ID: 984852664

View in Genome Browser
Species Human (GRCh38)
Location 4:184167823-184167845
Sequence GCATATCAACAGATGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 957
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 906}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984852658_984852664 17 Left 984852658 4:184167783-184167805 CCGCAGCTGGTTTGTCCTGATCA 0: 1
1: 0
2: 0
3: 15
4: 147
Right 984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG 0: 1
1: 0
2: 1
3: 49
4: 906
984852660_984852664 2 Left 984852660 4:184167798-184167820 CCTGATCAATGATCACCGGTGAT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG 0: 1
1: 0
2: 1
3: 49
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984852664 Original CRISPR GCATATCAACAGATGGTGCT GGG Intronic
901128537 1:6947043-6947065 TCTTTTCAACAAATGGTGCTGGG - Intronic
903584349 1:24399333-24399355 GCCTTTCAATAAATGGTGCTGGG + Intronic
905136111 1:35801302-35801324 TCTTTTCAACAAATGGTGCTTGG + Intergenic
905231220 1:36515945-36515967 TCAGGTCACCAGATGGTGCTGGG + Intergenic
905633695 1:39534384-39534406 CCTTTTCAACAAATGGTGCTAGG + Intergenic
907095773 1:51779309-51779331 CCTTCTCAACAAATGGTGCTGGG + Intronic
907204258 1:52754931-52754953 GCTTTTCAACAAATGATGCTGGG - Intronic
907227086 1:52958004-52958026 TCTTTTCAACAAATGGTGCTAGG - Intronic
907374891 1:54028512-54028534 GCATAACAAAAGATGGGGCTAGG - Intergenic
907949458 1:59167708-59167730 TCTTTTCAACAGATGGTGCTGGG + Intergenic
908058051 1:60313609-60313631 TCTTTTCAACAAATGGTGCTGGG + Intergenic
908104564 1:60828183-60828205 CCTTTTCAACAAATGGTGCTGGG - Intergenic
908254494 1:62291941-62291963 TCTTTTCAACAAATGGTGCTGGG - Intronic
908298975 1:62742688-62742710 CCTTTTCAACAAATGGTGCTGGG + Intergenic
908310019 1:62871609-62871631 TCTTTTCAACAAATGGTGCTTGG - Intergenic
908502925 1:64762640-64762662 TCTTTTCAACAGATGATGCTAGG + Intronic
909667211 1:78148303-78148325 TCTTTTCAACAAATGGTGCTGGG + Intergenic
909674088 1:78219789-78219811 CCTTTTCAACAAATGGTGCTGGG + Intergenic
909680892 1:78290383-78290405 CCTTTTCAACAAATGGTGCTCGG - Intergenic
909833047 1:80218044-80218066 TCATATCAACAGATGTTACTAGG + Intergenic
909947958 1:81684867-81684889 CCTTTTCAACAAATGGTGCTGGG - Intronic
910101884 1:83585987-83586009 CCTTTTCAACAAATGGTGCTGGG - Intergenic
910242881 1:85106792-85106814 TCTTTTCAACAAATGGTGCTGGG + Intronic
910380833 1:86624932-86624954 CCTTTTCAACAAATGGTGCTGGG + Intergenic
910734028 1:90432368-90432390 CCTTTTCAACAAATGGTGCTGGG + Intergenic
911340401 1:96629257-96629279 TCATTTCAATACATGGTGCTAGG + Intergenic
911689536 1:100816924-100816946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
911716961 1:101144132-101144154 GCTTCTTAACAGAAGGTGCTGGG - Intergenic
912169656 1:107083316-107083338 TCTTTTCAACAAATGGTGCTGGG - Intergenic
912227543 1:107752246-107752268 CCTTTTCAACAAATGGTGCTGGG + Intronic
912611814 1:111054982-111055004 CCTATTCAACAGATGGTGCTGGG - Intergenic
912662567 1:111545853-111545875 TCTTTTCAACAAATGGTGCTGGG - Intronic
913143574 1:115966552-115966574 CCTTTTCAACAAATGGTGCTGGG + Intergenic
913151761 1:116051472-116051494 CCTTTTCAACATATGGTGCTGGG + Intronic
913433251 1:118819106-118819128 CCTTATCAATAAATGGTGCTCGG + Intergenic
913587661 1:120291772-120291794 CCTTTTCAACAAATGGTGCTGGG - Intergenic
913620524 1:120606597-120606619 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914346482 1:146803924-146803946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
914569681 1:148903641-148903663 CCTTTTCAACAAATGGTGCTGGG - Intronic
914603148 1:149226617-149226639 CCTTTTCAACAAATGGTGCTGGG + Intergenic
915045843 1:153014828-153014850 CCTTTTCAACAAATGGTGCTGGG - Intergenic
915961503 1:160270804-160270826 GTTTTTCAACAAATGGTGCTGGG - Intergenic
916910762 1:169343341-169343363 TCTTTTCAACAGATGGTGCTAGG - Intronic
916981087 1:170137794-170137816 CCCTCTCAACAAATGGTGCTGGG + Intergenic
917053789 1:170956048-170956070 CCTTTTCAACAAATGGTGCTGGG - Intronic
917461985 1:175239390-175239412 CCTTTTCAACAAATGGTGCTAGG + Intergenic
917886727 1:179393199-179393221 CCTTTTCAACAAATGGTGCTGGG - Intronic
918172297 1:182010123-182010145 CCTATTCAACAGATGGTGCTGGG + Intergenic
919109184 1:193196222-193196244 CCTTTTCAACAAATGGTGCTGGG - Intronic
919190274 1:194207947-194207969 CCATTTCAACATATGATGCTGGG + Intergenic
919442187 1:197649627-197649649 TCTTTTCAACAAATGGTGCTGGG + Intronic
919514616 1:198507701-198507723 CCTAATCAACAAATGGTGCTGGG - Intergenic
919816165 1:201441323-201441345 TCATTTCAACAAATGGTGCTGGG + Intergenic
920516019 1:206585155-206585177 GCAAACCAAGAGAGGGTGCTGGG - Intronic
921032786 1:211348708-211348730 TCTTTTCAACAAATGGTGCTGGG - Intronic
921033161 1:211351695-211351717 TCTTTTCAACAAATGGTGCTGGG - Intronic
921038927 1:211410623-211410645 TTTTTTCAACAGATGGTGCTGGG + Intergenic
921409559 1:214820906-214820928 CCTTTTCAACAAATGGTGCTGGG - Intergenic
921834921 1:219768635-219768657 CCTTTTCAACAAATGGTGCTGGG + Intronic
921836768 1:219786463-219786485 TCTTTTCAACAAATGGTGCTGGG + Intronic
921846783 1:219891589-219891611 CCATATTAATAAATGGTGCTGGG + Intronic
921909796 1:220535744-220535766 TCTTTTCAACAAATGGTGCTGGG - Intronic
922017036 1:221658962-221658984 TCTTTTCAACATATGGTGCTGGG - Intergenic
922392075 1:225154972-225154994 GGACATCAACAGATAGTTCTTGG + Intronic
922658391 1:227406330-227406352 CCTTTTCAACAAATGGTGCTGGG + Intergenic
922926959 1:229356628-229356650 CCTTTTCAACAAATGGTGCTGGG - Intergenic
922995536 1:229955881-229955903 CCTTTTCAACAAATGGTGCTGGG - Intergenic
923289885 1:232534297-232534319 TCTTTTCAACAAATGGTGCTGGG + Intronic
923446838 1:234079229-234079251 CCTTGTCAACAAATGGTGCTGGG + Intronic
924250326 1:242126569-242126591 GCTATTCAACAAATGGTGCTGGG + Intronic
924882914 1:248182409-248182431 CCTATTCAACAGATGGTGCTGGG - Intergenic
1062870374 10:897286-897308 TCTTGTCAACAAATGGTGCTGGG + Intronic
1063081188 10:2769061-2769083 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1063542391 10:6947169-6947191 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1064700450 10:18013700-18013722 TCCTTTCAAGAGATGGTGCTGGG - Intronic
1065091669 10:22241258-22241280 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1065227658 10:23561728-23561750 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1065470560 10:26076727-26076749 CCTTTTCAACAAATGGTGCTGGG - Intronic
1065712010 10:28527567-28527589 CCATATCAACATATGGTACTAGG - Intergenic
1067346520 10:45442328-45442350 GCATCTAAACAGAAAGTGCTGGG + Intronic
1067398373 10:45945759-45945781 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1067813458 10:49450235-49450257 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1067852989 10:49767507-49767529 GCCTTTCAACAAATGGTACTGGG - Intergenic
1067866686 10:49914844-49914866 TCTTTTCAACAAATGGTGCTGGG + Intronic
1068073558 10:52225719-52225741 CCTTTTCAACAAATGGTGCTGGG - Intronic
1068097810 10:52513826-52513848 CCAATTCAACAAATGGTGCTGGG - Intergenic
1068114881 10:52725871-52725893 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1068387102 10:56344687-56344709 TCTTTTCAACAGATGGTACTAGG + Intergenic
1068532459 10:58204989-58205011 TCCTATCAACAAATGGTGCTGGG + Intronic
1068550372 10:58401344-58401366 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1068559752 10:58500617-58500639 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1068629696 10:59286567-59286589 GGTTATCAAGAGCTGGTGCTGGG + Intronic
1068903437 10:62296524-62296546 TCATTTAAATAGATGGTGCTGGG + Intergenic
1068932086 10:62601799-62601821 TCTTTTCAACAGATGATGCTGGG - Intronic
1069150064 10:64949089-64949111 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1069194826 10:65538112-65538134 GCATTTCAATAAAAGGTGCTGGG + Intergenic
1069302823 10:66928988-66929010 AACTATCAAAAGATGGTGCTAGG + Intronic
1069325796 10:67230230-67230252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1069327400 10:67248353-67248375 TCTTTTCAACAAATGGTGCTAGG + Intronic
1069343109 10:67436232-67436254 CCTTTTCAACAAATGGTGCTGGG + Intronic
1069378073 10:67814268-67814290 TCTTTTCAACAAATGGTGCTAGG + Intronic
1070433617 10:76365973-76365995 CCTTTTCAACAAATGGTGCTGGG - Intronic
1070974237 10:80592602-80592624 TCTTTTCAACAAATGGTGCTTGG - Intronic
1071023795 10:81088442-81088464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1071035036 10:81234533-81234555 CCTTTTCAACAAATGGTGCTCGG - Intergenic
1071040225 10:81299638-81299660 CCTTATCAACAAATGATGCTGGG - Intergenic
1071300399 10:84252170-84252192 TCATATCAAAAGATGCTGCTGGG + Intronic
1071405430 10:85325564-85325586 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1072142131 10:92598327-92598349 GCTTTTCACCAAATGGTGCTGGG - Intronic
1072380502 10:94864287-94864309 CCTTTTCAACAGATGGTGCTGGG - Intergenic
1072815306 10:98502458-98502480 ACTTTTCAACAAATGGTGCTAGG + Intronic
1073169876 10:101497141-101497163 ACATTTCAATAAATGGTGCTAGG - Intronic
1074142980 10:110692002-110692024 TCTTTTCAACAAATGGTGCTGGG - Intronic
1074483268 10:113847987-113848009 GCTTATCAACACATGGTTTTAGG + Intronic
1074985401 10:118654261-118654283 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1075538407 10:123291545-123291567 CCTTTTCAACATATGGTGCTGGG + Intergenic
1075660212 10:124188821-124188843 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1075889280 10:125931939-125931961 CCTTTTCAACAAATGGTGCTGGG - Intronic
1076348078 10:129794417-129794439 GCATATCAAAATATAGTGCAAGG - Intergenic
1077427176 11:2487106-2487128 TCTTTTCAACAAATGGTGCTGGG - Intronic
1077625270 11:3765901-3765923 TCTTTTCAACATATGGTGCTGGG - Intronic
1077731981 11:4741147-4741169 CCTAATCAACAAATGGTGCTGGG - Intronic
1077921478 11:6645151-6645173 GCCTATCAGGGGATGGTGCTGGG - Intronic
1078076254 11:8164104-8164126 TCTTTTCAACAAATGGTGCTGGG + Intronic
1078289047 11:9988171-9988193 CCTTTTCAACAAATGGTGCTGGG + Intronic
1078684246 11:13512779-13512801 CCCTATCAATAAATGGTGCTGGG - Intergenic
1078692916 11:13599780-13599802 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1078967893 11:16368517-16368539 TCTTTTCAACAAATGGTGCTTGG + Intronic
1078988781 11:16623794-16623816 GCAAGTCAACAATTGGTGCTGGG - Intronic
1079518610 11:21298257-21298279 GCAGAGCTACTGATGGTGCTGGG - Intronic
1079791261 11:24742925-24742947 CCTTTTCAACAAATGGTGCTGGG - Intronic
1080672127 11:34390243-34390265 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1080709107 11:34729239-34729261 ACAATTCAACAAATGGTGCTAGG - Intergenic
1081009384 11:37789615-37789637 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1081068517 11:38578344-38578366 GCATATCAACATGAGGTGTTTGG + Intergenic
1081106110 11:39071880-39071902 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1083017085 11:59465484-59465506 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1083180140 11:60979975-60979997 GCATATGCATAGCTGGTGCTTGG - Intronic
1084608984 11:70188807-70188829 GCATTTCCACAGATGGTGTCAGG + Exonic
1084803217 11:71560036-71560058 GTACTTCAACAAATGGTGCTGGG + Intronic
1085485196 11:76857748-76857770 GTCTTTCAACAAATGGTGCTGGG - Intergenic
1086013848 11:82139870-82139892 CCCTATCAATAAATGGTGCTAGG + Intergenic
1086082397 11:82918317-82918339 CCTTTTCAACAAATGGTGCTGGG - Intronic
1086492013 11:87365057-87365079 GCATATGAGCAGAGGCTGCTAGG - Intergenic
1086819384 11:91416197-91416219 CCTATTCAACAGATGGTGCTAGG + Intergenic
1086824877 11:91484427-91484449 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1087442511 11:98204746-98204768 CCACTTCAACAAATGGTGCTGGG + Intergenic
1087602432 11:100333693-100333715 CCATTTCAACAAATGGTGCTGGG + Intronic
1087631806 11:100658943-100658965 GCTGTTCAACAAATGGTGCTGGG + Intergenic
1087992645 11:104764790-104764812 GTATCTAAACAGAAGGTGCTGGG + Intergenic
1088112139 11:106274533-106274555 GCAAGTCAATAAATGGTGCTGGG - Intergenic
1088206839 11:107401990-107402012 CCTTTTCAACAAATGGTGCTGGG + Intronic
1088240087 11:107764834-107764856 TCTTGTCAACAAATGGTGCTGGG + Intergenic
1088414207 11:109570966-109570988 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1088642898 11:111890452-111890474 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1089548313 11:119248375-119248397 TCTTTTCAACAAATGGTGCTGGG + Intronic
1090142651 11:124281168-124281190 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1090813836 11:130272796-130272818 GCTTTTTAACAGATGGTACTGGG - Intronic
1091210056 11:133849608-133849630 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1091455388 12:603633-603655 TCTTTTCAACAAATGGTGCTGGG - Intronic
1091569712 12:1674115-1674137 TCTTTTCAACAAATGGTGCTTGG - Intergenic
1091772402 12:3161472-3161494 TTATGTCAACAAATGGTGCTGGG - Intronic
1092399300 12:8160056-8160078 CCTTTTCAACAAATGGTGCTGGG - Intronic
1092656872 12:10695089-10695111 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1092774933 12:11935359-11935381 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1093011034 12:14107044-14107066 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1093408812 12:18840483-18840505 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1093540377 12:20276147-20276169 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1093951978 12:25172861-25172883 CCTTTTCAACAAATGGTGCTGGG + Intronic
1093995413 12:25635892-25635914 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094253081 12:28388765-28388787 CCTTTTCAACAAATGGTGCTGGG + Intronic
1094422605 12:30287307-30287329 TATTTTCAACAGATGGTGCTGGG - Intergenic
1094628695 12:32151049-32151071 GCATCAAAACAGATGGTGGTGGG + Intronic
1094645062 12:32315185-32315207 TCTTTTCAACAAATGGTGCTGGG - Intronic
1094802444 12:34052376-34052398 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1095115605 12:38348315-38348337 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1095117855 12:38377342-38377364 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1095229044 12:39715294-39715316 CCTTTTCAACAAATGGTGCTGGG - Intronic
1095247671 12:39941942-39941964 CCTTTTCAACAGATGGTGTTGGG - Intronic
1095394931 12:41751071-41751093 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1095531645 12:43193516-43193538 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1095733108 12:45526800-45526822 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1095743994 12:45636995-45637017 GGTTTTCAACAGATGGTGCTGGG + Intergenic
1096012218 12:48228876-48228898 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1096168194 12:49443311-49443333 TCTTTTCAACAAATGGTGCTGGG - Intronic
1096279279 12:50237849-50237871 TCTTTTCAACAAATGGTGCTAGG + Intronic
1096345884 12:50846372-50846394 ACTTTTCAATAGATGGTGCTGGG - Intronic
1096437463 12:51606321-51606343 CCTTTTCAACAAATGGTGCTGGG - Intronic
1097056930 12:56255974-56255996 GCCCCTCAACAGAAGGTGCTGGG - Exonic
1097059521 12:56272201-56272223 GCATATTAAAAGATGGGGGTTGG + Exonic
1097200611 12:57275227-57275249 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097303961 12:58048508-58048530 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1097321824 12:58234070-58234092 GTATATCAACAGGTGGAGGTGGG - Intergenic
1097465956 12:59924785-59924807 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1097607500 12:61773615-61773637 CCTTTTCAACAAATGGTGCTAGG + Intronic
1097608830 12:61791113-61791135 TCTCATCAATAGATGGTGCTGGG + Intronic
1097638943 12:62155702-62155724 CCTTTTCAACAAATGGTGCTGGG + Intronic
1097660152 12:62421323-62421345 CCACTTCAACAAATGGTGCTGGG + Intergenic
1097760867 12:63462430-63462452 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1098032629 12:66269913-66269935 GCCAATCAACAGATGCTGCCTGG - Intergenic
1098347414 12:69520648-69520670 CCTAATCAACAAATGGTGCTAGG - Intronic
1098689521 12:73469116-73469138 ACTATTCAACAGATGGTGCTGGG - Intergenic
1098841223 12:75480424-75480446 TCATATCAACACATAGTGGTTGG - Intergenic
1099243886 12:80171427-80171449 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1099393136 12:82103964-82103986 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1099472604 12:83069921-83069943 CCTTTTCAACAAATGGTGCTGGG - Intronic
1099554085 12:84088094-84088116 TATTTTCAACAGATGGTGCTGGG - Intergenic
1099777019 12:87146845-87146867 CCTTGTCAACAAATGGTGCTGGG - Intergenic
1100742756 12:97612775-97612797 GCTTTTCAACAAATGGTGCTGGG + Intergenic
1100970824 12:100068256-100068278 ACTTTTCAACAAATGGTGCTGGG + Intronic
1101634868 12:106531006-106531028 CCTTTTCAACAAATGGTGCTGGG - Intronic
1101644030 12:106611851-106611873 TCTTTTCAACAAATGGTGCTGGG - Intronic
1101890256 12:108707440-108707462 TCTTCTCAACAGATGGTACTGGG + Intronic
1102267943 12:111504601-111504623 TCTTTTTAACAGATGGTGCTGGG + Intronic
1102811589 12:115828853-115828875 CCAAATCAACAGAAGGTGATTGG - Intergenic
1102916270 12:116755219-116755241 CCTTTTCAACAAATGGTGCTGGG - Intronic
1102949094 12:117016864-117016886 TCTTTTCAACAGATGGTGCCAGG - Intronic
1104332956 12:127864780-127864802 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1105203598 13:18200682-18200704 TCCTCTCAATAGATGGTGCTGGG - Intergenic
1105266572 13:18823814-18823836 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1105515290 13:21084169-21084191 TCATTTCAACAAATGGTGCCAGG + Intergenic
1105680018 13:22716566-22716588 GCCTTTCATCAAATGGTGCTGGG - Intergenic
1105730242 13:23207226-23207248 TCTGTTCAACAGATGGTGCTGGG + Intronic
1105908693 13:24839640-24839662 CCTTTTCAACAAATGGTGCTGGG + Intronic
1105931206 13:25054265-25054287 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106346253 13:28881969-28881991 TCTTTTCAACAAATGGTGCTAGG + Intronic
1106691472 13:32122011-32122033 CCTTTTCAACAAATGGTGCTGGG - Intronic
1106921169 13:34564864-34564886 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1106958969 13:34975369-34975391 CCTATTCAACAGATGGTGCTGGG + Intronic
1107297584 13:38927809-38927831 TCTTTTCAACAGATGATGCTGGG + Intergenic
1107329325 13:39281794-39281816 GCATATCAACAGCTTGTCTTTGG - Intergenic
1107453163 13:40530595-40530617 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1107755579 13:43618471-43618493 CCTTTTCAACAAATGGTGCTGGG - Intronic
1108064871 13:46566742-46566764 GCATTTCTACAGATGGTCCTCGG + Intronic
1108288604 13:48934277-48934299 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1109077989 13:57862825-57862847 ACATAGCTACAGATGGTGATAGG + Intergenic
1109125775 13:58515238-58515260 CCTTGTCAACAAATGGTGCTGGG + Intergenic
1109213208 13:59558800-59558822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1109346630 13:61122868-61122890 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1110723507 13:78792656-78792678 GGATATCAACAGGTGATGATTGG + Intergenic
1110975565 13:81829603-81829625 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1111561094 13:89947931-89947953 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1111747912 13:92292898-92292920 TCTTTTCAACAAATGGTGCTGGG - Intronic
1111757454 13:92416480-92416502 TCTTTTCAACAAATGGTGCTGGG + Intronic
1111988827 13:95094427-95094449 CCTTTTCAACAAATGGTGCTGGG + Intronic
1112747714 13:102545928-102545950 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1113232342 13:108226718-108226740 ACATCTCAGCAGATGGTGCATGG + Intronic
1114180308 14:20361188-20361210 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1114570429 14:23663565-23663587 GCACATCATCAGATTTTGCTAGG - Intergenic
1114961117 14:27891050-27891072 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1115161594 14:30402551-30402573 GAATATCAAGAGATGTTGCATGG + Intergenic
1115526784 14:34288644-34288666 CCTTTTCAACAAATGGTGCTGGG - Intronic
1116223724 14:42120601-42120623 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1116417032 14:44690546-44690568 TCATTTCAATACATGGTGCTTGG + Intergenic
1116513386 14:45775056-45775078 GCTTTTCAACAAATGGTGCTGGG - Intergenic
1116751093 14:48884911-48884933 TATTTTCAACAGATGGTGCTAGG - Intergenic
1116773998 14:49158954-49158976 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1118162714 14:63306695-63306717 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1118197033 14:63636674-63636696 CCTTTTCAACAAATGGTGCTGGG + Intronic
1118392981 14:65311608-65311630 GCATATGAACAGATGATTTTAGG + Intergenic
1118489521 14:66245475-66245497 GATTATCAACAGAAGGTGCTGGG + Intergenic
1118928890 14:70221079-70221101 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1119056247 14:71423544-71423566 TCCTTTCAACAAATGGTGCTGGG - Intronic
1119493540 14:75058764-75058786 TCACTTCAACAAATGGTGCTGGG + Intronic
1119523825 14:75306473-75306495 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1120126192 14:80746497-80746519 TCTTACCAACAAATGGTGCTAGG + Intronic
1120288935 14:82541915-82541937 ACTTTTCAACAAATGGTGCTGGG - Intergenic
1120695629 14:87641154-87641176 GCAAAACAGCAGATGGTGCTTGG + Intergenic
1120776351 14:88442073-88442095 GCTATTCAACAAATGGTGCTGGG - Intronic
1121247014 14:92468664-92468686 TCTTTTCAACAAATGGTGCTAGG + Intronic
1121316879 14:92966853-92966875 TCGTTTCAACAAATGGTGCTTGG + Intronic
1121516180 14:94551911-94551933 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1122095612 14:99368933-99368955 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1122432366 14:101662105-101662127 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1202831955 14_GL000009v2_random:44267-44289 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1124421144 15:29523794-29523816 TCTTTTCAACAAATGGTGCTGGG + Intronic
1124427703 15:29576240-29576262 TCTCTTCAACAGATGGTGCTGGG + Intergenic
1124435214 15:29642920-29642942 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1124806683 15:32890970-32890992 CCTTTTCAACAAATGGTGCTGGG - Intronic
1125217941 15:37299095-37299117 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1125268952 15:37916865-37916887 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1125377427 15:39045479-39045501 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1126060060 15:44772102-44772124 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1126247932 15:46531560-46531582 GCTATTCAACAAATGGTGCTGGG + Intergenic
1126269464 15:46797594-46797616 GCTTTTCAATAAATGGTGCTAGG + Intergenic
1126460385 15:48908783-48908805 CCTTTTCAACAAATGGTGCTGGG - Intronic
1126816156 15:52456728-52456750 TCACCTCAATAGATGGTGCTGGG + Intronic
1127050557 15:55079151-55079173 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1127194864 15:56573276-56573298 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1127356136 15:58201900-58201922 GCTTTTCAACAAATGGTGCTGGG + Intronic
1127525190 15:59785989-59786011 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1127929703 15:63584981-63585003 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1128415469 15:67441645-67441667 CCTTTTCAACAAATGGTGCTGGG + Intronic
1128445191 15:67753102-67753124 TCTTTTCAACAAATGGTGCTGGG + Intronic
1128531812 15:68457463-68457485 TCATTTCAATAGATGGTGCTAGG + Intergenic
1129046710 15:72741683-72741705 CCTATTCAACAGATGGTGCTGGG + Intergenic
1129096500 15:73214504-73214526 CCTTTTCAACAAATGGTGCTGGG - Intronic
1130246420 15:82254010-82254032 TCATATCAACAGATAATTCTTGG - Intronic
1130731813 15:86501679-86501701 CCTTTTCAACAAATGGTGCTAGG - Intronic
1130779960 15:87025916-87025938 CCTTTTCAACAAATGGTGCTGGG + Intronic
1130790851 15:87154521-87154543 CTTTTTCAACAGATGGTGCTGGG + Intergenic
1130852396 15:87807534-87807556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1132033801 15:98462382-98462404 TCTTTTCAACAAATGGTGCTGGG + Intronic
1134333947 16:13277147-13277169 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1134388728 16:13798344-13798366 GTACATCACCAGAAGGTGCTTGG + Intergenic
1134996867 16:18746031-18746053 GCATATCAGTGGAGGGTGCTTGG - Intergenic
1135674023 16:24399637-24399659 GTCTTTCAACAAATGGTGCTGGG + Intergenic
1135774823 16:25248007-25248029 TCTTTTCAACAAATGGTGCTCGG + Intronic
1137512138 16:49110535-49110557 AAATATCAACAGCTGGTGTTTGG + Intergenic
1137656942 16:50168034-50168056 TCATTTCAACAAATGGTTCTGGG - Intronic
1137742678 16:50795698-50795720 GCACATCTACAGATGGGGCTGGG - Intronic
1137998835 16:53252310-53252332 GCTATTCAACAAATGGTGCTGGG + Intronic
1138924316 16:61572219-61572241 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1140064386 16:71598339-71598361 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1140620088 16:76719293-76719315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1141207153 16:81941423-81941445 GCAGCTCCCCAGATGGTGCTTGG + Intronic
1141916966 16:87105050-87105072 TCTTTTCAACAAATGGTGCTGGG - Intronic
1142293538 16:89204354-89204376 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1144139256 17:12332065-12332087 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1144158010 17:12526788-12526810 TCTGTTCAACAGATGGTGCTGGG - Intergenic
1144434319 17:15225826-15225848 GCTTTTCAACAAATGGTGCTGGG - Intergenic
1144532583 17:16053952-16053974 CCCTATCAATAAATGGTGCTGGG + Intronic
1144799601 17:17916502-17916524 TCTTTTCAACAAATGGTGCTGGG - Intronic
1146583798 17:34064285-34064307 CCTTTTCAACAAATGGTGCTGGG + Intronic
1146750931 17:35379388-35379410 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1146751045 17:35380837-35380859 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1146960444 17:36970838-36970860 TCTTTTCAACAAATGGTGCTGGG + Intronic
1147462733 17:40584325-40584347 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1148893651 17:50826807-50826829 TCTTTTCAACAGACGGTGCTGGG - Intergenic
1149006548 17:51811973-51811995 GCATATCAGCAAGAGGTGCTAGG - Intronic
1149410501 17:56400820-56400842 CCTTTTCAACAAATGGTGCTGGG - Intronic
1149934852 17:60794636-60794658 CCTTTTCAACAAATGGTGCTGGG - Intronic
1150027722 17:61695223-61695245 TCTTTTCAACAGATGGTGTTGGG - Intronic
1151048779 17:70952400-70952422 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1151330247 17:73402217-73402239 GCCAATCAACAGATGGTGTCCGG + Intronic
1153069095 18:1084783-1084805 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1153079516 18:1206015-1206037 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153168519 18:2289144-2289166 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1153402286 18:4694304-4694326 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1153958498 18:10119862-10119884 TCTTATCAACAAATGATGCTGGG + Intergenic
1154129674 18:11725988-11726010 TCTTTTCAAAAGATGGTGCTGGG - Intronic
1154421842 18:14237659-14237681 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1156614197 18:38764076-38764098 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1156926853 18:42592163-42592185 CCTTATCAATAAATGGTGCTGGG - Intergenic
1157023962 18:43820534-43820556 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1157219420 18:45816048-45816070 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1157601980 18:48898884-48898906 TCTTTTCAACAGATGGTGTTGGG + Intergenic
1158003023 18:52641124-52641146 CCTTTTCAACAAATGGTGCTGGG + Intronic
1158062954 18:53368673-53368695 TCTTTTCAACAAATGGTGCTGGG - Intronic
1158444029 18:57503099-57503121 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1158756912 18:60336236-60336258 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1160252544 18:77215844-77215866 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1160267118 18:77348393-77348415 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1160287124 18:77554085-77554107 GAATATCAAAGGATGGGGCTGGG - Intergenic
1160627620 18:80223028-80223050 TCTTTTCAACAAATGGTGCTGGG + Intronic
1162244209 19:9385745-9385767 GTGTAGCAACAGCTGGTGCTGGG + Intergenic
1163510363 19:17731340-17731362 TCTTTTCAACAAATGGTGCTGGG - Intronic
1164125264 19:22309134-22309156 TCTTTTCAACAAATGGTGCTGGG - Intronic
1164298812 19:23940248-23940270 CCTTTTCAACAAATGGTGCTGGG - Intronic
1164976642 19:32578234-32578256 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1165054893 19:33169003-33169025 TCTTTTCAACAAATGGTGCTAGG + Intronic
1165870239 19:38966818-38966840 TCTTTTCAACAAATGGTGCTGGG + Intronic
1166289323 19:41851636-41851658 GCAGAGCAACAGAGGGGGCTGGG - Exonic
1167407515 19:49323126-49323148 TCTTTTCAACAAATGGTGCTGGG + Intronic
1202640728 1_KI270706v1_random:83485-83507 TCTTTTCAACAAATGGTGCTGGG + Intergenic
926187455 2:10702281-10702303 GCTTTTCAACAAATGGTACTGGG + Intergenic
926560573 2:14412924-14412946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
927267610 2:21170241-21170263 GCTATTCAACAAATGGTGCTGGG - Intergenic
927327940 2:21828005-21828027 CCTTTTCAACAAATGGTGCTGGG - Intergenic
928851396 2:35751411-35751433 TCTTTTCAACAAATGGTGCTGGG + Intergenic
929009883 2:37430639-37430661 CCTTTTCAACAAATGGTGCTGGG - Intergenic
929339659 2:40799638-40799660 CCATTTTAACAAATGGTGCTGGG - Intergenic
929647454 2:43641726-43641748 TCTTTTCAACAGATGATGCTGGG - Intronic
929797520 2:45071689-45071711 GCATTCCAACAGATGGAGATGGG - Intergenic
929806260 2:45148226-45148248 CCTTTTCAACAAATGGTGCTGGG + Intergenic
930211672 2:48645560-48645582 CAAAATCAAGAGATGGTGCTCGG - Intronic
930486112 2:52013360-52013382 CCTTTTCAACAAATGGTGCTGGG - Intergenic
931123917 2:59252570-59252592 GCACCTGAACAGATGGTGCCTGG - Intergenic
931524690 2:63140045-63140067 CCTTTTCAACAAATGGTGCTGGG - Intronic
931993278 2:67812466-67812488 CCTTTTCAACAGATGGTGCTGGG + Intergenic
932270772 2:70407424-70407446 CCTTTTCAACAAATGGTGCTGGG + Intergenic
932925836 2:75973332-75973354 CCTAATCAACAAATGGTGCTGGG + Intergenic
933145835 2:78851589-78851611 GCATGTCAAGAGAAGTTGCTGGG - Intergenic
933231724 2:79815493-79815515 TCTTTTCAACAAATGGTGCTGGG - Intronic
933855456 2:86409580-86409602 TCTTTTCAACAAATGGTGCTGGG + Intergenic
933872841 2:86586399-86586421 TCTTTTCAACAAATGGTGCTGGG + Intronic
934044180 2:88158327-88158349 CCTTTTCAACAAATGGTGCTGGG - Intergenic
934496285 2:94803458-94803480 TCTTTTCAACAAATGGTGCTGGG + Intergenic
934536091 2:95134823-95134845 TCTTTTCAACAAATGGTGCTGGG - Intronic
934885261 2:98018970-98018992 TCTTTTCAACAGATAGTGCTGGG - Intergenic
935467564 2:103417063-103417085 CCTTTTCAACAAATGGTGCTGGG + Intergenic
935633141 2:105228453-105228475 TCTTTTCAACAAATGGTGCTGGG + Intergenic
935826837 2:106960700-106960722 TCATTTCAAGAAATGGTGCTAGG + Intergenic
935964898 2:108463857-108463879 CCATATCCACAGGTGGTGCATGG + Intronic
936176324 2:110223777-110223799 TCTTTTCAACAAATGGTGCTGGG - Intergenic
936407454 2:112219340-112219362 GTCTTTCAACAAATGGTGCTAGG + Intronic
936555255 2:113491405-113491427 CCTTTTCAACAAATGGTGCTGGG + Intronic
937058277 2:118958895-118958917 CCTTTTCAACAAATGGTGCTGGG + Intronic
937068832 2:119045902-119045924 CCTTTTCAACAAATGGTGCTGGG - Intergenic
937178968 2:119971875-119971897 TCATTTTAACAAATGGTGCTGGG - Intronic
937581219 2:123490857-123490879 TCTTTTCAACAAATGGTGCTGGG + Intergenic
937899653 2:127009249-127009271 TCTTTTCAACAAATGGTGCTGGG - Intergenic
937992040 2:127669177-127669199 TCTTATCAACAAATGATGCTAGG + Intronic
938068882 2:128297284-128297306 TCTTTTCAACAAATGGTGCTGGG + Intronic
938597845 2:132806989-132807011 CCTTTTCAACAAATGGTGCTAGG - Intronic
938844291 2:135192790-135192812 TCTTTTCAACAAATGGTGCTGGG + Intronic
939610591 2:144305334-144305356 TCTTTTCAACAGATGGTGCTGGG - Intronic
940028263 2:149231867-149231889 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940680726 2:156781694-156781716 CCTTTTCAACAAATGGTGCTGGG + Intergenic
940707212 2:157120278-157120300 CCTTTTCAACAAATGGTGCTGGG - Intergenic
940709002 2:157139570-157139592 CCTTTTCAACAAATGGTGCTGGG - Intergenic
941425201 2:165335511-165335533 CCTTTTCAACAAATGGTGCTTGG + Intronic
941627841 2:167849489-167849511 CCTTTTCAACAAATGGTGCTGGG + Intergenic
941631242 2:167887001-167887023 TCTTTTCAACAAATGGTGCTGGG - Intergenic
942056322 2:172186887-172186909 TCTTTTCAACAAATGGTGCTGGG - Intergenic
942154330 2:173111656-173111678 CCTTTTCAACAAATGGTGCTGGG - Intronic
942180524 2:173376378-173376400 TCTTTTCAACAAATGGTGCTGGG - Intergenic
942365119 2:175218025-175218047 TAATTTCAACAAATGGTGCTAGG + Intergenic
942726536 2:179014180-179014202 CCTTTTCAACAAATGGTGCTGGG + Intronic
942739390 2:179157054-179157076 CCTTTTCAACAAATGGTGCTGGG - Intronic
942817916 2:180074390-180074412 CCTAATCAATAGATGGTGCTGGG + Intergenic
942842995 2:180386675-180386697 ACTTTTCAACAAATGGTGCTGGG - Intergenic
943620922 2:190147232-190147254 CCTTTTCAACAAATGGTGCTAGG - Intronic
944031901 2:195244549-195244571 CCAATTCAACAAATGGTGCTAGG + Intergenic
944421106 2:199531224-199531246 CCTTTTCAACAAATGGTGCTGGG + Intergenic
944528489 2:200644293-200644315 CCTTTTCAACAAATGGTGCTAGG - Intronic
944771996 2:202923884-202923906 CCTATTCAACAGATGGTGCTGGG + Intronic
944830653 2:203530996-203531018 TCCTTTCAACAAATGGTGCTGGG + Intronic
945075557 2:206035497-206035519 CCCTTTCAACAAATGGTGCTGGG + Intronic
945452844 2:210013669-210013691 CCATATCAACAGAAGTTTCTTGG + Intronic
945826222 2:214723107-214723129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
945838670 2:214862464-214862486 CCTTTTCAACAAATGGTGCTGGG - Intergenic
945861250 2:215125035-215125057 CCTTTTCAACAAATGGTGCTGGG - Intronic
945865187 2:215166542-215166564 CCTTTTCAACAAATGGTGCTGGG + Intergenic
948347349 2:237310106-237310128 GTATACCAACAGATGGTGCTGGG + Intergenic
1168737199 20:151234-151256 TCACTTCAACAGATGGTGTTGGG + Intergenic
1169401780 20:5287713-5287735 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1169517041 20:6328583-6328605 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1169969832 20:11257791-11257813 GCTATTCAACAAATGGTGCTGGG + Intergenic
1170054333 20:12182843-12182865 CCCTTTCAACAAATGGTGCTAGG - Intergenic
1170752187 20:19159986-19160008 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1170862744 20:20123485-20123507 CCTTATCAACAAATGGTGCTGGG - Intronic
1170984762 20:21247389-21247411 CCATTTCAACAAATGATGCTGGG + Intergenic
1171789456 20:29506882-29506904 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1171858083 20:30367558-30367580 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1172378342 20:34465130-34465152 TCTTTTCAACAAATGGTGCTTGG - Intronic
1172469821 20:35184313-35184335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1172564778 20:35920709-35920731 GCATGTCCACTGGTGGTGCTGGG - Intronic
1172879031 20:38185948-38185970 GTCTTTCAACAAATGGTGCTAGG - Intergenic
1173330872 20:42075385-42075407 TCATGTCAACAGGTTGTGCTGGG - Exonic
1173716746 20:45214537-45214559 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1173901147 20:46589757-46589779 GCCTTTCAACAAATGGTGCTAGG + Intronic
1174411072 20:50336179-50336201 CCTTTTCAACAGATCGTGCTGGG + Intergenic
1174600691 20:51722099-51722121 CCTTTTCAACAAATGGTGCTGGG + Intronic
1176714371 21:10337395-10337417 TCCTCTCAATAGATGGTGCTGGG + Intergenic
1176851639 21:13922301-13922323 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1176873380 21:14102156-14102178 GCATTTCAACAGGTCGTGATGGG + Intergenic
1176906481 21:14507965-14507987 CCTTTTCAACAAATGGTGCTAGG + Intronic
1177325689 21:19585744-19585766 TCATCTCAATAAATGGTGCTGGG - Intergenic
1177346095 21:19873417-19873439 CCTTTTTAACAGATGGTGCTGGG + Intergenic
1177548703 21:22593413-22593435 CCTTATCAACAAATGGTGCTGGG + Intergenic
1177578391 21:22988100-22988122 AAAGATCAATAGATGGTGCTGGG + Intergenic
1177688317 21:24469029-24469051 CAATTTCAACAAATGGTGCTGGG + Intergenic
1177750046 21:25269947-25269969 CCAGTTCAACAAATGGTGCTGGG + Intergenic
1178054876 21:28787121-28787143 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1178346902 21:31837170-31837192 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1179024684 21:37670096-37670118 TCTTTTCAACAAATGGTGCTGGG - Intronic
1179100831 21:38354510-38354532 GCAGATCTACAGATGGCCCTTGG - Intergenic
1179191876 21:39129830-39129852 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1179806493 21:43841401-43841423 TCTTTTCAACAGATGGTGCTGGG - Intergenic
1180361216 22:11898377-11898399 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1180409604 22:12592747-12592769 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1180580685 22:16833420-16833442 GCCTTTCAACAAATGGTGCTAGG - Intergenic
1182785046 22:32900273-32900295 GGATCTGAAAAGATGGTGCTGGG - Intronic
1184953980 22:47869464-47869486 TCTTTTCAACAGATTGTGCTGGG + Intergenic
1185321708 22:50203625-50203647 ACTTTTCAACAAATGGTGCTGGG + Intronic
949170889 3:995103-995125 GCATCTCATCAGATGGTGGAAGG - Intergenic
949176269 3:1066558-1066580 TCATTTCAATAAATGGTGCTGGG + Intergenic
949727400 3:7065422-7065444 CCTTTTCAACAAATGGTGCTGGG - Intronic
949814667 3:8045457-8045479 CCTTTTCAACAAATGGTGCTGGG + Intergenic
950165662 3:10795836-10795858 TCTTTTCAACAAATGGTGCTGGG + Intergenic
950319604 3:12038135-12038157 TCTTTTCAACAAATGGTGCTGGG - Intronic
950537917 3:13591909-13591931 CCTTTTCAACACATGGTGCTGGG - Intronic
950599668 3:14021894-14021916 CCAGTTCAACAAATGGTGCTAGG - Intronic
951260274 3:20499465-20499487 ACTTTTCAACAAATGGTGCTGGG - Intergenic
951353639 3:21637333-21637355 CCTTTTCAACAAATGGTGCTGGG - Intronic
951444062 3:22756394-22756416 CCTTTTCAACACATGGTGCTGGG + Intergenic
951572033 3:24074308-24074330 CCTTTTCAACAAATGGTGCTGGG - Intergenic
951763837 3:26174696-26174718 CCTTTTCAACAAATGGTGCTAGG - Intergenic
951852398 3:27156046-27156068 CCTTTTCAACAAATGGTGCTGGG + Intronic
951967530 3:28403802-28403824 TCTTTTCAACAAATGGTGCTGGG + Intronic
952097018 3:29965959-29965981 CCTTTTCAACAAATGGTGCTGGG - Intronic
952973105 3:38668320-38668342 ACTTTTCAACAAATGGTGCTGGG - Intergenic
953004166 3:38962099-38962121 CCTTTTCAACAAATGGTGCTGGG - Intergenic
953255270 3:41284503-41284525 CCCTTTCAACAAATGGTGCTGGG + Intronic
953511608 3:43546534-43546556 TCTTTTCAACAAATGGTGCTGGG + Intronic
953554110 3:43928799-43928821 GTCTTTCAACAAATGGTGCTGGG + Intergenic
953774372 3:45802936-45802958 GGATATCAAGATATGGTGGTGGG - Intergenic
955283995 3:57621239-57621261 ACCTTTCAACAAATGGTGCTGGG + Intergenic
955304100 3:57812304-57812326 TCTTTTCAACAAATGGTGCTAGG - Intronic
955477143 3:59349042-59349064 CCTTTTCAACAAATGGTGCTGGG - Intergenic
955682487 3:61516613-61516635 TCTTTTCAACAAATGGTGCTGGG + Intergenic
955827029 3:62958434-62958456 TCTTTTCAACAAATGGTGCTGGG - Intergenic
955859700 3:63314966-63314988 CCTTTTCAACAAATGGTGCTGGG - Intronic
955968804 3:64416115-64416137 CCCTATCAATAGATGGTGTTAGG + Intronic
956024327 3:64966316-64966338 TCTCTTCAACAGATGGTGCTAGG - Intergenic
956071209 3:65453999-65454021 GTATTTCAACAGATGGTGACTGG + Intronic
956111439 3:65873733-65873755 CCTTTTCAACAAATGGTGCTGGG + Intronic
957015831 3:75064050-75064072 CCTTTTCAACAAATGGTGCTGGG - Intergenic
957428031 3:80065075-80065097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
957483634 3:80830222-80830244 GTTTTTCAACAGATGCTGCTGGG - Intergenic
957662535 3:83179304-83179326 ACATAGCAACATATGCTGCTTGG - Intergenic
957972072 3:87395105-87395127 TCTTTTCAACAAATGGTGCTGGG + Intergenic
958480393 3:94638778-94638800 CCTTTTCAACAAATGGTGCTGGG - Intergenic
958490212 3:94763125-94763147 TCTTTTCAACAAATGGTGCTGGG - Intergenic
959039929 3:101409694-101409716 TCTTTTCAACAAATGGTGCTGGG + Intronic
959131897 3:102366484-102366506 CCTTTTCAACAAATGGTGCTGGG - Intronic
959274921 3:104266511-104266533 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959325264 3:104928996-104929018 CCTTTTCAACAAATGGTGCTGGG - Intergenic
959436571 3:106322145-106322167 CCTTTTCAACAAATGGTGCTGGG + Intergenic
959878164 3:111411340-111411362 CCTAATCAACAAATGGTGCTGGG + Intronic
960077824 3:113508041-113508063 TCTTTTCAACAGATGGTGCTGGG + Intronic
960524837 3:118697799-118697821 CCTTTTCAACAAATGGTGCTGGG + Intergenic
960547341 3:118931131-118931153 TCTTTTCAACAAATGGTGCTGGG + Intronic
960559792 3:119071556-119071578 TCTTTTCAACAAATGGTGCTTGG - Intronic
961113769 3:124310671-124310693 TCTTTTCAACAAATGGTGCTGGG + Intronic
961264319 3:125628609-125628631 CCTTTTCAACAAATGGTGCTGGG - Intergenic
961468372 3:127095811-127095833 CCCTTTCAACAAATGGTGCTGGG - Intergenic
962487208 3:135855760-135855782 TCTTTTCAACAAATGGTGCTGGG + Intergenic
963113328 3:141704550-141704572 CCTTTTCAACAAATGGTGCTGGG + Intergenic
963166375 3:142208523-142208545 TTTTTTCAACAGATGGTGCTGGG - Intronic
963242340 3:143019514-143019536 TCTTTTCAACAAATGGTGCTTGG - Intronic
963554854 3:146774113-146774135 GCAAAATAACAGATGGGGCTAGG - Intergenic
963699702 3:148609177-148609199 CCTTTTCAACAAATGGTGCTGGG - Intergenic
964166302 3:153709933-153709955 CCTTTTCAACAAATGGTGCTGGG + Intergenic
964224306 3:154379676-154379698 ACTTTTCAACAAATGGTGCTGGG - Intronic
964430102 3:156596564-156596586 CCTTTTCAACAAATGGTGCTGGG + Intergenic
964678244 3:159307805-159307827 GCTAATCAATAAATGGTGCTGGG - Intronic
964725611 3:159811516-159811538 TCTTTTCAACAGATGGTGCTGGG - Intronic
965052345 3:163667010-163667032 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965200678 3:165654113-165654135 CCTTTTCAACAAATGGTGCTGGG - Intergenic
965345542 3:167544603-167544625 GCTATTCAACAAATGGTGCTAGG + Intronic
965933966 3:174082272-174082294 GCATATCAAAAGTGAGTGCTGGG - Intronic
965989297 3:174797189-174797211 TCTTTTCAATAGATGGTGCTGGG - Intronic
966117298 3:176480727-176480749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966164430 3:177001242-177001264 CCTTTTCAACAAATGGTGCTGGG - Intergenic
966344114 3:178959500-178959522 CCTTTTCAACAAATGGTGCTGGG - Intergenic
967349686 3:188499359-188499381 TCTTTTCAACAAATGGTGCTGGG - Intronic
967863310 3:194169864-194169886 GCATTTCAACAGATCTTACTGGG + Intergenic
1202737824 3_GL000221v1_random:23902-23924 TCTTTTCAACAAATGGTGCTGGG - Intergenic
969146187 4:5125988-5126010 GCTTCTCAACAAATGGTGCCAGG - Intronic
969546489 4:7832911-7832933 CCTTTTCAACAAATGGTGCTGGG + Intronic
970019536 4:11551874-11551896 ACTTTTCAATAGATGGTGCTAGG - Intergenic
970217058 4:13770449-13770471 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970640575 4:18061167-18061189 TCATTTCAACAAATGGTGCTGGG - Intergenic
970658237 4:18255783-18255805 CCTTTTCAACAAATGGTGCTGGG - Intergenic
970684213 4:18547512-18547534 TCTTTTCAATAGATGGTGCTGGG - Intergenic
970874464 4:20853400-20853422 CCTTTTCAACAAATGGTGCTGGG + Intronic
971182714 4:24344986-24345008 CCTTTTCAACAAATGGTGCTGGG - Intergenic
971276297 4:25200666-25200688 CCTTTTCAACAAATGGTGCTGGG + Intronic
971565164 4:28129904-28129926 CCTTTTCAACAAATGGTGCTGGG + Intergenic
971812854 4:31449965-31449987 TCTTTTCAACAAATGGTGCTAGG - Intergenic
972013775 4:34218029-34218051 CCATTTCAACAAATGATGCTGGG + Intergenic
972269614 4:37498142-37498164 CCCTTTCAACAAATGGTGCTTGG - Intronic
972624501 4:40783273-40783295 TCTTTTCAACAAATGGTGCTGGG + Intronic
973179187 4:47247251-47247273 CCTTTTCAACAAATGGTGCTGGG - Intronic
973244128 4:47991899-47991921 CCTTTTCAACAAATGGTGCTTGG - Intronic
973384246 4:49494017-49494039 TCTTTTCAACAAATGGTGCTGGG + Intergenic
973787445 4:54346370-54346392 CCTTTTCAACAAATGGTGCTGGG + Intergenic
973792195 4:54388658-54388680 CCTTTTCAACAAATGGTGCTGGG - Intergenic
974184262 4:58426216-58426238 GCTGTTCAACAAATGGTGCTGGG - Intergenic
974317453 4:60300360-60300382 TCCTATTAACAAATGGTGCTAGG + Intergenic
974327773 4:60437293-60437315 CCTTTTCAACAAATGGTGCTGGG + Intergenic
974458097 4:62154445-62154467 CCTTTTCAACAAATGGTGCTGGG + Intergenic
976240564 4:82951881-82951903 ACTTTTCAACAAATGGTGCTGGG + Intronic
976650712 4:87431174-87431196 TCTTTTCAACAAATGGTGCTAGG - Intronic
977554406 4:98474263-98474285 TCATTTCAACAAATGGTACTGGG - Intronic
977590320 4:98818872-98818894 TCTTTTCAATAGATGGTGCTGGG + Intergenic
977825939 4:101531683-101531705 CCTTTTCAACAAATGGTGCTGGG - Intronic
977906982 4:102488348-102488370 CCTTTTCAACAGATGGTCCTGGG + Intergenic
978122480 4:105097036-105097058 TCTTTTCAACAAATGGTGCTGGG + Intergenic
978726221 4:111972831-111972853 CCTTTTCAACAAATGGTGCTGGG - Intergenic
978999043 4:115194984-115195006 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979381693 4:120013927-120013949 TCTTTTCAACAAATGGTGCTGGG - Intergenic
979496407 4:121388363-121388385 GTCTTTCAACAAATGGTGCTGGG + Intergenic
979498002 4:121406591-121406613 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979590073 4:122468435-122468457 TCTTTTCAACAGATGGTGCTTGG + Intergenic
979614342 4:122725522-122725544 CCTAATCAACAAATGGTGCTGGG + Intergenic
979705903 4:123720285-123720307 CCTTTTCAACAAATGGTGCTGGG + Intergenic
979709750 4:123765332-123765354 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979794534 4:124830314-124830336 CCTTTTCAACAAATGGTGCTGGG - Intergenic
979995832 4:127429735-127429757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
980580445 4:134743622-134743644 TCTTTTCAACAAATGGTGCTAGG + Intergenic
981347102 4:143688784-143688806 CCTTTTCAACAAATGGTGCTGGG + Intronic
981626387 4:146760695-146760717 CCTTTTCAACAAATGGTGCTGGG + Intronic
981760352 4:148187952-148187974 ACATTTCAACAAATGGTGCTGGG - Intronic
981825241 4:148933073-148933095 CCTTTTCAACAAATGGTGCTGGG + Intergenic
981887037 4:149688860-149688882 CCTTTTCAACAAATGGTGCTGGG + Intergenic
982029805 4:151289144-151289166 TCATTTCAACAAATGATGCTGGG + Intronic
982119201 4:152124571-152124593 CCTTTTCAACAAATGGTGCTGGG - Intergenic
982189353 4:152838009-152838031 CCTTTTCAACAAATGGTGCTGGG - Intronic
982631041 4:157829456-157829478 CCTTTTCAACAAATGGTGCTGGG + Intergenic
982640758 4:157956953-157956975 CCTATTCAACAGATGGTGCTGGG + Intergenic
982679706 4:158414375-158414397 CCTTTTCAACAAATGGTGCTGGG - Intronic
982956355 4:161773103-161773125 TCTATTCAACAGATGGTGCTGGG + Intronic
983175303 4:164581213-164581235 CCTTTTCAACAAATGGTGCTGGG - Intergenic
983544477 4:168948598-168948620 CCTTTTCAACAAATGGTGCTGGG - Intronic
984527144 4:180871039-180871061 CCTTTTCAACAAATGGTGCTGGG - Intergenic
984724364 4:183006364-183006386 TCTTTTCAACAAATGGTGCTGGG + Intergenic
984852664 4:184167823-184167845 GCATATCAACAGATGGTGCTGGG + Intronic
1202768097 4_GL000008v2_random:169340-169362 TCTTTTCAACAAATGGTGCTGGG + Intergenic
985700129 5:1366126-1366148 TCTTTTCAACAAATGGTGCTGGG + Intergenic
987185533 5:15413862-15413884 CCTTTTCAACAGATAGTGCTGGG + Intergenic
987917773 5:24238067-24238089 GCATATCAAATAATGATGCTTGG + Intergenic
988652054 5:33163397-33163419 CCTTTTCAACAAATGGTGCTAGG - Intergenic
989028873 5:37096313-37096335 CCTTTTCAACAAATGGTGCTGGG + Intergenic
989390203 5:40892418-40892440 TCTTTTCAACAGATGGTGCTGGG + Intergenic
989533397 5:42535390-42535412 CCTTTTCAACAAATGGTGCTTGG - Intronic
990275311 5:54189552-54189574 TCTTTTCAACAGATGGTGCTAGG + Intronic
990673058 5:58154075-58154097 CCTTTTCAACAAATGGTGCTGGG + Intergenic
992289146 5:75266982-75267004 GGCTATCAACATGTGGTGCTGGG + Intergenic
992840342 5:80683919-80683941 TCTTTTCAACAAATGGTGCTGGG - Intronic
992892680 5:81218430-81218452 CCTTTTCAACAAATGGTGCTCGG - Intronic
993097860 5:83501522-83501544 TCTTTTCAACAAATGGTGCTGGG - Intronic
993445248 5:88003949-88003971 TCAATTCAACAAATGGTGCTGGG + Intergenic
993489781 5:88532945-88532967 TCTTTTCAACAAATGGTGCTAGG + Intergenic
993883486 5:93390339-93390361 ACTTTTCAACAAATGGTGCTGGG - Intergenic
993917456 5:93760660-93760682 CCTTTTCAACAAATGGTGCTGGG + Intronic
994555325 5:101292358-101292380 CCTATTCAACAGATGGTGCTGGG + Intergenic
994846952 5:105001796-105001818 CCAATTCAACAAATGGTGCTGGG - Intergenic
994875699 5:105418287-105418309 CCTTTTCAACAAATGGTGCTGGG + Intergenic
994883334 5:105526667-105526689 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995102057 5:108323844-108323866 CCTTTTCAACAAATGGTGCTGGG + Intronic
995134608 5:108667358-108667380 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995293351 5:110486549-110486571 CCTTTTCAACAAATGGTGCTGGG - Intronic
995472608 5:112518861-112518883 CCTTTTCAACAAATGGTGCTGGG - Intergenic
995729228 5:115219357-115219379 TCTTTTCAACAAATGGTGCTAGG + Intronic
996025714 5:118643421-118643443 CCTTTTCAACAAATGGTGCTGGG + Intergenic
997032643 5:130149127-130149149 ACACATCAATAAATGGTGCTGGG - Intronic
997797951 5:136829727-136829749 CCTTTTCAACAAATGGTGCTGGG - Intergenic
997895596 5:137713439-137713461 TCTTTTCAACAAATGGTGCTGGG + Intronic
998275477 5:140748643-140748665 GCAATTCAACAAATGATGCTGGG - Intergenic
998580390 5:143368148-143368170 TCTTTTCAACAAATGGTGCTGGG + Intronic
998776926 5:145614051-145614073 CCTTTTCAACAAATGGTGCTGGG - Intronic
998941273 5:147285211-147285233 CCTTTTCAACAAATGGTGCTGGG + Intronic
999343402 5:150793580-150793602 CCTTTTCAACAAATGGTGCTGGG + Intronic
999469792 5:151843830-151843852 TCTTCTCAACAAATGGTGCTGGG + Intronic
999484290 5:151979385-151979407 CCTTTTCAACAAATGGTGCTGGG - Intergenic
999526199 5:152408840-152408862 CCTTTTCAACAAATGGTGCTGGG - Intronic
999918730 5:156293551-156293573 TCATTTCAACAAATGGTGCTGGG - Intronic
1000024929 5:157350355-157350377 CCTTTTCAACAAATGGTGCTGGG - Intronic
1000713337 5:164607780-164607802 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1000757421 5:165179047-165179069 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1001071058 5:168585378-168585400 GCAATTAACCAGATGGTGCTAGG - Intergenic
1001830334 5:174781550-174781572 TCTTTTCAAAAGATGGTGCTGGG - Intergenic
1002910115 6:1483857-1483879 GCTTTTCAGCAAATGGTGCTGGG + Intergenic
1002965628 6:1963613-1963635 CCTTTTCAACAAATGGTGCTGGG - Intronic
1003029020 6:2584781-2584803 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1003063576 6:2882402-2882424 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1003582425 6:7352803-7352825 CCTTTTCAACAAATGGTGCTGGG + Intronic
1003597262 6:7485355-7485377 GCTTTTCAACAAATGGTGCTGGG - Intergenic
1003834403 6:10054003-10054025 TCTTTTCAACAAATGGTGCTGGG + Intronic
1003929907 6:10914255-10914277 CCTTTTCAACAAATGGTGCTGGG - Intronic
1004504231 6:16234730-16234752 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1005093930 6:22090665-22090687 TCATTTCAACAAATGATGCTGGG - Intergenic
1005625071 6:27654629-27654651 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1005770777 6:29068752-29068774 GCTATTCAACAGATGTTGCTGGG + Intronic
1005841377 6:29746410-29746432 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1006287803 6:33111180-33111202 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1006587348 6:35124747-35124769 TCTTTTCAACAAATGGTGCTGGG + Intronic
1006722480 6:36166027-36166049 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1006861416 6:37173941-37173963 GCATCTCATTAGATGGTGCTTGG + Exonic
1007891312 6:45295249-45295271 ACTTTTCAACAAATGGTGCTGGG + Intronic
1008121295 6:47620293-47620315 CCCTTTCAACAAATGGTGCTGGG - Intronic
1008313172 6:50003840-50003862 CCTTTTCAACAAATGGTGCTAGG + Intergenic
1008941006 6:57045962-57045984 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1008943958 6:57076714-57076736 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1009266734 6:61565076-61565098 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1009279995 6:61736715-61736737 GCATTTCAACAGATGGAAATGGG - Intronic
1009477980 6:64118446-64118468 GCTCTTCAACAAATGGTGCTGGG + Intronic
1010008593 6:71024442-71024464 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1010181399 6:73090643-73090665 CCTTTTCAACAAATGGTGCTGGG - Intronic
1011396072 6:86910057-86910079 GCTATTCAACAAATGGTGCTGGG + Intergenic
1011587751 6:88944997-88945019 TCATATCAGCAGAAGCTGCTGGG - Intronic
1011789329 6:90881038-90881060 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1011892912 6:92189633-92189655 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1012207997 6:96484979-96485001 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1012923149 6:105240488-105240510 CCTTTTCAACAGATGGTGCTGGG + Intergenic
1013143975 6:107369074-107369096 TCATATCAACCAATGGTGCTGGG + Intronic
1013182001 6:107725525-107725547 TCTTTTCAACAAATGGTGCTGGG + Intronic
1013270508 6:108541413-108541435 GCTTTTCAACAAGTGGTGCTGGG + Intergenic
1014229488 6:118887387-118887409 TCTTTTCAACAGATGCTGCTGGG + Intronic
1014235969 6:118955134-118955156 GTATCTGAACAGAAGGTGCTTGG - Intergenic
1014304444 6:119723041-119723063 CCTTCTCAACAAATGGTGCTAGG - Intergenic
1014324989 6:119982736-119982758 GCTTTTCAACAAATGGTGCTGGG - Intergenic
1014337238 6:120151924-120151946 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1014518717 6:122411660-122411682 TCTTTTCAACAAATGGTGCTGGG - Intronic
1014604294 6:123453010-123453032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1014658598 6:124137773-124137795 CCAATTCAACAAATGGTGCTGGG + Intronic
1015256733 6:131186050-131186072 GTCTTTCAACAAATGGTGCTAGG - Intronic
1015619226 6:135112632-135112654 GCTATTCAACAAATGGTGCTGGG + Intergenic
1015662852 6:135595612-135595634 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1015807747 6:137128772-137128794 GCTATTCAACAAATGGTGCTGGG - Intergenic
1015914347 6:138200583-138200605 CCTTTTCAACAAATGGTGCTGGG + Intronic
1016105667 6:140159084-140159106 GCACATCTTCAGATGGTGGTAGG + Intergenic
1016126108 6:140406364-140406386 ACTTTTCAACAAATGGTGCTTGG - Intergenic
1016152041 6:140752746-140752768 GCTTTTCAATAAATGGTGCTGGG - Intergenic
1016197047 6:141357043-141357065 CCTTATCAACAAATGGTGCTGGG - Intergenic
1016265279 6:142225618-142225640 GCATATTAACAGAAAGTGTTCGG - Intergenic
1016678217 6:146796622-146796644 ACTTTTCAACAAATGGTGCTGGG + Intronic
1016929281 6:149387343-149387365 TCTTTTCAACAAATGGTGCTGGG - Intronic
1016994203 6:149949783-149949805 CCAATTCAACAAATGGTGCTGGG + Intergenic
1017358437 6:153537516-153537538 GCACACCAACAGATGCTTCTAGG + Intergenic
1017374523 6:153752803-153752825 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1018010056 6:159661341-159661363 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG + Intronic
1019464394 7:1179263-1179285 TCTTTTCAACACATGGTGCTGGG - Intergenic
1019948723 7:4352431-4352453 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1020214020 7:6175367-6175389 CCTTTTCAACAAATGGTGCTGGG - Intronic
1021183699 7:17537953-17537975 CCTTTTCAACACATGGTGCTGGG + Intergenic
1021204697 7:17766284-17766306 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1021269049 7:18562490-18562512 GTTTTTCAACAAATGGTGCTGGG - Intronic
1022013968 7:26332803-26332825 TCCTTTCAACAAATGGTGCTGGG - Intronic
1022210519 7:28204586-28204608 TCTTATCAACAAATGGTGCTGGG + Intergenic
1022295759 7:29051010-29051032 CCTTTTCAACAAATGGTGCTGGG + Intronic
1022550139 7:31230468-31230490 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1022661226 7:32368903-32368925 TCTCATCAACAAATGGTGCTGGG + Intergenic
1023018758 7:35990866-35990888 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1023242798 7:38166474-38166496 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1023420427 7:39973816-39973838 TCTTTTCAACAAATGGTGCTGGG - Intronic
1023528485 7:41129791-41129813 GCATTCCAACACATGGTGCAGGG + Intergenic
1023748519 7:43346724-43346746 CCTTTTCAACAAATGGTGCTGGG - Intronic
1023979196 7:45057047-45057069 TCTTTTCAACAAATGGTGCTGGG - Intronic
1023985835 7:45095149-45095171 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1024098162 7:46002727-46002749 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1024126826 7:46307129-46307151 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024179276 7:46873496-46873518 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1024304879 7:47920800-47920822 TCTTTTCAACAAATGGTGCTGGG + Intronic
1024668890 7:51573040-51573062 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1027191482 7:75998652-75998674 TCATTTCAACAAATGGTGCTAGG + Intronic
1027349954 7:77301418-77301440 CCTTTTCAACAAATGGTGCTGGG - Intronic
1027589762 7:80103187-80103209 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1027650575 7:80862851-80862873 CCTTTTCAACAAATGGTGCTGGG + Intronic
1028193876 7:87882240-87882262 TCTTTTCAACAGCTGGTGCTGGG + Intronic
1028283440 7:88963425-88963447 TACTTTCAACAGATGGTGCTAGG + Intronic
1028499303 7:91500825-91500847 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028506423 7:91575890-91575912 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1028962435 7:96764105-96764127 TCATATCAACAACTGTTGCTGGG - Intergenic
1029340289 7:99937397-99937419 TCATTTCAACAAATTGTGCTGGG - Intergenic
1030085007 7:105808310-105808332 GCATTTCATCAAAGGGTGCTGGG + Intronic
1030130905 7:106198965-106198987 ACATATCAACAGAATGTGGTAGG - Intergenic
1030142154 7:106316014-106316036 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1030286267 7:107830033-107830055 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1030414532 7:109225662-109225684 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1030691070 7:112534339-112534361 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1030713460 7:112781660-112781682 TCTTTTCAACAAATGGTGCTGGG + Intronic
1031234752 7:119160420-119160442 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1031339830 7:120585488-120585510 GCAGAGAAACATATGGTGCTTGG + Intronic
1031459051 7:122022977-122022999 TCCTTCCAACAGATGGTGCTAGG + Intronic
1031542967 7:123017576-123017598 TCTTTTCAACAGATGCTGCTGGG - Intergenic
1031746149 7:125500717-125500739 TCTCATCAACAAATGGTGCTGGG - Intergenic
1031760706 7:125710070-125710092 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1031907628 7:127478682-127478704 TCAATTCAACAGATGGGGCTGGG + Intergenic
1032060553 7:128720696-128720718 TCTTTTCAACAAATGGTGCTAGG - Intronic
1032081428 7:128860380-128860402 GCATTTCAGCACATGGTGGTGGG + Intergenic
1032099802 7:128964850-128964872 TCTTTTCAACAAATGGTGCTGGG + Intronic
1033623720 7:143087678-143087700 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1033721761 7:144067244-144067266 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1034058545 7:148063962-148063984 CCTTTTCAACAAATGGTGCTGGG - Intronic
1034209496 7:149350592-149350614 TCGTTTCAACAGATGTTGCTGGG + Intergenic
1034229740 7:149513210-149513232 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1036109382 8:5880446-5880468 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1036215277 8:6874679-6874701 TCTTATCAACAGTTGGTTCTGGG + Intronic
1036617627 8:10400767-10400789 ACTTTTCAACAGATGGTGCTGGG + Intronic
1036743221 8:11385205-11385227 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1036939024 8:13033424-13033446 TCCTATCAGCAGATGGGGCTCGG - Intergenic
1037135955 8:15460761-15460783 CCTTTTCAACAAATGGTGCTGGG - Intronic
1037358505 8:18048275-18048297 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1038237469 8:25773942-25773964 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1038366839 8:26944867-26944889 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1039398878 8:37251046-37251068 TCTCTTCAACAGATGGTGCTAGG + Intergenic
1040064023 8:43129624-43129646 GCATTTCAACAAATAATGCTGGG - Intergenic
1040429838 8:47328589-47328611 TCTTTTCAACAAATGGTGCTGGG - Intronic
1040635272 8:49266051-49266073 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1041222620 8:55666651-55666673 TCTTTTCAACAAATGGTGCTAGG + Intergenic
1041228163 8:55721260-55721282 CCTTTTCAACAAATGGTGCTGGG + Intronic
1041395542 8:57387225-57387247 GCTTTTCAACAAATGGTGATGGG + Intergenic
1041577536 8:59416963-59416985 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1041589893 8:59565955-59565977 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1041877561 8:62707957-62707979 CCTTTTCAACAAATGGTGCTCGG - Intronic
1042115316 8:65425405-65425427 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1042663693 8:71182875-71182897 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1042928058 8:73987236-73987258 ACTTATCAATAGATGATGCTAGG - Intergenic
1043261314 8:78202182-78202204 CCCTTTCAACAAATGGTGCTGGG + Intergenic
1043471097 8:80563587-80563609 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1043568426 8:81573181-81573203 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1043628074 8:82289563-82289585 ACATTTCAACAAATGGTACTGGG - Intergenic
1043988277 8:86719905-86719927 CCTTTTCAACAAATGGTGCTGGG + Intronic
1044213226 8:89575344-89575366 GCCTTTCAACAAATGTTGCTAGG - Intergenic
1045072551 8:98524085-98524107 GCATTTCAGCAAATCGTGCTGGG - Intronic
1045537411 8:103044462-103044484 TCTTTTCAACAAATGGTGCTGGG - Intronic
1045788200 8:105950012-105950034 GAATATCAACAGAGGGTTCAAGG - Intergenic
1045881346 8:107044497-107044519 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1046075797 8:109310378-109310400 CCTTTTCAACAAATGGTGCTGGG + Intronic
1046225524 8:111273905-111273927 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1046417425 8:113936092-113936114 CCGTTTCAACAAATGGTGCTGGG + Intergenic
1046640465 8:116724215-116724237 TCTCTTCAACAGATGGTGCTAGG + Intronic
1046760950 8:118019857-118019879 GCCTTTCAATAAATGGTGCTTGG + Intronic
1046858442 8:119063168-119063190 GCACAAGAACAGATGTTGCTGGG + Intronic
1047357418 8:124136603-124136625 GGATATTAACAAAAGGTGCTGGG - Intergenic
1047530714 8:125672086-125672108 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1048562072 8:135550457-135550479 TCTTTTCAACATATGGTGCTAGG - Intronic
1049897744 9:125779-125801 CCTTTTCAACAAATGGTGCTGGG - Intronic
1050382669 9:5046627-5046649 GTCTTTCAACAAATGGTGCTAGG - Intronic
1050396129 9:5198325-5198347 GTTTTTCAACAAATGGTGCTGGG - Intergenic
1050635852 9:7611920-7611942 CCTTTTCAACAAATGGTGCTAGG - Intergenic
1050974305 9:11916993-11917015 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1051700617 9:19819107-19819129 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1052346968 9:27419563-27419585 CCTTTTCAACAAATGGTGCTGGG + Intronic
1052514232 9:29459647-29459669 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1052737853 9:32362808-32362830 CCAACTCAACAAATGGTGCTGGG + Intergenic
1053400932 9:37821540-37821562 CCTTTTCAACAAATGGTGCTAGG + Intronic
1053724330 9:40982770-40982792 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1053740833 9:41136069-41136091 CCTTTTCAACAAATGGTGCTGGG - Intronic
1054361853 9:64129877-64129899 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1054443821 9:65292214-65292236 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1054486452 9:65729289-65729311 CCTTTTCAACAAATGGTGCTGGG + Intronic
1054687518 9:68295230-68295252 CCTTTTCAACAAATGGTGCTGGG + Intronic
1055141180 9:72878822-72878844 CCTTTTCAACACATGGTGCTGGG + Intergenic
1055178868 9:73357833-73357855 AGATATCAACAGATGGCGGTTGG - Intergenic
1055199747 9:73646153-73646175 CCATTTCAACAGCTGGTGCCAGG - Intergenic
1055345925 9:75338800-75338822 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1055656789 9:78458480-78458502 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1056322325 9:85447560-85447582 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1056543656 9:87595345-87595367 TCATATAAAGAGATGCTGCTTGG - Intronic
1056698633 9:88882478-88882500 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1056734674 9:89198812-89198834 TCATTTCAACAAATGATGCTGGG + Intergenic
1057242640 9:93425398-93425420 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1057333286 9:94136367-94136389 GTCTTTCAACAAATGGTGCTGGG + Intergenic
1057378555 9:94546481-94546503 GGCTATCAACATGTGGTGCTGGG + Intergenic
1057609638 9:96529308-96529330 TCTTTTCAACAAATGGTGCTGGG - Intronic
1058084632 9:100735320-100735342 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058308012 9:103466999-103467021 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058631119 9:106987895-106987917 CCTTTTCAACAAATGGTGCTGGG - Intronic
1058721059 9:107764549-107764571 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1058992163 9:110264846-110264868 TCTTTTCAACAGATGATGCTAGG + Intergenic
1059075032 9:111183900-111183922 TCTTTTCAACACATGGTGCTGGG - Intergenic
1059397363 9:114045449-114045471 TCTTTTCAACAAATGGTGCTGGG - Intronic
1059493306 9:114688048-114688070 TCTTCTCAACAAATGGTGCTGGG - Intergenic
1059815609 9:117909769-117909791 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1060154674 9:121311066-121311088 ACATATGAACAGAAGGTGCCAGG - Intronic
1062133339 9:134912166-134912188 GCAGATCAACAGCTGGAGATGGG + Intronic
1062223694 9:135436247-135436269 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203692503 Un_GL000214v1:58246-58268 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203706551 Un_KI270742v1:54346-54368 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1203556686 Un_KI270744v1:5138-5160 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1203643792 Un_KI270751v1:45945-45967 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1187099186 X:16174623-16174645 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1187100850 X:16189823-16189845 GCATCTCAATAGAGGGTGTTAGG + Intergenic
1187218753 X:17303041-17303063 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187228820 X:17401149-17401171 TCTTTTCAACAAATGGTGCTGGG + Intronic
1187375673 X:18751421-18751443 TCTCTTCAACAGATGGTGCTGGG - Intronic
1187421901 X:19142448-19142470 CTATTTCAACAAATGGTGCTGGG + Intergenic
1187451886 X:19404776-19404798 TCTTTTCAACAAATGGTGCTAGG + Intronic
1187636423 X:21234063-21234085 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1187639207 X:21269303-21269325 CCATTTCAATAAATGGTGCTGGG - Intergenic
1188040057 X:25361469-25361491 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1188045483 X:25421590-25421612 GCTTTTCAACAAATGGTGCTGGG - Intergenic
1188260939 X:28023186-28023208 TCTTTTCAACAGATGATGCTAGG - Intergenic
1188363801 X:29289312-29289334 CCTTTTCAACAAATGGTGCTGGG - Intronic
1188376883 X:29442318-29442340 CCTTTTCAACAAATGGTGCTGGG + Intronic
1188500417 X:30819766-30819788 GCTATTCAACAAATGGTGCTGGG - Intergenic
1188524421 X:31073706-31073728 TCTTCTCAACAAATGGTGCTAGG - Intergenic
1189200600 X:39192751-39192773 GCATGTCAAAAGAAGGTTCTAGG + Intergenic
1189218567 X:39349536-39349558 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189218787 X:39352171-39352193 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1189414121 X:40799636-40799658 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1189567455 X:42257860-42257882 ACAGATCAACAAATGATGCTGGG + Intergenic
1189733554 X:44046969-44046991 CCTAATCAACAAATGGTGCTGGG - Intergenic
1189878701 X:45466419-45466441 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1189963510 X:46348608-46348630 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1190001582 X:46693491-46693513 TCTTTTCAACAAATGGTGCTGGG + Intronic
1190631781 X:52394330-52394352 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1190704351 X:53014051-53014073 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1190723970 X:53174549-53174571 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1190724937 X:53183066-53183088 TCTCTTCAACAGATGGTGCTGGG - Intergenic
1190967531 X:55315105-55315127 CCACTTCAACAAATGGTGCTGGG - Intergenic
1191012951 X:55779735-55779757 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1191100693 X:56724219-56724241 CCTAATCAACAAATGGTGCTGGG + Intergenic
1191209975 X:57874697-57874719 GCTTTTCAATAAATGGTGCTTGG + Intergenic
1191743290 X:64458843-64458865 TCATATTAATAAATGGTGCTAGG - Intergenic
1191905853 X:66089223-66089245 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1192384995 X:70658966-70658988 TCTTTTCAACAAATGGTGCTGGG + Intronic
1192671360 X:73145527-73145549 TCATTTCAATAAATGGTGCTGGG - Intergenic
1193102049 X:77625152-77625174 CCTTTTCAACAAATGGTGCTGGG + Intronic
1193402110 X:81057617-81057639 GCATAGCAACATCTGGTTCTGGG + Intergenic
1193421532 X:81289184-81289206 TCACTTCAATAGATGGTGCTGGG + Intronic
1193422605 X:81300969-81300991 TCATTTCAGCAAATGGTGCTTGG - Intergenic
1193423378 X:81311629-81311651 CCCTTTCAACAAATGGTGCTGGG - Intergenic
1193578901 X:83237334-83237356 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193589940 X:83376753-83376775 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1193676595 X:84461430-84461452 CCTTTTCAACAAATGGTGCTAGG + Intronic
1193779518 X:85685318-85685340 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1193826092 X:86229199-86229221 CCTTTTCAACAAATGGTGCTGGG - Intronic
1193864804 X:86718710-86718732 CCTTTTCAACAAATGGTGCTGGG - Intronic
1194070001 X:89310705-89310727 TCATTTTAACAAATGGTGCTAGG - Intergenic
1194543078 X:95199024-95199046 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194601728 X:95929475-95929497 CCTATTCAACAGATGGTGCTGGG + Intergenic
1194637847 X:96367374-96367396 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1194956029 X:100181584-100181606 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1195019650 X:100813963-100813985 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1195253149 X:103067728-103067750 TCTTTTCAACAAATGGTGCTTGG - Intergenic
1195266630 X:103187376-103187398 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1195530003 X:105943267-105943289 TCTTTTCAACAAATGGTGCTGGG - Intronic
1195556897 X:106237001-106237023 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1195717927 X:107836093-107836115 TCTTTTCAACAAATGGTGCTTGG - Intronic
1195800696 X:108706065-108706087 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1195913003 X:109907672-109907694 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1195917457 X:109949655-109949677 TCTTTTCAATAGATGGTGCTGGG + Intergenic
1195935596 X:110123144-110123166 TCTTTTCAACAAATGGTGCTGGG - Intronic
1196111214 X:111949096-111949118 CCTTTTCAACAAATGGTGCTGGG + Intronic
1196362564 X:114881572-114881594 TCTTTTCAACAAATGGTGCTAGG - Intronic
1196383102 X:115115460-115115482 TCTTATCAACAAATGGTGCTGGG + Intronic
1196465232 X:115965554-115965576 ACTTTTCAACAAATGGTGCTGGG + Intergenic
1196590140 X:117477673-117477695 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1196708085 X:118733852-118733874 TCTTTTCAACAAATGGTGCTGGG - Intronic
1196737989 X:118997380-118997402 CCTTTTCAACAAATGGTGCTGGG + Intronic
1196947836 X:120845505-120845527 ACTTTTCAACAAATGGTGCTAGG - Intergenic
1197065783 X:122232578-122232600 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197145101 X:123163294-123163316 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1197308063 X:124868387-124868409 GCACGTCAATAAATGGTGCTGGG + Intronic
1197525560 X:127557942-127557964 CCATTTCAACAAATGGTGCTGGG - Intergenic
1197711161 X:129669389-129669411 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1197739937 X:129882902-129882924 TCTTTTCAACAAATGGTGCTAGG - Intergenic
1197861213 X:130972707-130972729 TCCTTTCAACAAATGGTGCTGGG - Intergenic
1198313339 X:135441665-135441687 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1198367457 X:135956016-135956038 TCTTCTCAACAAATGGTGCTAGG + Intergenic
1198444875 X:136703001-136703023 AGAAATCAACAAATGGTGCTGGG + Intronic
1198616900 X:138468108-138468130 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1198668692 X:139053987-139054009 CCTTTTCAACAAATGGTGCTGGG - Intronic
1199007985 X:142724660-142724682 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199088485 X:143662222-143662244 TCATTTCAAAACATGGTGCTGGG + Intergenic
1199259668 X:145757154-145757176 TCATTTCAATAAATGGTGCTAGG + Intergenic
1199421072 X:147644987-147645009 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199521098 X:148736847-148736869 CCTTTTCAACAAATGGTGCTGGG - Intronic
1199618091 X:149674720-149674742 TCTTTTCAACAAATGGTGCTGGG + Intergenic
1199624551 X:149728529-149728551 TCTTTTCAACAAATGGTGCTGGG - Intergenic
1199668953 X:150125756-150125778 CCTTTTCAACAAATGGTGCTGGG + Intergenic
1199749193 X:150798443-150798465 TCTTTTCAACAAATGGTGCTGGG + Intronic
1199821312 X:151451123-151451145 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200313967 X:155111519-155111541 GCAATTCAACAAATGGTGCTGGG + Intronic
1200317704 X:155151054-155151076 CCTTTTCAACAAATGGTGCTGGG - Intergenic
1200724240 Y:6646339-6646361 TCATTTTAACAAATGGTGCTAGG - Intergenic
1200982774 Y:9277478-9277500 GTAAATCAACAGATGGTAATGGG - Intergenic
1202035209 Y:20626459-20626481 TCTTATCAACAAATGGTGCTGGG - Intergenic
1202127611 Y:21582199-21582221 GTAAATCAACAGATGGTAATGGG + Intergenic
1202151657 Y:21849282-21849304 GTAAATCAACAGATGGTAATGGG - Intergenic