ID: 984856311

View in Genome Browser
Species Human (GRCh38)
Location 4:184199044-184199066
Sequence CTCTGGTCACATATGCTTCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984856311_984856315 0 Left 984856311 4:184199044-184199066 CCACGAAGCATATGTGACCAGAG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 984856315 4:184199067-184199089 ACCAAGGGAACACGCATGAATGG 0: 1
1: 0
2: 0
3: 3
4: 84
984856311_984856317 15 Left 984856311 4:184199044-184199066 CCACGAAGCATATGTGACCAGAG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 984856317 4:184199082-184199104 ATGAATGGTTTTAACATAACTGG 0: 1
1: 0
2: 1
3: 31
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984856311 Original CRISPR CTCTGGTCACATATGCTTCG TGG (reversed) Intronic
900631450 1:3638291-3638313 CACTGGTCACATATCCCTCTGGG + Intronic
900823809 1:4910492-4910514 CTCTGGACACTGAGGCTTCGTGG - Intergenic
901215987 1:7555665-7555687 CTCTGGTCACATTTGCAGCCTGG + Intronic
903719697 1:25395610-25395632 CTCTGGTGACATTTTCTTCCTGG + Intronic
909432986 1:75611398-75611420 TTCTTGTCACAAATGCTTAGGGG + Intergenic
917825726 1:178818455-178818477 CTCTGGTCACAAATGACTCAGGG + Intronic
1062962571 10:1584344-1584366 CTCTAGTGACATATGATACGGGG - Intronic
1063570758 10:7212738-7212760 CTGTAGGCACATATGCTTCCTGG - Intronic
1071462858 10:85914933-85914955 CTCTGCCCACATATCCTTTGAGG - Intronic
1072556067 10:96514253-96514275 CTCTGGCCACGTGTGCATCGGGG - Intergenic
1073351023 10:102819882-102819904 CTCTGTGCACACATGCTTCGTGG - Intergenic
1089800909 11:121025803-121025825 CACAGGTCAAATATGCTACGTGG - Intronic
1091082653 11:132686173-132686195 ATCTGCACACATCTGCTTCGGGG - Intronic
1097829878 12:64212966-64212988 CTGTGGTCACAGCTGCTTGGTGG + Intronic
1100082472 12:90869734-90869756 CTCTGGTCACATGTGTTTACTGG - Intergenic
1101474739 12:105034302-105034324 CTCTTGTCACAAATTCGTCGTGG + Exonic
1103875859 12:124126703-124126725 CAATGGTCACATATGGCTCGAGG - Intronic
1105265505 13:18810732-18810754 CTCTGGGCACATATGCAGGGAGG - Intergenic
1107037577 13:35917415-35917437 CTGTGGTCAGTGATGCTTCGGGG + Intronic
1111223612 13:85239931-85239953 CTGTGGTCACAGCTACTTCGGGG - Intergenic
1111297404 13:86299255-86299277 CTCTGGCCTCATATGCTTCTTGG + Intergenic
1119886948 14:78151417-78151439 CTCTGCTCACAAAGGCTTGGAGG - Intergenic
1120628849 14:86864194-86864216 CTCTGGTCAGATAAGTTTCCAGG + Intergenic
1123919708 15:25061758-25061780 TTCTGGCCACATATGCTTTTAGG + Intergenic
1124048133 15:26169931-26169953 CTCTTGTCACCTATGCTTCCTGG + Intergenic
1124319262 15:28700818-28700840 CTCTGTTCACGTATTCTTTGAGG - Intergenic
1125214673 15:37257538-37257560 CTTTGGTCACCTGTGCTTCTGGG - Intergenic
1125343637 15:38697874-38697896 CTCTGGTCTCAAGTGCTTCTTGG + Intronic
1139713326 16:68792963-68792985 TTCTGGGCACATATGTTTGGGGG + Intronic
1140546167 16:75811636-75811658 TTCTGATCACATCTCCTTCGAGG + Intergenic
1147056875 17:37841577-37841599 GTCTGGTCACAGATGTTTTGTGG - Intergenic
1149554320 17:57562283-57562305 CTCTAGACACATAAGCTTCTTGG - Intronic
1153604668 18:6819806-6819828 CTCTGGTTTCAAATGCTTCAAGG - Intronic
1154505530 18:15036926-15036948 CTCAGGTCACTTATGCTTGTGGG - Intergenic
1157260758 18:46174057-46174079 CTCTGGTGACATTTTCTTGGGGG + Exonic
1157925330 18:51758828-51758850 ATCTGGTCACATAATCTTAGGGG + Intergenic
1160147834 18:76379057-76379079 CTCTGGCCACCTGTGCTGCGGGG - Exonic
1163494891 19:17640622-17640644 CCCTGGGCACATATACTTGGAGG + Exonic
929565466 2:42981202-42981224 ATGTGGTCACTTATGCTTCTGGG + Intergenic
930290563 2:49488119-49488141 CTCTGGTCACATAATTTTTGAGG + Intergenic
932488291 2:72100817-72100839 TTCTGTTTACATATGTTTCGAGG + Intergenic
933379795 2:81527989-81528011 CTCAGGTAGCATATGCTTCTAGG - Intergenic
937829362 2:126403012-126403034 CTCTGGTCACCTCTGCCTCCAGG - Intergenic
938504719 2:131867190-131867212 CTCAGGTCACTTATGCTTGTGGG - Intergenic
942185772 2:173423510-173423532 CTGTGGTCACAAATTCTTTGAGG + Intergenic
944493262 2:200280188-200280210 TTCTGGTCACATATTCATCTAGG - Intergenic
945607189 2:211949378-211949400 CTCAGGTCACATATGACTAGTGG - Intronic
949065045 2:241985249-241985271 CCCCGGCCTCATATGCTTCGTGG + Intergenic
1171317855 20:24211306-24211328 CTCGGGTCACATATGCACCACGG - Intergenic
1173162267 20:40661916-40661938 CCCTGGTCAAAGATGCTTCATGG + Intergenic
1175033615 20:55978953-55978975 CTCTTGTCACTAATGCTTTGTGG - Intergenic
1175439361 20:58980142-58980164 CTCTGGGCACTTTTGCTTTGTGG + Intergenic
1176792330 21:13332192-13332214 CTCAGGTCACTTATGCTTGTGGG + Intergenic
1177991727 21:28043058-28043080 CTCAGGTCACTTATGCTTCTGGG + Intergenic
1178090465 21:29157646-29157668 CTATCATCACATATGCTTAGTGG + Intronic
1179973636 21:44850564-44850586 CTCTGGACACACCTGCTTCCGGG + Exonic
955045796 3:55358391-55358413 CTGTGCTCACATCTGCTTAGTGG - Intergenic
963423893 3:145097711-145097733 CTGTGGTGACATCTGCTGCGTGG + Intergenic
971654372 4:29323573-29323595 CTCTGCTCAGATAAGCTCCGTGG - Intergenic
975369082 4:73563097-73563119 CTCTCGTCACCTATGCTTATGGG + Intergenic
982617735 4:157662592-157662614 CCCTGGTTACATATGCTACAAGG + Intergenic
984856311 4:184199044-184199066 CTCTGGTCACATATGCTTCGTGG - Intronic
996929949 5:128874371-128874393 CTCTGGTTACAAATTCTTAGAGG + Intronic
1002183989 5:177445680-177445702 CTTTGGTCACAGTTGCTTCCAGG - Intergenic
1003115880 6:3283723-3283745 CTCTGGACACATCAGCTTCGTGG - Intronic
1003924243 6:10861941-10861963 CTCTGGGCACATTTGCTGTGGGG + Intronic
1007056427 6:38890252-38890274 CTAAGCTCACATATGCTTCAGGG + Intronic
1014327838 6:120021102-120021124 CTTTTGTCACTTATGCTTTGGGG - Intergenic
1015030738 6:128592150-128592172 CTTTGGTTACCTATGCTTCTGGG - Intergenic
1017043169 6:150324121-150324143 CTTTGGTCACAGATGCCTGGGGG - Intergenic
1017239802 6:152155171-152155193 CTCTGGTCAAATTTGGCTCGAGG - Intronic
1029995113 7:105000320-105000342 CTCTGGTCACAGAGGCTTGAGGG + Intergenic
1031351318 7:120734977-120734999 CTCTGGACAAATATGCTGTGTGG - Intronic
1037279995 8:17229507-17229529 GTCTGGTCACATATTCTGCATGG + Exonic
1037501146 8:19486532-19486554 CTCTGGGCAGGAATGCTTCGAGG - Intronic
1041671071 8:60492473-60492495 CTCTGGACACCTAGGCTTGGAGG - Intergenic
1041729879 8:61052634-61052656 CTCAGGTCACATGGGCTTCCTGG - Intergenic
1042106537 8:65333404-65333426 CTGTGTTCACATATGCCTCTCGG - Intergenic
1046973338 8:120246953-120246975 TGCTGTTCACATATGCTTAGTGG + Intronic
1049193942 8:141305366-141305388 CTCTGGTCAAATCTGTTTCCTGG + Intronic
1054726220 9:68653341-68653363 CTGTGGTCACAAATTCTTAGAGG - Intergenic
1056000083 9:82206016-82206038 GTCTGCTCACATAAGCTTCCTGG + Intergenic
1057928328 9:99171771-99171793 TTCTGGTCACATATTCTCCGTGG + Intergenic
1058252828 9:102722993-102723015 CTTTGGTCACTTGTGCTTTGAGG - Intergenic
1186514546 X:10156825-10156847 CTCTGGACACGAATGCTCCGGGG + Intergenic
1191706890 X:64103289-64103311 CTCTGGTCAGAGATGCTGTGGGG - Intergenic
1192303775 X:69935759-69935781 GTCTGGTCACATATTCTGCATGG + Intronic
1193183575 X:78486541-78486563 CTCCTGTCACATATCCTGCGAGG - Intergenic
1193572310 X:83159816-83159838 CTTTGGGCACCTATGCTTTGTGG - Intergenic
1196009548 X:110872332-110872354 CTCTGGGCACATATGCACCATGG - Intergenic
1196891716 X:120297751-120297773 CACTGGTCACAAATGCAGCGAGG - Intronic
1198367869 X:135960381-135960403 GTCTGGTTAGATATGCTTCTGGG - Intergenic