ID: 984855465

View in Genome Browser
Species Human (GRCh38)
Location 4:184191405-184191427
Sequence GCTCCCTGCTTGACTGAATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 117}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984855465 Original CRISPR GCTCCCTGCTTGACTGAATC CGG Intronic
900898663 1:5502120-5502142 TCACCCTGCTTGAGAGAATCAGG - Intergenic
902970508 1:20044777-20044799 GCACCCTGCCAGGCTGAATCAGG - Intronic
905974910 1:42167888-42167910 GCTCCATGCTAGACTGGAGCCGG + Intergenic
906928168 1:50141465-50141487 TCTCACTGCTTCACTGAGTCAGG - Intronic
909729300 1:78873585-78873607 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
909768759 1:79392365-79392387 AGTCTCTGCTTGACTGAATAGGG - Intergenic
910602023 1:89042756-89042778 GCTCCCTGCGAGGCTGAAACTGG + Intergenic
912857943 1:113188390-113188412 GCACACTGCTTGTCTGAGTCTGG - Intergenic
915381798 1:155448436-155448458 GCTACCTGCGTGACTGAGGCAGG - Intronic
915668581 1:157467300-157467322 GCTTGCTTCTTGCCTGAATCAGG - Intergenic
915873350 1:159585785-159585807 AATCCCTTCTAGACTGAATCTGG - Intergenic
916941704 1:169684511-169684533 GCTCCCCGCCAGGCTGAATCAGG + Intronic
918104362 1:181403813-181403835 GCTTCCGGGTTGATTGAATCTGG + Intergenic
921812952 1:219535306-219535328 CCCTCCTGCTTGACTGAACCTGG + Intergenic
922292789 1:224222557-224222579 GCTTCCTGCATGCCAGAATCCGG + Intergenic
922845543 1:228681351-228681373 GCTCCCCGCCAGGCTGAATCAGG - Intergenic
1070806105 10:79271650-79271672 GCTGCCTGCTTCACTGGATATGG - Intronic
1075016257 10:118911974-118911996 GCTCCATGCTTGGGTGACTCAGG - Intergenic
1081159569 11:39735694-39735716 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1082197845 11:49325472-49325494 ACTCCCTGCCAGGCTGAATCAGG - Intergenic
1085186454 11:74579943-74579965 GCACCCTGCTTGGCTAAAACTGG - Intronic
1085410387 11:76287358-76287380 GCTCCCTGCTTGCCTTGCTCTGG - Intergenic
1086644904 11:89208370-89208392 GCTCCTTGCTTGACTGAAATAGG - Intronic
1086657972 11:89382654-89382676 ACTCCCTGCCAGGCTGAATCAGG + Intronic
1091168981 11:133503980-133504002 GGCCCGTGCTTGTCTGAATCTGG - Intronic
1091929071 12:4380006-4380028 GTTGACTGCTTGACTGAAGCTGG - Intergenic
1092776729 12:11950168-11950190 GCTCCCAGCTTTCCTGACTCGGG + Intergenic
1093764862 12:22951910-22951932 GCTCCCTGCAAGACTGCAGCTGG + Intergenic
1095999172 12:48114522-48114544 GCTCCCCGCCAGGCTGAATCAGG - Intronic
1097694100 12:62760429-62760451 GCTCCCTGCCAGGTTGAATCAGG + Intronic
1097710841 12:62915377-62915399 GCTCCCTGCGTGGTTCAATCAGG + Intronic
1101295554 12:103419837-103419859 AGCCCCTGCTTGACTGAAACTGG - Intronic
1102604333 12:114057147-114057169 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1104874178 12:132021474-132021496 GCTCCCTGCTAGACTCATGCCGG - Intronic
1108049191 13:46413625-46413647 GCTCTCTGCTTGACTGTTGCTGG - Intronic
1109541711 13:63786898-63786920 GCTCTCTGCTTGACTGTTGCTGG - Intergenic
1112762180 13:102703772-102703794 TCTGCCTGCTTGCCTGACTCAGG - Intergenic
1113818479 13:113193016-113193038 CCTCCCTGCCTGACTTGATCTGG + Intronic
1114344629 14:21781743-21781765 GCTCCCTGCCAGGCTGAAGCTGG - Intergenic
1116210651 14:41938599-41938621 GCTGCTTTCTTCACTGAATCAGG + Intergenic
1120888398 14:89469950-89469972 CCTGCCTGCATGACTGAAGCTGG - Intronic
1121615180 14:95309044-95309066 TCTCCCTCCTTGACTGAACGCGG - Intronic
1122822389 14:104354148-104354170 ACTCCCTGCTTGAAGGACTCTGG - Intergenic
1128841838 15:70856778-70856800 GCTCCCTGCTAGACAAAATCGGG - Intronic
1129845395 15:78765706-78765728 GCTCCCAGCCTGGCTGAAGCGGG - Exonic
1135160357 16:20089284-20089306 TTACCATGCTTGACTGAATCAGG + Intergenic
1139465410 16:67151336-67151358 GCACCCTGCCTGATGGAATCAGG - Intergenic
1140103600 16:71939152-71939174 GCTCCCTGAAAGACTGAAGCTGG - Intronic
1141513052 16:84525050-84525072 TCTCCCTGCAAGACAGAATCTGG + Intronic
1150107431 17:62472624-62472646 GCTCCTTGCTAGGCTGAAGCAGG + Intronic
1152026657 17:77814055-77814077 GCCCCCTCCTTGACTGATTCTGG + Intergenic
1152242829 17:79169187-79169209 CCCCCCTGCATGTCTGAATCAGG - Intronic
1152706616 17:81846837-81846859 GCTGCCTGCTGGACTGGATCGGG - Intronic
1156915729 18:42463214-42463236 ACTCCCTGCCAGGCTGAATCAGG + Intergenic
1159334439 18:67044471-67044493 GCTCCCTGTGTGACTGCAGCTGG - Intergenic
1166826729 19:45614481-45614503 GCTCACTGCTTTACTGCATGTGG - Intronic
929021721 2:37560037-37560059 GCTCCCTTCTTGGCTGTATATGG + Intergenic
930099206 2:47590072-47590094 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
931005717 2:57849000-57849022 GCTCCCTGCAAGACTGCAGCTGG + Intergenic
932054609 2:68431929-68431951 GCTCCCTGCAAGGCTGCATCTGG + Intergenic
934990967 2:98921266-98921288 GCGCCCTGCCAGACTGACTCAGG - Intronic
936275311 2:111091051-111091073 GCTCCCTGCTTGCCTCACTATGG + Intronic
936348625 2:111695237-111695259 GATCCGTGTTTGACTGAATAGGG + Intergenic
936689452 2:114869345-114869367 GCTCCCAGCTTGTCTGAGTCTGG + Intronic
938708452 2:133954595-133954617 GCTCCCTGTTTACCTGAGTCAGG + Intergenic
940563177 2:155327662-155327684 GCTCCCAGCTTGACTGCTACTGG - Intergenic
941745420 2:169081753-169081775 GCTGCCTGTCTGACTGAATCAGG + Exonic
942867932 2:180698911-180698933 GCTGCCTGCTCGGCTGCATCTGG - Intergenic
944250943 2:197579784-197579806 GCTCCCTGCCAGGCTGAATCAGG + Intronic
1169018059 20:2307888-2307910 GCACACTGCTTGACTGTATTAGG - Intronic
1170398653 20:15956435-15956457 GCTCTCTGAGTGACAGAATCTGG - Intronic
1170523092 20:17208804-17208826 TCTCCCTGGTTGAAAGAATCAGG - Intergenic
1172522776 20:35579078-35579100 GATCCCTTCTTGGCTGAAGCGGG - Intergenic
1173906280 20:46632005-46632027 GCTCCCTGCTGGGCTGCAGCTGG + Intronic
1177063108 21:16397398-16397420 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
1181547039 22:23607990-23608012 TCTCGCTGCATGAATGAATCAGG + Intergenic
953727882 3:45416434-45416456 TCTCACGGCTTGCCTGAATCCGG - Intronic
953728796 3:45427113-45427135 TCTCTCTTCCTGACTGAATCAGG + Intronic
956233584 3:67042744-67042766 ACTCCCTGCCAGGCTGAATCAGG - Intergenic
958421868 3:93939446-93939468 GCTCCCCGCCAGGCTGAATCAGG + Intronic
961192568 3:124974349-124974371 TCCCCCAGATTGACTGAATCAGG + Intronic
962022265 3:131513140-131513162 ACTCCCTGCAAGGCTGAATCAGG - Intergenic
962982008 3:140499178-140499200 GCTCCCTGCTTTTCAGAGTCAGG - Intronic
967042389 3:185705543-185705565 GTTCACTGCTTGAATGAAACAGG + Intronic
968900111 4:3426954-3426976 GCTCCCTGCGTGACATCATCAGG - Intronic
974173508 4:58295363-58295385 GCTCCCTGCCAGGCTGAATCAGG - Intergenic
978637019 4:110821784-110821806 TCACCCAGCTTGTCTGAATCAGG + Intergenic
982115296 4:152093967-152093989 TCCCCCTGCATGACTGAATCAGG - Intergenic
983751990 4:171285274-171285296 GTTACCAGCTTGTCTGAATCTGG - Intergenic
984169335 4:176342669-176342691 GCTCCCTGCTAGACTGTGGCTGG + Intergenic
984855465 4:184191405-184191427 GCTCCCTGCTTGACTGAATCCGG + Intronic
994833990 5:104824799-104824821 ACTCATTGCTTGACTGAATATGG + Intergenic
999038819 5:148384245-148384267 GTTGCCTGCTTGTCTGAACCTGG + Intronic
999664560 5:153899034-153899056 GCTCCCAGATTGTCTGATTCAGG + Intergenic
1000782332 5:165497902-165497924 TCCCCCTGCTGGACTTAATCAGG + Intergenic
1001354607 5:171007422-171007444 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1006048902 6:31324817-31324839 GCCCCCTCCATGACTGAACCAGG + Intronic
1006987707 6:38187584-38187606 GCTCCCTGCTCGCCTGGCTCTGG - Intronic
1007454603 6:41966699-41966721 GCTCCCTTCTAGACTGGATGTGG + Intronic
1010109779 6:72212911-72212933 TCTCCTTGCATGACTGACTCAGG - Intronic
1012660064 6:101877266-101877288 GATCCCTAGTTGATTGAATCTGG - Intronic
1017774793 6:157672574-157672596 GCTCCCTGCCTGGCTGACTGAGG + Intronic
1018614026 6:165669041-165669063 GCTCCCGTCTAGACTGAGTCAGG + Intronic
1019627666 7:2028626-2028648 CCTCTCTGCTTGTCTGCATCAGG - Intronic
1021781311 7:24109333-24109355 TCTCCCTGGTGAACTGAATCAGG - Intergenic
1029381217 7:100216044-100216066 ACTCCCATCTGGACTGAATCTGG - Intronic
1029400596 7:100342995-100343017 ACTCCCGTCTTGACTGAGTCTGG - Intronic
1029447267 7:100620787-100620809 GCTCCTCGCTTGAATGATTCAGG - Exonic
1030445864 7:109646156-109646178 GCTCCCCGCCAGGCTGAATCAGG - Intergenic
1038479859 8:27894469-27894491 GCTCCAGTCTTGACTGTATCTGG + Intronic
1039059146 8:33559808-33559830 CATCCCTGCCTAACTGAATCAGG + Intronic
1039594442 8:38778681-38778703 GCTTCCTGCTTCACAAAATCAGG + Intronic
1042705997 8:71666064-71666086 GCTCCGTGCCAGGCTGAATCAGG + Intergenic
1047256906 8:123220787-123220809 GCTCCCTACTGGTCAGAATCAGG + Intronic
1049121284 8:140740391-140740413 GCTCCATGCTCTTCTGAATCAGG - Intronic
1049265936 8:141667939-141667961 TCACTCTGCTTGAGTGAATCAGG + Intergenic
1049373654 8:142279231-142279253 GCTCACCGCTGGACTGCATCTGG + Intronic
1051356166 9:16241358-16241380 GCTCCATGCCTGGCTGATTCAGG - Intronic
1055445252 9:76375979-76376001 GCTCCCTTATTTACTGCATCTGG + Intergenic
1057496472 9:95565070-95565092 GCTCCCTGCTGGGCTGAACGTGG - Intergenic
1057510727 9:95677834-95677856 GCTCCCTGCAAGACTGCATCTGG + Intergenic
1060479022 9:124007141-124007163 ACTCCCTGCTTTGCTGAATGAGG + Intronic
1062691430 9:137844045-137844067 GCTCCCCGCCAGGCTGAATCAGG + Intronic
1186264072 X:7812613-7812635 GCTCCCTGCTTGGATGAACTAGG + Intergenic
1186493849 X:9996391-9996413 AATCCCTGGTTGATTGAATCTGG - Intergenic
1188201094 X:27293551-27293573 GCTCCCTGCCAGACTGAATCAGG - Intergenic
1188265424 X:28067382-28067404 GTTCCCTGCAAGACTGAGTCAGG - Intergenic
1188890960 X:35610756-35610778 GCTCCCCGCCAGGCTGAATCAGG + Intergenic
1189031902 X:37459852-37459874 GCTCCCTGCCAGGCTGAATCAGG - Intronic
1190010474 X:46780412-46780434 GCTCCCTGCTGGACTGGCTAAGG + Intergenic
1192764741 X:74129219-74129241 GCTCCTTGCCAGGCTGAATCAGG - Intergenic
1194871354 X:99136167-99136189 GCTGCCTGCTTGACTGACAGCGG + Intergenic
1201540757 Y:15102638-15102660 ACTCCCTGCCAGGCTGAATCAGG - Intergenic