ID: 984854569

View in Genome Browser
Species Human (GRCh38)
Location 4:184183707-184183729
Sequence ATGCATATCAATAAGTCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984854567_984854569 24 Left 984854567 4:184183660-184183682 CCACAGACTAAGTTCAATCATAT 0: 1
1: 0
2: 1
3: 8
4: 137
Right 984854569 4:184183707-184183729 ATGCATATCAATAAGTCACATGG No data
984854566_984854569 25 Left 984854566 4:184183659-184183681 CCCACAGACTAAGTTCAATCATA 0: 1
1: 0
2: 1
3: 12
4: 116
Right 984854569 4:184183707-184183729 ATGCATATCAATAAGTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984854569 Original CRISPR ATGCATATCAATAAGTCACA TGG Intronic
No off target data available for this crispr