330148-119330170 GAGGGTACAGAGAGGACTGATGG + Intronic
996288376 5:121822813-121822835 GAGGGTGGAGGGAGGGGTGTTGG - Intergenic
998056304 5:139081136-139081158 GTGGGTGCAGGCAGGGCACTGGG + Intronic
998385007 5:141752554-141752576 GAGGGGGTGGAGGGGGCTCTGGG - Intergenic
999149333 5:149416424-149416446 GAGGGTCCACAGATGGCTCAAGG + Intergenic
999245229 5:150150617-150150639 GCGGGGGCAGGGTGGGCTCTGGG + Intronic
999281636 5:150370002-150370024 GCGGCTGCTGAGAGGGTTCTGGG + Intronic
999738964 5:154534706-154534728 GAGGTTGCAGAGACGGTTCAGGG + Intergenic
1001093750 5:168760607-168760629 GAGGGTCCAGGGAGGGGTCAGGG + Intronic
1001228149 5:169963370-169963392 GAGGGAGCAGAGAGGGATGGAGG - Intronic
1001284376 5:170411872-170411894 GAGGGGGCAGTCTGGGCTCTGGG + Intronic
1001626754 5:173142720-173142742 GAGGGTGTGTAGAGGGCTGTAGG + Intergenic
1002050679 5:176568855-176568877 GGGGGTGCTGGGAGGGCCCTGGG + Intronic
1002066670 5:176655265-176655287 TAGGGTGCAGGGAGGCCTCCAGG - Intronic
1002098270 5:176844786-176844808 GAGGGTGGAGAGGGGTCTCGGGG - Intronic
1002525884 5:179816008-179816030 GAGGGGGAAGAGCGGGCACTGGG + Intronic
1002583499 5:180225631-180225653 AAGGACGCAGAGAGGCCTCTAGG + Intergenic
1003727143 6:8777730-8777752 AATGGTGCAGAGAGTTCTCTGGG - Intergenic
1003928132 6:10896423-10896445 GAGGGTGCTGGGAGGGTGCTGGG + Intronic
1005583110 6:27251618-27251640 GAGGGTGCAGACCTAGCTCTTGG - Intronic
1005877092 6:30019333-30019355 GAGCCTTCAGAGAGGGCTGTGGG - Intergenic
1006030281 6:31172592-31172614 GGGGCTCCAGAGGGGGCTCTGGG + Intronic
1006605311 6:35251967-35251989 CACGCTGCAGAGAGGCCTCTGGG - Exonic
1007109067 6:39302679-39302701 GAGGGTGCAGGTATGGCCCTTGG + Intronic
1007120491 6:39376736-39376758 GAGGGAGCTGAGATAGCTCTGGG + Intronic
1007404597 6:41627236-41627258 GAGGGTAGAGAGAGGGAGCTAGG - Intergenic
1007654997 6:43446501-43446523 GATGGTGCAGGGAGAGATCTGGG - Intronic
1007719022 6:43874505-43874527 GAGGGAGCACAGTGGGCTATGGG - Intergenic
1008128748 6:47696871-47696893 GATGGTGTAGAGTGGGCTTTGGG - Intronic
1011215954 6:85005746-85005768 GAGGGTGCTGAGGTGGCACTTGG - Intergenic
1011509831 6:88088318-88088340 CAGGGTGGTGAGAGGGCTGTGGG - Intergenic
1013094283 6:106930168-106930190 GACTGAGCAGAGAAGGCTCTTGG - Intergenic
1014693571 6:124591472-124591494 GAGGGAGTAGAAATGGCTCTAGG - Intronic
1015126863 6:129764725-129764747 GAGGGTGGATAGTGGGGTCTGGG + Intergenic
1015416858 6:132959026-132959048 GAGGATGAAGAGAGGGCATTTGG + Intergenic
1015789827 6:136955272-136955294 TAGGGTGTAGAGAGGGCTGTGGG + Intergenic
1016863626 6:148746366-148746388 GGGGGTGCATAGCGGACTCTAGG - Intergenic
1017041959 6:150315134-150315156 GAGGGTGCAGTGGGGTTTCTTGG - Intergenic
1017757427 6:157541435-157541457 TAGGAAGCAGACAGGGCTCTTGG - Intronic
1017995065 6:159525187-159525209 GAGAGTGCAGGGAGGGGTCCTGG - Intergenic
1019359850 7:599092-599114 GAGGCTGCGGAGGGAGCTCTCGG - Intronic
1019496903 7:1345036-1345058 GAGGGGGCTCAGATGGCTCTGGG + Intergenic
1019824109 7:3269252-3269274 GGGGGAGCAGAGAAAGCTCTGGG - Intergenic
1020800831 7:12730180-12730202 TAGGGTGAAGAGAGAGTTCTTGG - Intergenic
1022222625 7:28328855-28328877 TAGGGTATTGAGAGGGCTCTTGG + Intronic
1022702237 7:32772219-32772241 GAGGGTTCAGAGAAGGCCCCAGG - Intergenic
1022963841 7:35454988-35455010 GGAGGTGCAGAGAGGCCGCTGGG - Intergenic
1023761237 7:43467253-43467275 GAGGGAGGACAGAGTGCTCTGGG + Intronic
1023965358 7:44961121-44961143 GAGGGGGCTGAGAGGGCTGAGGG + Intergenic
1023965410 7:44961277-44961299 GAGGGGGCTGAGAGGGCTGAGGG + Intergenic
1023965497 7:44961515-44961537 GAGGGGGCTGAGAGGGCTGAGGG + Intergenic
1024097142 7:45991276-45991298 GAGGGGGCAGAGTGTGCTCAGGG + Intergenic
1024128503 7:46325772-46325794 GAGGTTGCAGAGAGGACGCTGGG + Intergenic
1024394198 7:48847361-48847383 GAGGGGGGAGAGAGAGCACTGGG + Intergenic
1025235297 7:57230648-57230670 GAGGGACCAGTGAGGGCTCAAGG - Intergenic
1027235580 7:76295710-76295732 GACAGTTCAGAGAGGGCTGTGGG - Intergenic
1027336485 7:77156051-77156073 AAGGGTGCTGAGAGAGCTCTAGG - Intronic
1027460575 7:78447910-78447932 AAGGGTGCAGAGAGGTATGTAGG - Intronic
1029779304 7:102715050-102715072 AAGGGTGCTGAGAGAGCTCTAGG + Intergenic
1029924854 7:104304626-104304648 GAGCCTGCAGAGAAGGCTCGAGG + Intergenic
1030056511 7:105588145-105588167 CAGGCTTCAGAGAGGGCCCTCGG - Intronic
1031077333 7:117225536-117225558 GAAGATGCAGAGAAGACTCTGGG - Intronic
1031223762 7:119007835-119007857 TAGGGTGCAGGGATGGCTATAGG + Intergenic
1031732076 7:125312432-125312454 GAGAGGGCAGAGATAGCTCTTGG + Intergenic
1032078036 7:128845357-128845379 TGGGGTGAAGGGAGGGCTCTCGG + Intronic
1032153589 7:129450753-129450775 TAGGCTGCAGAGAAGGCCCTTGG - Intronic
1033516234 7:142109535-142109557 GAGGGTACAGAGAGCTCTTTTGG - Intergenic
1033657292 7:143382286-143382308 GACGATGCAGAGGGTGCTCTGGG + Exonic
1034071642 7:148191659-148191681 GAGAGTTCAGAGAGCTCTCTGGG + Intronic
1034458782 7:151186751-151186773 GAGGCTGCAGATGGAGCTCTGGG - Intronic
1035092870 7:156329183-156329205 GAGGGTGTGGAGAAGGGTCTGGG - Intergenic
1035133885 7:156681207-156681229 GAGGCTGCAGGGAGGGCCATGGG + Exonic
1035361445 7:158316293-158316315 GACTGTGAAGTGAGGGCTCTTGG - Intronic
1035582789 8:750291-750313 GATTGTGCAGAGTGGGCTCAGGG + Intergenic
1036756602 8:11475269-11475291 AAGGGTGCAGAGAGGCCCATAGG - Intergenic
1038649568 8:29390243-29390265 GTGGGTGCAGAGAGGATTGTGGG + Intergenic
1039920516 8:41891033-41891055 GAAGGTGCAGAGAGAGCAATGGG + Intronic
1040072839 8:43202277-43202299 GAGGCTGCTGAGAGGCTTCTGGG - Exonic
1041301029 8:56411565-56411587 GATGGAGCCAAGAGGGCTCTGGG - Intergenic
1041690776 8:60684821-60684843 GTGGGTGCAGAGAGGACAATAGG + Intronic
1045151004 8:99408037-99408059 GCTGGTGCAGAGAGAGCACTGGG + Intronic
1046264055 8:111807808-111807830 AAGGGTCAAGAGAGTGCTCTGGG + Intergenic
1047546986 8:125827771-125827793 GAGGGAGCAAAGAGGTCTGTAGG - Intergenic
1047835737 8:128688831-128688853 GAGGCTGCAGGGAGTGCTTTTGG + Intergenic
1047920501 8:129629920-129629942 GAGGGAGCTGTGAGGGCTTTTGG - Intergenic
1049220536 8:141426878-141426900 GAGGGTAGAGAGGCGGCTCTGGG - Intronic
1049234648 8:141506508-141506530 GAGGGGGCGGGCAGGGCTCTGGG + Intergenic
1049387672 8:142352393-142352415 CATGGAGCAAAGAGGGCTCTGGG + Intronic
1050351204 9:4741900-4741922 GAGTGGGAAGAGAGGGCGCTCGG - Intronic
1053072664 9:35110453-35110475 GTGGGAACTGAGAGGGCTCTGGG - Exonic
1053151077 9:35743491-35743513 GATGAGGCAGAGAGGGATCTTGG + Intronic
1053294455 9:36902916-36902938 GAGGCTGCACTTAGGGCTCTGGG - Intronic
1054733603 9:68727763-68727785 TAGGGTAGAGAGACGGCTCTGGG - Intronic
1055585226 9:77752190-77752212 CATGGTGTAGAGAGGTCTCTAGG + Intronic
1056160727 9:83889694-83889716 GAGGGAGTGGAGACGGCTCTGGG - Intronic
1056268674 9:84925125-84925147 GAAGGTGCAGAGAGGGCAGTGGG - Intronic
1056359414 9:85839630-85839652 GAGGGAGTGGAGACGGCTCTGGG + Intergenic
1057454914 9:95199343-95199365 AAGGAGGCAGAGAGGGCTGTGGG - Intronic
1060297775 9:122354962-122354984 GGGGGTGGGGAGAGGGTTCTGGG + Intergenic
1060473941 9:123971161-123971183 GACTGAGCCGAGAGGGCTCTGGG - Intergenic
1060973720 9:127753312-127753334 GAGGGGTCAGAGAGGACTCCTGG + Intronic
1061047611 9:128175500-128175522 GAGGGGACAGGAAGGGCTCTTGG - Intronic
1061117992 9:128626724-128626746 CAGGGCCCAGAGAGGGCTCTGGG - Intronic
1061274471 9:129561532-129561554 GAGTGGGGAGAGAGGACTCTGGG + Intergenic
1061287673 9:129633375-129633397 AAGGGTGCAGAGAGGGAACATGG - Intronic
1061303765 9:129721212-129721234 GAGGGTGGACACAGGGCGCTGGG - Intronic
1061659203 9:132117095-132117117 GAGGGTGCATGTAGGGTTCTTGG + Intergenic
1061750387 9:132772966-132772988 GTGGGTGGAGAAAGGGCTGTAGG - Intronic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1062003136 9:134226755-134226777 GCGAGGGCAGAGAGGGGTCTGGG - Intergenic
1062063870 9:134515440-134515462 ATGGGAGCTGAGAGGGCTCTGGG - Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1062384925 9:136305432-136305454 GAGGCTGCAGAGGGGTCCCTGGG - Intronic
1062600881 9:137318181-137318203 GAGGGGACAGAGTGGGCTCCAGG - Intronic
1062609407 9:137367257-137367279 CTGGGGCCAGAGAGGGCTCTTGG - Intronic
1062630653 9:137461706-137461728 GAGGCTGCAGAGAGGGCGCAGGG - Intronic
1186493958 X:9997192-9997214 GAGGGGACAGAGAAGGCTTTAGG - Intergenic
1187314822 X:18183563-18183585 TAGGGTACAAAGTGGGCTCTTGG + Intronic
1188106835 X:26156493-26156515 GAGGCTGCATAGAGGGGTCCTGG + Intergenic
1189230929 X:39451709-39451731 GAGGATGCAGAGAGGGGAATGGG + Intergenic
1189346862 X:40248377-40248399 GATGGAGGAGGGAGGGCTCTCGG - Intergenic
1189699949 X:43708293-43708315 GAGGGTGAAGCAGGGGCTCTGGG - Intronic
1190335428 X:49258868-49258890 CAGGGTGCAGGGAGGGCTAGAGG - Intronic
1190497468 X:51040494-51040516 GAGGGTGGAGACATGGCTTTGGG - Intergenic
1192155509 X:68743544-68743566 TAGGGTGCAAAGAGGCCACTGGG - Intergenic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1193210590 X:78802505-78802527 GAGGGGGGAGAGAGAGCTTTAGG - Intergenic
1195129100 X:101837352-101837374 GAGGGAGCAGTGGGGGATCTGGG + Intronic
1195177154 X:102322486-102322508 GAGGGAGCAGTGGGGGATCTGGG - Intronic
1195181710 X:102364607-102364629 GAGGGAGCAGTGGGGGATCTGGG + Intronic
1195439859 X:104887342-104887364 GAGAGAGCAGAGATAGCTCTTGG + Intronic
1195717436 X:107830232-107830254 AAGGGTGAAGACAGGGCTGTGGG + Intronic
1198596336 X:138240170-138240192 GAGGGTGGCGGCAGGGCTCTAGG - Intergenic
1198723261 X:139647757-139647779 CAGGCTGCATAGAGGGCTATTGG - Intronic
1199049913 X:143224960-143224982 GAGAGTGCTGAGAGTGTTCTTGG - Intergenic
1201568326 Y:15389256-15389278 GAGGGAGCAGGGATAGCTCTTGG - Intergenic